version

Summary of OsREG638 (All List)

OrganismOryza sativa  
IDOsREG638  
SequenceGGGCCAGA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count867  

Entry Sequences (867 entries)

LocusGene modelSequenceDescription
Os01g0153700AK105875GGGCCAGAConserved hypothetical protein. 
Os01g0246100AK120732TCTGGCCCATCCACTGACProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0276700AK059579GGGCCAGANONE 
AK100799GGGCCAGANONE 
J023121F22GGGCCAGANONE 
Os01g0327600AK120216TCTGGCCCAATNONE 
AK121799TCTGGCCCAATConserved hypothetical protein. 
J065081I07TCTGGCCCAATNONE 
J065082D04TCTGGCCCAATNONE 
J065082G10TCTGGCCCAATNONE 
J065085G24TCTGGCCCAATNONE 
J065105J24TCTGGCCCAATNONE 
J065128D18TCTGGCCCAATNONE 
J065155D13TCTGGCCCAATNONE 
J065200C11TCTGGCCCAATNONE 
Os01g0391100AK108533TCTGGCCCAAANONE 
AK121200TCTGGCCCAAASimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
J023042H11TCTGGCCCAAANONE 
J023087I02TCTGGCCCAAANONE 
J065099C01TCTGGCCCAAANONE 
Os01g0517800J075194B21TCTGGCCCATAProtein of unknown function DUF597 family protein. 
Os01g0570500AK111703TCTGGCCCSimilar to Dual specificity kinase 1. 
AK111922TCTGGCCCNONE 
Os01g0633000006-075-A01ACGCGTGGGCCAGANONE 
009-064-A11ACGCGTGGGCCAGANONE 
009-153-F07ACGCGTGGGCCAGANONE 
AK062051ACGCGTGGGCCAGASimilar to 50S ribosomal protein L31. 
J013073B08ACGCGTGGGCCAGANONE 
J065006K19ACGCGTGGGCCAGANONE 
J065053P08ACGCGTGGGCCAGANONE 
J065057D08ACGCGTGGGCCAGANONE 
J065086P07ACGCGTGGGCCAGANONE 
J065095C14ACGCGTGGGCCAGANONE 
J065116B05ACGCGTGGGCCAGANONE 
J065164L20ACGCGTGGGCCAGANONE 
J065185K19ACGCGTGGGCCAGANONE 
J065191E21ACGCGTGGGCCAGANONE 
J065199P21ACGCGTGGGCCAGANONE 
J065216M12ACGCGTGGGCCAGANONE 
J075002M09ACGCGTGGGCCAGANONE 
J075016N10ACGCGTGGGCCAGANONE 
J075041K05ACGCGTGGGCCAGANONE 
J075094E04ACGCGTGGGCCAGANONE 
J075154O04ACGCGTGGGCCAGANONE 
J075176D22ACGCGTGGGCCAGANONE 
J075186M09ACGCGTGGGCCAGANONE 
J075191H20ACGCGTGGGCCAGANONE 
Os01g0640800AK065688TCTGGCCCGTTConserved hypothetical protein 48 family protein. 
J013042L10TCTGGCCCGTTNONE 
J013121H08TCTGGCCCGTTNONE 
Os01g0649000AK073564TCTGGCCCAATWD40-like domain containing protein. 
Os01g0699400AK107168TCTGGCCCProtein kinase-like domain containing protein. 
Os01g0716200AK062106TCTGGCCCCACCIQ calmodulin-binding region domain containing protein. 
AK098920TCTGGCCCCACCNONE 
J013002N06TCTGGCCCCACCNONE 
J013050O19TCTGGCCCCACCNONE 
J013074N19TCTGGCCCCACCNONE 
J013127F17TCTGGCCCCACCNONE 
J013155C17TCTGGCCCCACCNONE 
J013158K07TCTGGCCCCACCNONE 
J053086D01TCTGGCCCCACCNONE 
Os01g0831900011-058-G07CCATGGGCCAGANONE 
AK063959CCATGGGCCAGANONE 
AK102106CCATGGGCCAGASimilar to Ammonium transporter. 
J033084D13CCATGGGCCAGANONE 
Os01g0842200003-126-E01TCTGGCCCAAGNONE 
AK102593TCTGGCCCAAGNONE 
AK119896TCTGGCCCAAGSimilar to Scarecrow-like 9 (Fragment). 
J013151G12TCTGGCCCAAGNONE 
J033098G15TCTGGCCCAAGNONE 
J090041L03TCTGGCCCAAGNONE 
J090069J20TCTGGCCCAAGNONE 
Os01g0850900009-089-D11TCTGGCCCNONE 
AK063822TCTGGCCCNONE 
AK102887TCTGGCCCSOUL heme-binding protein family protein. 
J033112K22TCTGGCCCNONE 
J065087B10TCTGGCCCNONE 
J065100A05TCTGGCCCNONE 
J075077M10TCTGGCCCNONE 
Os01g0859500AK101338GGGCGAGGGCCAGASimilar to Basic leucine zipper protein (Liguleless2). 
J075013I11GGGCGAGGGCCAGANONE 
J075038A10GGGCGAGGGCCAGANONE 
J075139M10GGGCGAGGGCCAGANONE 
J075146N08GGGCGAGGGCCAGANONE 
J075146P09GGGCGAGGGCCAGANONE 
J075164E07GGGCGAGGGCCAGANONE 
J075180C01GGGCGAGGGCCAGANONE 
Os01g0919900006-027-D02ATTGGGCCAGANONE 
009-156-F01ATTGGGCCAGANONE 
AK060087ATTGGGCCAGANONE 
Os01g0927500AK068802TCTGGCCCGGTProtein kinase domain containing protein. 
AK101312TCTGGCCCGGTNONE 
J013159J12TCTGGCCCGGTNONE 
J033033P12TCTGGCCCGGTNONE 
J043034L07TCTGGCCCGGTNONE 
Os01g0936100AK101371ACATGGGCCAGASimilar to Protein kinase. 
Os01g0949200AK102412AACTGGGCCAGANONE 
J033093A04AACTGGGCCAGANONE 
J065053P06AACTGGGCCAGANONE 
J100086D18AACTGGGCCAGANONE 
Os02g0119700AK108777TCTGGCCCAACCProtein prenyltransferase domain containing protein. 
Os02g0128400014-022-B07GGGCCAGANONE 
015-060-C03GGGCCAGANONE 
015-063-E03GGGCCAGANONE 
AK064322GGGCCAGAHeat shock protein DnaJ, N-terminal domain containing protein. 
J013036A01GGGCCAGANONE 
J023149H06GGGCCAGANONE 
J075052N09GGGCCAGANONE 
J075054D16GGGCCAGANONE 
J075188P07GGGCCAGANONE 
J080303K03GGGCCAGANONE 
J080307H12GGGCCAGANONE 
J080318P08GGGCCAGANONE 
Os02g0220600AK061944GGGCCAGAElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK104946GGGCCAGANONE 
D89802GGGCCAGANONE 
J013042L22GGGCCAGANONE 
J013056A14GGGCCAGANONE 
J013120G13GGGCCAGANONE 
J013155K19GGGCCAGANONE 
J023002B10GGGCCAGANONE 
J023080J19GGGCCAGANONE 
J023081C08GGGCCAGANONE 
J023090H05GGGCCAGANONE 
J023091M07GGGCCAGANONE 
J023115F09GGGCCAGANONE 
J033025I23GGGCCAGANONE 
J033026G12GGGCCAGANONE 
J033035E15GGGCCAGANONE 
J033040N13GGGCCAGANONE 
J033046C17GGGCCAGANONE 
J033069F02GGGCCAGANONE 
J033071B16GGGCCAGANONE 
J033071N22GGGCCAGANONE 
J033088J02GGGCCAGANONE 
J033092N24GGGCCAGANONE 
J033093I09GGGCCAGANONE 
J033126G06GGGCCAGANONE 
J043003G15GGGCCAGANONE 
J043010M11GGGCCAGANONE 
J043024O20GGGCCAGANONE 
J065092N03GGGCCAGANONE 
J080004D17GGGCCAGANONE 
J080010L09GGGCCAGANONE 
J080021I11GGGCCAGANONE 
J080022L01GGGCCAGANONE 
J080029B01GGGCCAGANONE 
J080032D11GGGCCAGANONE 
J080039B11GGGCCAGANONE 
J080040K17GGGCCAGANONE 
J080041B21GGGCCAGANONE 
J080052L24GGGCCAGANONE 
J080054M12GGGCCAGANONE 
J080057B15GGGCCAGANONE 
J080078G15GGGCCAGANONE 
J080078H06GGGCCAGANONE 
J080079M03GGGCCAGANONE 
J080088H16GGGCCAGANONE 
J080093C11GGGCCAGANONE 
J080095K09GGGCCAGANONE 
J080095O20GGGCCAGANONE 
J090009J19GGGCCAGANONE 
J090040D04GGGCCAGANONE 
J090052E14GGGCCAGANONE 
J090063B14GGGCCAGANONE 
J090071K04GGGCCAGANONE 
J090075E12GGGCCAGANONE 
J090087A06GGGCCAGANONE 
J090094P03GGGCCAGANONE 
J090098M14GGGCCAGANONE 
Os02g0595700006-057-E01TCTGGCCCAAACNONE 
006-082-F10TCTGGCCCAAACNONE 
006-087-C10TCTGGCCCAAACNONE 
006-091-H03TCTGGCCCAAACNONE 
006-094-A11TCTGGCCCAAACNONE 
AF145053TCTGGCCCAAACNONE 
AK064937TCTGGCCCAAACNONE 
AK066858TCTGGCCCAAACNONE 
AK104785TCTGGCCCAAACNONE 
AK119587TCTGGCCCAAACChloroplast translational elongation factor Tu. 
J013000P03TCTGGCCCAAACNONE 
Os02g0634800003-004-F03TCTGGCCCATCTNONE 
AK059694TCTGGCCCATCTUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17TCTGGCCCATCTNONE 
J053077G20TCTGGCCCATCTNONE 
J075195F14TCTGGCCCATCTNONE 
Os02g0634900006-032-G12AGATGGGCCAGANONE 
006-033-E09AGATGGGCCAGANONE 
006-117-F10AGATGGGCCAGANONE 
006-118-E01AGATGGGCCAGANONE 
013-056-G08AGATGGGCCAGANONE 
AK059769AGATGGGCCAGANONE 
AK068583AGATGGGCCAGANONE 
AK072855AGATGGGCCAGAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210AGATGGGCCAGANONE 
J023138P05AGATGGGCCAGANONE 
J023143J07AGATGGGCCAGANONE 
J033022O09AGATGGGCCAGANONE 
J033111L02AGATGGGCCAGANONE 
J033135O03AGATGGGCCAGANONE 
J065005K19AGATGGGCCAGANONE 
J065044C17AGATGGGCCAGANONE 
J065116K09AGATGGGCCAGANONE 
J065119O21AGATGGGCCAGANONE 
J075014L05AGATGGGCCAGANONE 
J075109H16AGATGGGCCAGANONE 
J075117D04AGATGGGCCAGANONE 
Os02g0638400AK060633AATTGGGCCAGABRO1 domain containing protein. 
J065083J17AATTGGGCCAGANONE 
Os02g0643500AK068423GGGCCAGAPentapeptide repeat containing protein. 
Os02g0655300006-024-H05TCTGGCCCAACTNONE 
006-032-G04TCTGGCCCAACTNONE 
006-045-F03TCTGGCCCAACTNONE 
006-076-D04TCTGGCCCAACTNONE 
006-086-C09TCTGGCCCAACTNONE 
006-104-C07TCTGGCCCAACTNONE 
AK061544TCTGGCCCAACTNONE 
AK103778TCTGGCCCAACTNONE 
AK106107TCTGGCCCAACTNONE 
AK120006TCTGGCCCAACTNONE 
AY363174TCTGGCCCAACTSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21TCTGGCCCAACTNONE 
J065021C16TCTGGCCCAACTNONE 
J065182F01TCTGGCCCAACTNONE 
J075063I18TCTGGCCCAACTNONE 
J075151E01TCTGGCCCAACTNONE 
J075198K18TCTGGCCCAACTNONE 
J090026M06TCTGGCCCAACTNONE 
J090081H02TCTGGCCCAACTNONE 
J100061E20TCTGGCCCAACTNONE 
Os02g0658300AK073923TCTGGCCCAACAConserved hypothetical protein. 
J065152M15TCTGGCCCAACANONE 
Os02g0768600006-034-F01TCTGGCCCGGCCCAAACNONE 
006-046-G07TCTGGCCCGGCCCAAACNONE 
006-054-C07TCTGGCCCGGCCCAAACNONE 
006-056-F07TCTGGCCCGGCCCAAACNONE 
006-100-C02TCTGGCCCGGCCCAAACNONE 
AK059725TCTGGCCCGGCCCAAACNONE 
AK098996TCTGGCCCGGCCCAAACNONE 
AK099120TCTGGCCCGGCCCAAACNONE 
AK104659TCTGGCCCGGCCCAAACNONE 
J065043H04TCTGGCCCGGCCCAAACNONE 
J075034N21TCTGGCCCGGCCCAAACNONE 
J075145C18TCTGGCCCGGCCCAAACNONE 
J080016H01TCTGGCCCGGCCCAAACNONE 
J080040F01TCTGGCCCGGCCCAAACNONE 
J080047L23TCTGGCCCGGCCCAAACNONE 
J080049B22TCTGGCCCGGCCCAAACNONE 
J080062J16TCTGGCCCGGCCCAAACNONE 
J080064C23TCTGGCCCGGCCCAAACNONE 
J080064L22TCTGGCCCGGCCCAAACNONE 
J080077N01TCTGGCCCGGCCCAAACNONE 
J080097G17TCTGGCCCGGCCCAAACNONE 
J100065L15TCTGGCCCGGCCCAAACNONE 
J100066K23TCTGGCCCGGCCCAAACNONE 
J100088C07TCTGGCCCGGCCCAAACNONE 
J100090H09TCTGGCCCGGCCCAAACNONE 
Os02g0782200AK070439TCTGGCCCATCANONE 
AK101869TCTGGCCCATCANOT2/NOT3/NOT5 domain containing protein. 
Os03g0277000AK100522TCTGGCCCAAAASimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0284800AJ550618TCTGGCCCNONE 
AK073184TCTGGCCCSpo11/DNA topoisomerase VI, subunit A family protein. 
Os03g0294600AK110762TCTGGCCCAAGSimilar to Importin-beta1. 
Os03g0295500009-083-F02TGTGGGCCAGANONE 
J053029J05TGTGGGCCAGANONE 
J053054B07TGTGGGCCAGACHCH domain containing protein. 
J065024G23TGTGGGCCAGANONE 
J065036F08TGTGGGCCAGANONE 
J065066M11TGTGGGCCAGANONE 
J065143G19TGTGGGCCAGANONE 
Os03g0343700AK060603ACATGGGCCAGABrix domain containing protein. 
AK060603TCTGGCCCBrix domain containing protein. 
AK102274ACATGGGCCAGANONE 
AK102274TCTGGCCCNONE 
J033089C06ACATGGGCCAGANONE 
J033089C06TCTGGCCCNONE 
J090089A17ACATGGGCCAGANONE 
J090089A17TCTGGCCCNONE 
Os03g0383100AK107106AGCCCAATGGGCCAGAConserved hypothetical protein. 
Os03g0606200009-030-E09TCTGGCCCACGTGNONE 
009-076-H10TCTGGCCCACGTGNONE 
009-122-H12TCTGGCCCACGTGNONE 
009-153-F09TCTGGCCCACGTGNONE 
AB055076TCTGGCCCACGTGMitochondrial ATP synthase 6 KD subunit. 
AK072384TCTGGCCCACGTGNONE 
AK107928TCTGGCCCACGTGNONE 
J023078E13TCTGGCCCACGTGNONE 
J053031N01TCTGGCCCACGTGNONE 
J053046K19TCTGGCCCACGTGNONE 
J053062P07TCTGGCCCACGTGNONE 
J053091C23TCTGGCCCACGTGNONE 
J053099N19TCTGGCCCACGTGNONE 
J065005E06TCTGGCCCACGTGNONE 
J065030N03TCTGGCCCACGTGNONE 
J065138O21TCTGGCCCACGTGNONE 
J065159K03TCTGGCCCACGTGNONE 
J075030M08TCTGGCCCACGTGNONE 
J080006E23TCTGGCCCACGTGNONE 
J080010D10TCTGGCCCACGTGNONE 
J080016N17TCTGGCCCACGTGNONE 
J080024N09TCTGGCCCACGTGNONE 
J080028E23TCTGGCCCACGTGNONE 
J080035I11TCTGGCCCACGTGNONE 
J080038D15TCTGGCCCACGTGNONE 
J080040H08TCTGGCCCACGTGNONE 
J080043L04TCTGGCCCACGTGNONE 
J080047C06TCTGGCCCACGTGNONE 
J080061G04TCTGGCCCACGTGNONE 
J080066E10TCTGGCCCACGTGNONE 
J080067P03TCTGGCCCACGTGNONE 
J080082D07TCTGGCCCACGTGNONE 
J080089M13TCTGGCCCACGTGNONE 
J080094O09TCTGGCCCACGTGNONE 
J080095C24TCTGGCCCACGTGNONE 
J080309E21TCTGGCCCACGTGNONE 
J090016G15TCTGGCCCACGTGNONE 
J090031C20TCTGGCCCACGTGNONE 
J090033A15TCTGGCCCACGTGNONE 
J090037L07TCTGGCCCACGTGNONE 
J090038I10TCTGGCCCACGTGNONE 
J090072P19TCTGGCCCACGTGNONE 
J100040J02TCTGGCCCACGTGNONE 
J100047N05TCTGGCCCACGTGNONE 
J100048M10TCTGGCCCACGTGNONE 
J100076C02TCTGGCCCACGTGNONE 
J100077G23TCTGGCCCACGTGNONE 
J100080O08TCTGGCCCACGTGNONE 
J100085C06TCTGGCCCACGTGNONE 
J100085F16TCTGGCCCACGTGNONE 
Os03g0685500009-034-F03TCTGGCCCCACANONE 
009-081-B02TCTGGCCCCACANONE 
AB110171TCTGGCCCCACANONE 
AK062080TCTGGCCCCACACHCH domain containing protein. 
AK120726TCTGGCCCCACANONE 
J013099K19TCTGGCCCCACANONE 
J023002L22TCTGGCCCCACANONE 
J023052G18TCTGGCCCCACANONE 
J023057J22TCTGGCCCCACANONE 
J023095A10TCTGGCCCCACANONE 
J033097N07TCTGGCCCCACANONE 
J033132H15TCTGGCCCCACANONE 
J065064M10TCTGGCCCCACANONE 
J065069C22TCTGGCCCCACANONE 
J065202I16TCTGGCCCCACANONE 
J065214M17TCTGGCCCCACANONE 
J075007E07TCTGGCCCCACANONE 
J075016A20TCTGGCCCCACANONE 
J075036C08TCTGGCCCCACANONE 
J075057C03TCTGGCCCCACANONE 
J075064H21TCTGGCCCCACANONE 
J075078B13TCTGGCCCCACANONE 
J075078D01TCTGGCCCCACANONE 
J075087P03TCTGGCCCCACANONE 
J075091N16TCTGGCCCCACANONE 
J075110P14TCTGGCCCCACANONE 
J075116J17TCTGGCCCCACANONE 
J075148J23TCTGGCCCCACANONE 
J075171C20TCTGGCCCCACANONE 
J075175K20TCTGGCCCCACANONE 
J080035F24TCTGGCCCCACANONE 
J080058E06TCTGGCCCCACANONE 
J080086E16TCTGGCCCCACANONE 
J080301L22TCTGGCCCCACANONE 
J080304O06TCTGGCCCCACANONE 
J080305N09TCTGGCCCCACANONE 
J080306J16TCTGGCCCCACANONE 
J080306N17TCTGGCCCCACANONE 
J080311O12TCTGGCCCCACANONE 
J080315L06TCTGGCCCCACANONE 
J080317H12TCTGGCCCCACANONE 
J080317O05TCTGGCCCCACANONE 
J080318L22TCTGGCCCCACANONE 
J090065J21TCTGGCCCCACANONE 
J090070G13TCTGGCCCCACANONE 
J100028F03TCTGGCCCCACANONE 
J100073D05TCTGGCCCCACANONE 
Os03g0727100AK068587ATTGGGCCAGAConserved hypothetical protein. 
J013153F04ATTGGGCCAGANONE 
J065165J09ATTGGGCCAGANONE 
Os03g0759500AB099524GGGCCAGANONE 
AK063449GGGCCAGAOrigin recognition complex 5. 
J065152N07GGGCCAGANONE 
Os03g0774200AK065851AGATGGGCCAGANONE 
AK119532AGATGGGCCAGASimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AGATGGGCCAGANONE 
J023107I03AGATGGGCCAGANONE 
J065156I19AGATGGGCCAGANONE 
J065176L07AGATGGGCCAGANONE 
J100066F15AGATGGGCCAGANONE 
Os03g0819900006-058-B05GGGCCAGACAGCCCACACNONE 
AK111912GGGCCAGACAGCCCACACNONE 
AK112029GGGCCAGACAGCCCACACSimilar to RAB8C. 
AY576526GGGCCAGACAGCCCACACNONE 
AY579410GGGCCAGACAGCCCACACNONE 
J075041G24GGGCCAGACAGCCCACACNONE 
J100070N08GGGCCAGACAGCCCACACNONE 
Os04g0428900009-068-A06AGATGGGCCAGANONE 
AK061355AGATGGGCCAGASimilar to CSN8. 
AK099153AGATGGGCCAGANONE 
AY336991AGATGGGCCAGANONE 
J023069F08AGATGGGCCAGANONE 
J065112H12AGATGGGCCAGANONE 
J075022F23AGATGGGCCAGANONE 
J090045D23AGATGGGCCAGANONE 
J090067E18AGATGGGCCAGANONE 
J090099H14AGATGGGCCAGANONE 
Os04g0529600Os04g0529600TCTGGCCCACACGTCACLanthionine synthetase C-like family protein. 
Os04g0545600009-152-B05TCTGGCCCNONE 
009-164-B04TCTGGCCCNONE 
AK119259TCTGGCCCSimilar to Uclacyanin 3-like protein. 
J065174C14TCTGGCCCNONE 
Os04g0570600AK106747AGATGGGCCAGACytochrome P450 family protein. 
J080319G08AGATGGGCCAGANONE 
Os04g0585600006-117-A02TCTGGCCCAAAANONE 
AK106073TCTGGCCCAAAAConserved hypothetical protein. 
J053089I23TCTGGCCCAAAANONE 
J065112K06TCTGGCCCAAAANONE 
J065128D09TCTGGCCCAAAANONE 
J100038D09TCTGGCCCAAAANONE 
Os04g0602100AK069838TCTGGCCCHaem peroxidase family protein. 
AK121197TCTGGCCCNONE 
J023087B01TCTGGCCCNONE 
Os04g0612600AB042115AACGGGCCAGANONE 
AK060707AACGGGCCAGASimilar to Coatomer-like protein, epsilon subunit. 
AK099008AACGGGCCAGANONE 
AK104427AACGGGCCAGANONE 
J023043H02AACGGGCCAGANONE 
J033033I23AACGGGCCAGANONE 
J033067P21AACGGGCCAGANONE 
J033088M21AACGGGCCAGANONE 
J033133M08AACGGGCCAGANONE 
J043030I16AACGGGCCAGANONE 
J075049H08AACGGGCCAGANONE 
Os04g0687300AK060617ACATGGGCCAGAHeat shock protein DnaJ, N-terminal domain containing protein. 
J065072M04ACATGGGCCAGANONE 
Os05g0118000AK110694TCTGGCCCATCTSRR1 domain containing protein. 
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0194550J075140P14GGATGGGCCAGAConserved hypothetical protein. 
Os05g0328000AK107977TCTGGCCCGTTCGGCCCGConserved hypothetical protein. 
J065005I02TCTGGCCCGTTCGGCCCGNONE 
J065049M05TCTGGCCCGTTCGGCCCGNONE 
J080005F01TCTGGCCCGTTCGGCCCGNONE 
J080005H15TCTGGCCCGTTCGGCCCGNONE 
J080005K23TCTGGCCCGTTCGGCCCGNONE 
J080007O03TCTGGCCCGTTCGGCCCGNONE 
J080013H09TCTGGCCCGTTCGGCCCGNONE 
J080024C02TCTGGCCCGTTCGGCCCGNONE 
J080026M22TCTGGCCCGTTCGGCCCGNONE 
J080029K21TCTGGCCCGTTCGGCCCGNONE 
J080032K04TCTGGCCCGTTCGGCCCGNONE 
J080034M16TCTGGCCCGTTCGGCCCGNONE 
J080037G11TCTGGCCCGTTCGGCCCGNONE 
J080040L01TCTGGCCCGTTCGGCCCGNONE 
J080041D13TCTGGCCCGTTCGGCCCGNONE 
J080043G20TCTGGCCCGTTCGGCCCGNONE 
J080046H17TCTGGCCCGTTCGGCCCGNONE 
J080048A05TCTGGCCCGTTCGGCCCGNONE 
J080064C21TCTGGCCCGTTCGGCCCGNONE 
J080067E15TCTGGCCCGTTCGGCCCGNONE 
J080071P05TCTGGCCCGTTCGGCCCGNONE 
J080074H16TCTGGCCCGTTCGGCCCGNONE 
J080076A18TCTGGCCCGTTCGGCCCGNONE 
J080076D20TCTGGCCCGTTCGGCCCGNONE 
J080077J15TCTGGCCCGTTCGGCCCGNONE 
J080085J11TCTGGCCCGTTCGGCCCGNONE 
J080086E08TCTGGCCCGTTCGGCCCGNONE 
J080088I23TCTGGCCCGTTCGGCCCGNONE 
J080088I24TCTGGCCCGTTCGGCCCGNONE 
J080089D05TCTGGCCCGTTCGGCCCGNONE 
J080093B04TCTGGCCCGTTCGGCCCGNONE 
J080093D07TCTGGCCCGTTCGGCCCGNONE 
J080094A09TCTGGCCCGTTCGGCCCGNONE 
J080096I12TCTGGCCCGTTCGGCCCGNONE 
J080097L23TCTGGCCCGTTCGGCCCGNONE 
Os05g0377000Os05g0377000GCTGGGCCAGATGGGCCGGASimilar to Acyl carrier protein (ACP). 
Os05g0379300AK109293TCTGGCCCGGCConserved hypothetical protein. 
Os05g0437200014-036-D04TACTGGGCCAGANONE 
014-036-D04TCTGGCCCACTNONE 
AK059283TACTGGGCCAGANONE 
AK059283TCTGGCCCACTNONE 
AK121867TACTGGGCCAGAProtein of unknown function DUF502 family protein. 
AK121867TCTGGCCCACTProtein of unknown function DUF502 family protein. 
Os05g0445500009-021-C05TCTGGCCCATTNONE 
009-129-D11TCTGGCCCATTNONE 
009-147-E04TCTGGCCCATTNONE 
009-169-C11TCTGGCCCATTNONE 
AK121459TCTGGCCCATTSimilar to 60S acidic ribosomal protein P2B. 
D21114TCTGGCCCATTNONE 
J023001K23TCTGGCCCATTNONE 
J023107J19TCTGGCCCATTNONE 
J023143J09TCTGGCCCATTNONE 
J065049D04TCTGGCCCATTNONE 
J065092I06TCTGGCCCATTNONE 
J065188H04TCTGGCCCATTNONE 
Os05g0571300AK072262TTGGCCCATCTGGCCCATAConserved hypothetical protein. 
AK109853TTGGCCCATCTGGCCCATANONE 
AK111014TTGGCCCATCTGGCCCATANONE 
Os05g0588200AK109323TCTGGCCCATCCRuvA domain 2-like containing protein. 
Os06g0101000J023143D21TCTGGCCCATCCANONE 
J033027A19TCTGGCCCATCCANONE 
J033131O18TCTGGCCCATCCANONE 
J043040N17TCTGGCCCATCCANONE 
J090007I16TCTGGCCCATCCANONE 
Os06g0187000AB037135GGGCCAGASimilar to Origin recognition complex 1. 
AK103068GGGCCAGANONE 
Os06g0298100AK108594GGGCCAGAConserved hypothetical protein. 
Os06g0309000AK121021TCTGGCCCZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0351500006-083-H04TCTGGCCCNONE 
006-090-H02TCTGGCCCNONE 
006-113-H07TCTGGCCCNONE 
AK061188TCTGGCCCNONE 
AK067876TCTGGCCCLipolytic enzyme, G-D-S-L family protein. 
AK099072TCTGGCCCNONE 
J090059P21TCTGGCCCNONE 
J090062K17TCTGGCCCNONE 
Os06g0482200AK119703GGGCCAGAThioredoxin fold domain containing protein. 
J065014B11GGGCCAGANONE 
J065055E22GGGCCAGANONE 
J065092L13GGGCCAGANONE 
J065113E21GGGCCAGANONE 
J065191D11GGGCCAGANONE 
J065214F18GGGCCAGANONE 
J075104E18GGGCCAGANONE 
J075149O19GGGCCAGANONE 
J075170I11GGGCCAGANONE 
Os06g0517300J075099N11GGGCCAGANONE 
J075143C04GGGCCAGANONE 
J075167K24GGGCCAGAThionin family protein. 
Os06g0543400AK065374GGGCCAGASimilar to CBL-interacting serine/threonine-protein kinase 11 (EC 2.7.1.37) (SOS2-like protein kinase PKS5) (SOS-interacting protein 4) (SNF1- related kinase 3.22). 
J065019L09GGGCCAGANONE 
J065041F08GGGCCAGANONE 
J065081P20GGGCCAGANONE 
J065087C11GGGCCAGANONE 
J065136F12GGGCCAGANONE 
J065152F17GGGCCAGANONE 
J065152M10GGGCCAGANONE 
J065168F13GGGCCAGANONE 
J065169K12GGGCCAGANONE 
J065171C10GGGCCAGANONE 
J065180B14GGGCCAGANONE 
J090014B17GGGCCAGANONE 
Os06g0602600AK121619AGTTGGGCCAGAAlba, DNA/RNA-binding protein family protein. 
J033044O03AGTTGGGCCAGANONE 
J043036G04AGTTGGGCCAGANONE 
J075107E08AGTTGGGCCAGANONE 
J090060N14AGTTGGGCCAGANONE 
J090094K04AGTTGGGCCAGANONE 
Os06g0622700AK107021TCTGGCCCAAAAGGCCCACAEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTGGCCCAAAAGGCCCACANONE 
J065100L18TCTGGCCCAAAAGGCCCACANONE 
J065129N15TCTGGCCCAAAAGGCCCACANONE 
J065152M08TCTGGCCCAAAAGGCCCACANONE 
J065198M12TCTGGCCCAAAAGGCCCACANONE 
J090077J22TCTGGCCCAAAAGGCCCACANONE 
J100024G23TCTGGCCCAAAAGGCCCACANONE 
J100027L01TCTGGCCCAAAAGGCCCACANONE 
J100047C06TCTGGCCCAAAAGGCCCACANONE 
J100055D01TCTGGCCCAAAAGGCCCACANONE 
J100067M05TCTGGCCCAAAAGGCCCACANONE 
J100077M16TCTGGCCCAAAAGGCCCACANONE 
J100078M22TCTGGCCCAAAAGGCCCACANONE 
Os06g0656800AK109762AAAGCCCAATGGGCCAGABeta-Ig-H3/fasciclin domain containing protein. 
Os06g0696400011-019-C01CCCCCGCGTCTCTGGCCCCCACACNONE 
011-027-D04CCCCCGCGTCTCTGGCCCCCACACNONE 
013-051-H10CCCCCGCGTCTCTGGCCCCCACACNONE 
013-054-A06CCCCCGCGTCTCTGGCCCCCACACNONE 
013-061-D06CCCCCGCGTCTCTGGCCCCCACACNONE 
013-088-F04CCCCCGCGTCTCTGGCCCCCACACNONE 
014-018-C07CCCCCGCGTCTCTGGCCCCCACACNONE 
014-026-E10CCCCCGCGTCTCTGGCCCCCACACNONE 
AK058291CCCCCGCGTCTCTGGCCCCCACACNONE 
AK066125CCCCCGCGTCTCTGGCCCCCACACNONE 
AK104912CCCCCGCGTCTCTGGCCCCCACACNONE 
BT014685CCCCCGCGTCTCTGGCCCCCACACSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase). 
J013059H08CCCCCGCGTCTCTGGCCCCCACACNONE 
J065065L22CCCCCGCGTCTCTGGCCCCCACACNONE 
J065084O06CCCCCGCGTCTCTGGCCCCCACACNONE 
J075006O13CCCCCGCGTCTCTGGCCCCCACACNONE 
J075013J18CCCCCGCGTCTCTGGCCCCCACACNONE 
J075018L23CCCCCGCGTCTCTGGCCCCCACACNONE 
J075036E14CCCCCGCGTCTCTGGCCCCCACACNONE 
J075039K21CCCCCGCGTCTCTGGCCCCCACACNONE 
J075075H13CCCCCGCGTCTCTGGCCCCCACACNONE 
J075091A14CCCCCGCGTCTCTGGCCCCCACACNONE 
J075093I09CCCCCGCGTCTCTGGCCCCCACACNONE 
J075136L17CCCCCGCGTCTCTGGCCCCCACACNONE 
J075156M24CCCCCGCGTCTCTGGCCCCCACACNONE 
J075174J01CCCCCGCGTCTCTGGCCCCCACACNONE 
J075179P15CCCCCGCGTCTCTGGCCCCCACACNONE 
J075181F02CCCCCGCGTCTCTGGCCCCCACACNONE 
J075194L24CCCCCGCGTCTCTGGCCCCCACACNONE 
J080302J02CCCCCGCGTCTCTGGCCCCCACACNONE 
J080304J11CCCCCGCGTCTCTGGCCCCCACACNONE 
J080308A15CCCCCGCGTCTCTGGCCCCCACACNONE 
J100041B09CCCCCGCGTCTCTGGCCCCCACACNONE 
Os06g0701400013-010-G06ACATGGGCTTTTCATGGGCCAGANONE 
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16ACATGGGCTTTTCATGGGCCAGANONE 
J033023L12ACATGGGCTTTTCATGGGCCAGANONE 
J065043I07ACATGGGCTTTTCATGGGCCAGANONE 
J065049E09ACATGGGCTTTTCATGGGCCAGANONE 
J065054I05ACATGGGCTTTTCATGGGCCAGANONE 
J065072H13ACATGGGCTTTTCATGGGCCAGANONE 
J065073L10ACATGGGCTTTTCATGGGCCAGANONE 
J065079P09ACATGGGCTTTTCATGGGCCAGANONE 
J065112I06ACATGGGCTTTTCATGGGCCAGANONE 
J065167C03ACATGGGCTTTTCATGGGCCAGANONE 
J065167I03ACATGGGCTTTTCATGGGCCAGANONE 
J065176P13ACATGGGCTTTTCATGGGCCAGANONE 
J065205M07ACATGGGCTTTTCATGGGCCAGANONE 
J075018E13ACATGGGCTTTTCATGGGCCAGANONE 
J075021E04ACATGGGCTTTTCATGGGCCAGANONE 
J075038F13ACATGGGCTTTTCATGGGCCAGANONE 
J075051E05ACATGGGCTTTTCATGGGCCAGANONE 
J075067C10ACATGGGCTTTTCATGGGCCAGANONE 
J075079A12ACATGGGCTTTTCATGGGCCAGANONE 
J075084A13ACATGGGCTTTTCATGGGCCAGANONE 
J075103E20ACATGGGCTTTTCATGGGCCAGANONE 
J075116E09ACATGGGCTTTTCATGGGCCAGANONE 
J075118F15ACATGGGCTTTTCATGGGCCAGANONE 
J075121I15ACATGGGCTTTTCATGGGCCAGANONE 
J075129B01ACATGGGCTTTTCATGGGCCAGANONE 
J075138A22ACATGGGCTTTTCATGGGCCAGANONE 
J075159B22ACATGGGCTTTTCATGGGCCAGANONE 
J075165I11ACATGGGCTTTTCATGGGCCAGANONE 
J075186E09ACATGGGCTTTTCATGGGCCAGANONE 
J075190J09ACATGGGCTTTTCATGGGCCAGANONE 
J075191I07ACATGGGCTTTTCATGGGCCAGANONE 
J080301C05ACATGGGCTTTTCATGGGCCAGANONE 
J080302L02ACATGGGCTTTTCATGGGCCAGANONE 
J100035C19ACATGGGCTTTTCATGGGCCAGANONE 
J100059P06ACATGGGCTTTTCATGGGCCAGANONE 
Os07g0124500012-092-F01GGGCCAGANONE 
AK070529GGGCCAGASimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000GGGCCAGANONE 
J090007O11GGGCCAGANONE 
J090010E02GGGCCAGANONE 
J090078C04GGGCCAGANONE 
Os07g0132700J065014C09GGGCCAGAConserved hypothetical protein. 
Os07g0146600J075074M15GGGGCCCATGGGCCAGAConserved hypothetical protein. 
J075120F11GGGGCCCATGGGCCAGANONE 
J075170L13GGGGCCCATGGGCCAGANONE 
J080302A21GGGGCCCATGGGCCAGANONE 
J080304J04GGGGCCCATGGGCCAGANONE 
J080308I12GGGGCCCATGGGCCAGANONE 
J080312F11GGGGCCCATGGGCCAGANONE 
J080315M22GGGGCCCATGGGCCAGANONE 
Os07g0146700014-006-H11AGCCCATGGGCCAGANONE 
AK063631AGCCCATGGGCCAGAConserved hypothetical protein. 
AK101150AGCCCATGGGCCAGANONE 
J065038C21AGCCCATGGGCCAGANONE 
Os07g0164100AK111557TCTGGCCCAGTTHistone deacetylase superfamily protein. 
Os07g0164200009-038-C11AACTGGGCCAGANONE 
AK059382AACTGGGCCAGATranslation factor domain containing protein. 
AK107096AACTGGGCCAGANONE 
Os07g0181800AK121080TGTGGGCCCCACTTGTCTGGCCCConserved hypothetical protein. 
J023063D04TGTGGGCCCCACTTGTCTGGCCCNONE 
J033084A07TGTGGGCCCCACTTGTCTGGCCCNONE 
J075013C04TGTGGGCCCCACTTGTCTGGCCCNONE 
J075027H13TGTGGGCCCCACTTGTCTGGCCCNONE 
J075045P19TGTGGGCCCCACTTGTCTGGCCCNONE 
J090042L13TGTGGGCCCCACTTGTCTGGCCCNONE 
J090098E10TGTGGGCCCCACTTGTCTGGCCCNONE 
Os07g0463100009-138-B06GGGCCAGANONE 
AK121807GGGCCAGADNA-directed RNA polymerase, 14 to 18 kDa subunit family protein. 
J013162G21GGGCCAGANONE 
J065061H22GGGCCAGANONE 
J075091J19GGGCCAGANONE 
J075107E13GGGCCAGANONE 
J075141I11GGGCCAGANONE 
J075172E07GGGCCAGANONE 
J080305N05GGGCCAGANONE 
J080311B17GGGCCAGANONE 
J080316I07GGGCCAGANONE 
Os07g0486000AK069343GGATGGGCCAGASimilar to MSH4. 
Os07g0543000AB110196TCTGGCCCAAANONE 
AK058889TCTGGCCCAAASimilar to Helix-loop-helix-like protein (Fragment). 
Os07g0625500AK064628TCTGGCCCAACASimilar to Fimbriata-associated protein (Fragment). 
Os07g0626100009-127-G03AACGGGCCAGANONE 
AK062899AACGGGCCAGASimilar to 50S ribosomal protein L7/L12. 
Os07g0675250013-097-G10TCTGGCCCCGGCCCNONE 
AK063620TCTGGCCCCGGCCCConserved hypothetical protein. 
J075026H18TCTGGCCCCGGCCCNONE 
J075192A02TCTGGCCCCGGCCCNONE 
Os08g0105800AK065355AATGGGCCAGANONE 
AK067200AATGGGCCAGACytochrome P450 family protein. 
Os08g0178100AK101717TAATGGGCCAGAPep3/Vps18/deep orange domain containing protein. 
Os08g0224200AK101331TCTGGCCCSimilar to Ythdf2-prov protein. 
Os08g0447200AK067377GCCCGGCCCATCTGGCCCSGT1 family protein. 
J013106M17GCCCGGCCCATCTGGCCCNONE 
J033133D18GCCCGGCCCATCTGGCCCNONE 
J033140B09GCCCGGCCCATCTGGCCCNONE 
J100028I17GCCCGGCCCATCTGGCCCNONE 
J100086C22GCCCGGCCCATCTGGCCCNONE 
Os08g0455800006-050-A09TCTGGCCCAAACNONE 
AK061573TCTGGCCCAAACProtein of unknown function DUF985 family protein. 
AK099156TCTGGCCCAAACNONE 
J023067L05TCTGGCCCAAACNONE 
J065101A05TCTGGCCCAAACNONE 
J065171H09TCTGGCCCAAACNONE 
J100022D08TCTGGCCCAAACNONE 
J100029K04TCTGGCCCAAACNONE 
J100029O10TCTGGCCCAAACNONE 
Os08g0463100009-160-D03GGTGGGGCCAGANONE 
AK063043GGTGGGGCCAGAConserved hypothetical protein. 
Os08g0471900015-099-E10TCTGGCCCATCANONE 
AK069434TCTGGCCCATCAZinc finger, ZPR1-type domain containing protein. 
Os08g0474750J075009C13TCTGGCCCAAATNONE 
J075122O14TCTGGCCCAAATHypothetical protein. 
Os08g0474800Os08g0474800TCTGGCCCAAATEsterase/lipase/thioesterase domain containing protein. 
Os08g0511000AK107578AGTGGGCCAGAProtein prenyltransferase domain containing protein. 
Os08g0526500016-063-D04TTTTGGGCCAGANONE 
AK073431TTTTGGGCCAGASimilar to SOX-1 protein. 
J033042D10TTTTGGGCCAGANONE 
J065019E02TTTTGGGCCAGANONE 
Os09g0120033AK069069TCTGGCCCATCTConserved hypothetical protein. 
Os09g0321300AK122141TATTGGGCCAGATTGGGCCATNONE 
Os09g0370300AK108199AAATGGGCCAGASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0411700005-017-C05TCTGGCCCATTANONE 
009-163-B01TCTGGCCCATTANONE 
AK058290TCTGGCCCATTAPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919TCTGGCCCATTANONE 
AK121091TCTGGCCCATTANONE 
J013039D20TCTGGCCCATTANONE 
J023066F16TCTGGCCCATTANONE 
J023082H09TCTGGCCCATTANONE 
J023088H05TCTGGCCCATTANONE 
J065013G09TCTGGCCCATTANONE 
J065065C12TCTGGCCCATTANONE 
J065111I04TCTGGCCCATTANONE 
J065179H22TCTGGCCCATTANONE 
J075023N14TCTGGCCCATTANONE 
J090041J17TCTGGCCCATTANONE 
J100031J21TCTGGCCCATTANONE 
J100057A18TCTGGCCCATTANONE 
J100068P22TCTGGCCCATTANONE 
Os09g0437900AK107833GGTGGGCCAGASimilar to Adrenodoxin. 
Os09g0458700J065112J22TCTGGCCCATCTCalcium-binding EF-hand domain containing protein. 
J065207F05TCTGGCCCATCTNONE 
Os09g0485800AK108749ATTTGGGCCAGAConserved hypothetical protein. 
J065137H03ATTTGGGCCAGANONE 
Os09g0527900AK122172TCTGGCCCCACCTGTCAGTGSimilar to Hd1-like protein. 
J033148H23TCTGGCCCCACCTGTCAGTGNONE 
J080070L07TCTGGCCCCACCTGTCAGTGNONE 
J090088G19TCTGGCCCCACCTGTCAGTGNONE 
Os09g0538450J080302B10TGCGGGCCAGAHypothetical protein. 
Os09g0542200006-092-A09ATATGGGCCAGANONE 
AK064887ATATGGGCCAGAThioredoxin fold domain containing protein. 
AK104804ATATGGGCCAGANONE 
J013000K12ATATGGGCCAGANONE 
J013170A19ATATGGGCCAGANONE 
J033103B02ATATGGGCCAGANONE 
J065196J20ATATGGGCCAGANONE 
J075037H17ATATGGGCCAGANONE 
J075069H14ATATGGGCCAGANONE 
J075071C16ATATGGGCCAGANONE 
J075095N02ATATGGGCCAGANONE 
J075136N03ATATGGGCCAGANONE 
J075192L16ATATGGGCCAGANONE 
J100057N23ATATGGGCCAGANONE 
J100060O07ATATGGGCCAGANONE 
J100062F10ATATGGGCCAGANONE 
J100077I08ATATGGGCCAGANONE 
J100086B07ATATGGGCCAGANONE 
J100088L14ATATGGGCCAGANONE 
Os09g0569100009-133-D02GGGCCAGANONE 
AK071860GGGCCAGAHaloacid dehalogenase-like hydrolase domain containing protein. 
J023117I03GGGCCAGANONE 
J065046H04GGGCCAGANONE 
J065051H17GGGCCAGANONE 
J065070C15GGGCCAGANONE 
J065088K22GGGCCAGANONE 
J065100H10GGGCCAGANONE 
J065110A06GGGCCAGANONE 
J100027K01GGGCCAGANONE 
J100079K16GGGCCAGANONE 
Os11g0126100AK067875TCTGGCCCMulti antimicrobial extrusion protein MatE family protein. 
J065043B01TCTGGCCCNONE 
Os11g0168200005-010-H01TTGTGGGCCAGAGCCCATCCNONE 
009-156-F07TTGTGGGCCAGAGCCCATCCNONE 
012-025-F01TTGTGGGCCAGAGCCCATCCNONE 
012-089-A02TTGTGGGCCAGAGCCCATCCNONE 
016-016-E08TTGTGGGCCAGAGCCCATCCNONE 
AK073392TTGTGGGCCAGAGCCCATCC60S ribosomal protein L3. 
AK099225TTGTGGGCCAGAGCCCATCCNONE 
AK101469TTGTGGGCCAGAGCCCATCCNONE 
AY236158TTGTGGGCCAGAGCCCATCCNONE 
J013152M22TTGTGGGCCAGAGCCCATCCNONE 
J023013N11TTGTGGGCCAGAGCCCATCCNONE 
J023038J11TTGTGGGCCAGAGCCCATCCNONE 
J023054N21TTGTGGGCCAGAGCCCATCCNONE 
J033041E13TTGTGGGCCAGAGCCCATCCNONE 
J033050O09TTGTGGGCCAGAGCCCATCCNONE 
J033093G05TTGTGGGCCAGAGCCCATCCNONE 
J033094J17TTGTGGGCCAGAGCCCATCCNONE 
J033112J24TTGTGGGCCAGAGCCCATCCNONE 
J033113D05TTGTGGGCCAGAGCCCATCCNONE 
J033120K10TTGTGGGCCAGAGCCCATCCNONE 
J033121H19TTGTGGGCCAGAGCCCATCCNONE 
J033129C08TTGTGGGCCAGAGCCCATCCNONE 
J033140H24TTGTGGGCCAGAGCCCATCCNONE 
J065020I18TTGTGGGCCAGAGCCCATCCNONE 
J065058L01TTGTGGGCCAGAGCCCATCCNONE 
J065059G22TTGTGGGCCAGAGCCCATCCNONE 
J065212L09TTGTGGGCCAGAGCCCATCCNONE 
J075047P09TTGTGGGCCAGAGCCCATCCNONE 
J075063C18TTGTGGGCCAGAGCCCATCCNONE 
J075076E07TTGTGGGCCAGAGCCCATCCNONE 
J075077F14TTGTGGGCCAGAGCCCATCCNONE 
J075086C22TTGTGGGCCAGAGCCCATCCNONE 
J075161L09TTGTGGGCCAGAGCCCATCCNONE 
J075177K20TTGTGGGCCAGAGCCCATCCNONE 
J090007L06TTGTGGGCCAGAGCCCATCCNONE 
J090010M02TTGTGGGCCAGAGCCCATCCNONE 
J090013M20TTGTGGGCCAGAGCCCATCCNONE 
J090044I15TTGTGGGCCAGAGCCCATCCNONE 
J090045O06TTGTGGGCCAGAGCCCATCCNONE 
J090060L04TTGTGGGCCAGAGCCCATCCNONE 
J090061C17TTGTGGGCCAGAGCCCATCCNONE 
J090062F10TTGTGGGCCAGAGCCCATCCNONE 
J090066L03TTGTGGGCCAGAGCCCATCCNONE 
J090089E13TTGTGGGCCAGAGCCCATCCNONE 
J090096D21TTGTGGGCCAGAGCCCATCCNONE 
J100039F12TTGTGGGCCAGAGCCCATCCNONE 
J100053N06TTGTGGGCCAGAGCCCATCCNONE 
Os11g0182400016-077-B04TGTCAGTGTAATGGGCCATTGGGCCAGANONE 
AK112089TGTCAGTGTAATGGGCCATTGGGCCAGACyclin-like F-box domain containing protein. 
Os11g0484300AK121422AACTGGGCCAGASimilar to Mcm2-prov protein. 
Os11g0512000AK107369GGGCCAGANo apical meristem (NAM) protein domain containing protein. 
J075006M23GGGCCAGANONE 
J075069E01GGGCCAGANONE 
J075073J15GGGCCAGANONE 
J075081H21GGGCCAGANONE 
J075081I24GGGCCAGANONE 
J075098E10GGGCCAGANONE 
J075109B07GGGCCAGANONE 
J075109B09GGGCCAGANONE 
J075109K23GGGCCAGANONE 
J075120F18GGGCCAGANONE 
J075121H03GGGCCAGANONE 
J075174O18GGGCCAGANONE 
J075177G19GGGCCAGANONE 
J075179P19GGGCCAGANONE 
J075195P18GGGCCAGANONE 
J075196B20GGGCCAGANONE 
J090068H20GGGCCAGANONE 
Os11g0617800009-105-D10CACGGCCCATTCTGGCCCAACANONE 
AK062778CACGGCCCATTCTGGCCCAACAConserved hypothetical protein. 
Os11g0620300AJ704770TCTGGCCCATGNONE 
AK107901TCTGGCCCATGSimilar to Nonspecific lipid-transfer protein 2 (LTP 2). 
J075006M12TCTGGCCCATGNONE 
J075046J22TCTGGCCCATGNONE 
Os11g0689000AK067598GGGCCAGAHypothetical protein. 
Os12g0182200009-110-C10TCTGGCCCNONE 
AK069414TCTGGCCCNONE 
Os12g0403800AK059940GGGCCAGANONE 
AK064189GGGCCAGAExoribonuclease domain containing protein. 
Os12g0405700AK061920TGATGGGCCAGASimilar to Wound-induced basic protein. 
AK120436TGATGGGCCAGANONE 
Os12g0431100014-071-A04TCTGGCCCATGNONE 
AK063710TCTGGCCCATGAAA ATPase domain containing protein. 
Os12g0540000AK108630TCATGGGCCAGAConserved hypothetical protein. 
J065046N02TCATGGGCCAGANONE 
J065100H24TCATGGGCCAGANONE 
J065142M24TCATGGGCCAGANONE 
Os12g0569700AK060051TCTGGCCCNONE 
Os12g0569900Os12g0569900TATGGGCCAGASimilar to Zn finger protein (Fragment). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.