version

Summary of OsREG639 (All List)

OrganismOryza sativa  
IDOsREG639  
SequenceGGGCCCAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1456  

Entry Sequences (1456 entries)

LocusGene modelSequenceDescription
Os01g0150100J023078H07CTTGGGCCCACCTGTCNONE 
Os01g0179901J075009I05TGCGGCCCAATTAGGGCCCAACTNONE 
J075058D09TGCGGCCCAATTAGGGCCCAACTNONE 
J075153K16TGCGGCCCAATTAGGGCCCAACTConserved hypothetical protein. 
Os01g0212100AK065467AGCCCATCCAAGGTGGGCCCAAATNONE 
AK101456AGCCCATCCAAGGTGGGCCCAAATATP-dependent helicase, DEAH-box family protein. 
Os01g0246500AK058984TCCGGGCCGGGCCCAAAASimilar to Minus dominance protein. 
Os01g0314300AK073419TTTTGGGCCCACCACUncharacterized domain 2 containing protein. 
AK104939TTTTGGGCCCACCACNONE 
J033044B03TTTTGGGCCCACCACNONE 
J033060E12TTTTGGGCCCACCACNONE 
J043037E21TTTTGGGCCCACCACNONE 
J065019O18TTTTGGGCCCACCACNONE 
J065025P22TTTTGGGCCCACCACNONE 
J065042P06TTTTGGGCCCACCACNONE 
J065074C19TTTTGGGCCCACCACNONE 
J065074E13TTTTGGGCCCACCACNONE 
J065094E05TTTTGGGCCCACCACNONE 
J065108N08TTTTGGGCCCACCACNONE 
J065134L13TTTTGGGCCCACCACNONE 
J065152N24TTTTGGGCCCACCACNONE 
J065162N24TTTTGGGCCCACCACNONE 
J065170P16TTTTGGGCCCACCACNONE 
J065177M20TTTTGGGCCCACCACNONE 
J065187N01TTTTGGGCCCACCACNONE 
J075012N12TTTTGGGCCCACCACNONE 
J075046C17TTTTGGGCCCACCACNONE 
J075055N06TTTTGGGCCCACCACNONE 
J075141H03TTTTGGGCCCACCACNONE 
J075150M11TTTTGGGCCCACCACNONE 
J090005B16TTTTGGGCCCACCACNONE 
J090079L11TTTTGGGCCCACCACNONE 
J100039F16TTTTGGGCCCACCACNONE 
Os01g0555100AK111255CTTGGGCCCCASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os01g0558500AK099982TAATGGGCTTTTGGGCCCAGCCPWWP domain containing protein. 
J065096J12TAATGGGCTTTTGGGCCCAGCCNONE 
Os01g0581300AK066182GGGGCCCAACSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015GGGGCCCAACNONE 
Os01g0585400AK103584TCATGGGCCCAAATConserved hypothetical protein. 
J033133B01TCATGGGCCCAAATNONE 
Os01g0595900AK100625AATTGGGCCCACACyclin-like F-box domain containing protein. 
Os01g0618200AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein. 
Os01g0621700AK108938AATTGGGCCCAAAMyosin tail 2 domain containing protein. 
J100033P13AATTGGGCCCAAANONE 
Os01g0626300016-070-G04TTTTGGGCCCATCANONE 
AK122071TTTTGGGCCCATCASimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04TTTTGGGCCCATCANONE 
J033117J08TTTTGGGCCCATCANONE 
J065007O12TTTTGGGCCCATCANONE 
J065020K12TTTTGGGCCCATCANONE 
J065142D24TTTTGGGCCCATCANONE 
J065157K19TTTTGGGCCCATCANONE 
J080307H19TTTTGGGCCCATCANONE 
J080311D16TTTTGGGCCCATCANONE 
J080316C12TTTTGGGCCCATCANONE 
J080316E03TTTTGGGCCCATCANONE 
J100033K16TTTTGGGCCCATCANONE 
J100042J21TTTTGGGCCCATCANONE 
J100051E06TTTTGGGCCCATCANONE 
J100071E22TTTTGGGCCCATCANONE 
Os01g0658500AK058491GCGGGCCCAACProtein of unknown function DUF852, eukaryotic family protein. 
AK069050GCGGGCCCAACNONE 
J043036P22GCGGGCCCAACNONE 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
Os01g0688200AK120982ACTGGGCCCAATAlpha/beta hydrolase family protein. 
AK120982TAAGCCCATCTGGGCCCAACAAlpha/beta hydrolase family protein. 
Os01g0725100J075035B02CTTGGGCCCGCANONE 
Os01g0807000AK109751TGTTGGGCCCGConserved hypothetical protein. 
Os01g0810000AK102143AGGGCCCAAACNONE 
AK120752AGGGCCCAAACUtp11 family protein. 
J023006E09AGGGCCCAAACNONE 
J033086A13AGGGCCCAAACNONE 
J033133K07AGGGCCCAAACNONE 
J065066L16AGGGCCCAAACNONE 
J065161C01AGGGCCCAAACNONE 
J100027D18AGGGCCCAAACNONE 
J100063J12AGGGCCCAAACNONE 
Os01g0829266J065010C18TGTTGGGCCCATTANONE 
J065037A22TGTTGGGCCCATTANONE 
J065044B02TGTTGGGCCCATTAConserved hypothetical protein. 
J065044B10TGTTGGGCCCATTANONE 
J065051A06TGTTGGGCCCATTANONE 
J065073E06TGTTGGGCCCATTANONE 
J065074I11TGTTGGGCCCATTANONE 
J065086D22TGTTGGGCCCATTANONE 
J065104H10TGTTGGGCCCATTANONE 
J065107C05TGTTGGGCCCATTANONE 
J065124H16TGTTGGGCCCATTANONE 
J065165F22TGTTGGGCCCATTANONE 
J065169B11TGTTGGGCCCATTANONE 
J065172G21TGTTGGGCCCATTANONE 
J065191E05TGTTGGGCCCATTANONE 
J065191F18TGTTGGGCCCATTANONE 
Os01g0836400AK068741TTGTGGGCCCAAACNONE 
AK073540TTGTGGGCCCAAACSAC3/GANP family protein. 
J023019D11TTGTGGGCCCAAACNONE 
J023139O22TTGTGGGCCCAAACNONE 
J033042J20TTGTGGGCCCAAACNONE 
J033046M18TTGTGGGCCCAAACNONE 
J033124J09TTGTGGGCCCAAACNONE 
J090015E05TTGTGGGCCCAAACNONE 
J090076J09TTGTGGGCCCAAACNONE 
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
AK072312GTTGGGCCCACCTGGGCCTGGNONE 
AK103428GTTGGGCCCACCTGGGCCTGGNONE 
Os01g0876500J053026A07AGGGCCCAACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17AGGGCCCAACCNONE 
Os01g0915800AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TTTTGGGCCGGGCCCAAACNONE 
J090056H03TTTTGGGCCGGGCCCAAACNONE 
J090058L14TTTTGGGCCGGGCCCAAACNONE 
J090058P16TTTTGGGCCGGGCCCAAACNONE 
J090076C19TTTTGGGCCGGGCCCAAACNONE 
J100086P14TTTTGGGCCGGGCCCAAACNONE 
Os01g0952600AK067525CTTGGGCCCATACNONE 
AK070047CTTGGGCCCATACSimilar to LacZ (Fragment). 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os02g0101500012-006-E03ATTTGGGCCCCNONE 
013-006-A02ATTTGGGCCCCNONE 
013-011-F03ATTTGGGCCCCNONE 
AK067642ATTTGGGCCCCNONE 
AK072105ATTTGGGCCCCSimilar to NADH-dependent hydroxypyruvate reductase (EC 1.1.1.29) (Fragment). 
J013027G04ATTTGGGCCCCNONE 
J013034P10ATTTGGGCCCCNONE 
J013039D15ATTTGGGCCCCNONE 
J013048P14ATTTGGGCCCCNONE 
J013050O03ATTTGGGCCCCNONE 
J013056H19ATTTGGGCCCCNONE 
J013071D11ATTTGGGCCCCNONE 
J013097D17ATTTGGGCCCCNONE 
J013104F13ATTTGGGCCCCNONE 
J013108J23ATTTGGGCCCCNONE 
J013119J12ATTTGGGCCCCNONE 
J013122N16ATTTGGGCCCCNONE 
J013146M24ATTTGGGCCCCNONE 
J013149E16ATTTGGGCCCCNONE 
J013157E04ATTTGGGCCCCNONE 
J023012P06ATTTGGGCCCCNONE 
J023050C21ATTTGGGCCCCNONE 
J023107F18ATTTGGGCCCCNONE 
J023110B19ATTTGGGCCCCNONE 
J023111H01ATTTGGGCCCCNONE 
J023148P04ATTTGGGCCCCNONE 
J043009E13ATTTGGGCCCCNONE 
J043009H22ATTTGGGCCCCNONE 
J065007D17ATTTGGGCCCCNONE 
J065038K16ATTTGGGCCCCNONE 
J065042A01ATTTGGGCCCCNONE 
J065075C20ATTTGGGCCCCNONE 
J065091I04ATTTGGGCCCCNONE 
J065131A03ATTTGGGCCCCNONE 
J075152O18ATTTGGGCCCCNONE 
J075152P17ATTTGGGCCCCNONE 
J080001F06ATTTGGGCCCCNONE 
J080002H09ATTTGGGCCCCNONE 
J080004L23ATTTGGGCCCCNONE 
J080005H18ATTTGGGCCCCNONE 
J080010D22ATTTGGGCCCCNONE 
J080010G17ATTTGGGCCCCNONE 
J080013E07ATTTGGGCCCCNONE 
J080013P18ATTTGGGCCCCNONE 
J080015D22ATTTGGGCCCCNONE 
J080025H24ATTTGGGCCCCNONE 
J080026O03ATTTGGGCCCCNONE 
J080036J01ATTTGGGCCCCNONE 
J080036L03ATTTGGGCCCCNONE 
J080037O13ATTTGGGCCCCNONE 
J080041D10ATTTGGGCCCCNONE 
J080045J04ATTTGGGCCCCNONE 
J080046J06ATTTGGGCCCCNONE 
J080048G16ATTTGGGCCCCNONE 
J080048I21ATTTGGGCCCCNONE 
J080056F16ATTTGGGCCCCNONE 
J080056L16ATTTGGGCCCCNONE 
J080057C02ATTTGGGCCCCNONE 
J080058D03ATTTGGGCCCCNONE 
J080061B19ATTTGGGCCCCNONE 
J080061E16ATTTGGGCCCCNONE 
J080061L22ATTTGGGCCCCNONE 
J080062P08ATTTGGGCCCCNONE 
J080067C01ATTTGGGCCCCNONE 
J080067G13ATTTGGGCCCCNONE 
J080068F20ATTTGGGCCCCNONE 
J080072H15ATTTGGGCCCCNONE 
J080072P12ATTTGGGCCCCNONE 
J080079O21ATTTGGGCCCCNONE 
J080081J15ATTTGGGCCCCNONE 
J080081K02ATTTGGGCCCCNONE 
J080085O11ATTTGGGCCCCNONE 
J080086N15ATTTGGGCCCCNONE 
J080087E22ATTTGGGCCCCNONE 
J080087O15ATTTGGGCCCCNONE 
J080091D07ATTTGGGCCCCNONE 
J080091J02ATTTGGGCCCCNONE 
J080091L21ATTTGGGCCCCNONE 
J080093B13ATTTGGGCCCCNONE 
J100069F01ATTTGGGCCCCNONE 
J100086B08ATTTGGGCCCCNONE 
Os02g0103700009-031-C12ATTGGGCCCATCCANONE 
AK062502ATTGGGCCCATCCANONE 
AK102186ATTGGGCCCATCCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17ATTGGGCCCATCCANONE 
J065161I07ATTGGGCCCATCCANONE 
J065184G15ATTGGGCCCATCCANONE 
J075123E02ATTGGGCCCATCCANONE 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0121000AK099931CGCGTGGGCTTTGTTGGGCCCCSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0140200AK066454ATTGGGCCCAGGCCCGCASimilar to Beta-amyrin synthase. 
Os02g0176400009-099-H11AGCCCAACCAGGGCCCAAATNONE 
AK062746AGCCCAACCAGGGCCCAAATProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0190900AK111037GTGGGGGCCCAAGPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CTTGGGCCCCCACConserved hypothetical protein. 
J075001E02TTTTGGGCCCAACCConserved hypothetical protein. 
J075117E23CTTGGGCCCCCACNONE 
J075117E23TTTTGGGCCCAACCNONE 
J075117F23CTTGGGCCCCCACNONE 
J075117F23TTTTGGGCCCAACCNONE 
J075144M12CTTGGGCCCCCACNONE 
J075144M12TTTTGGGCCCAACCNONE 
J075145H10CTTGGGCCCCCACNONE 
J075145H10TTTTGGGCCCAACCNONE 
J075186B15CTTGGGCCCCCACNONE 
J075186B15TTTTGGGCCCAACCNONE 
Os02g0194000015-020-A08GGTTGGGCCCAATNONE 
AK064096GGTTGGGCCCAATMyb, DNA-binding domain containing protein. 
J090092L06GGTTGGGCCCAATNONE 
Os02g0215950J090051K07ATTGGGCCCTConserved hypothetical protein. 
Os02g0235600009-009-H04AATTGGGCCCATCCANONE 
009-165-G06AATTGGGCCCATCCANONE 
AK120417AATTGGGCCCATCCASimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14AATTGGGCCCATCCANONE 
J023106P11AATTGGGCCCATCCANONE 
J033080L09AATTGGGCCCATCCANONE 
J033123O05AATTGGGCCCATCCANONE 
J065197A18AATTGGGCCCATCCANONE 
J065216P16AATTGGGCCCATCCANONE 
J075017F02AATTGGGCCCATCCANONE 
J075025L16AATTGGGCCCATCCANONE 
J075027P04AATTGGGCCCATCCANONE 
J075039N01AATTGGGCCCATCCANONE 
J075101F24AATTGGGCCCATCCANONE 
J075132J15AATTGGGCCCATCCANONE 
J075164K16AATTGGGCCCATCCANONE 
J075174E19AATTGGGCCCATCCANONE 
J100043C23AATTGGGCCCATCCANONE 
J100067B11AATTGGGCCCATCCANONE 
Os02g0317800J033050F18TTTTGGGCCCAAGNONE 
J075032I21TTTTGGGCCCAAGNONE 
J075108K06TTTTGGGCCCAAGNONE 
J075120B04TTTTGGGCCCAAGNONE 
J080315C12TTTTGGGCCCAAGConserved hypothetical protein. 
J100056L07TTTTGGGCCCAAGNONE 
Os02g0441000AK108073CTTGGGCCCACTTGConserved hypothetical protein. 
Os02g0530100AK058520GGACCCACTGACGTTGGGCCCCHeavy metal transport/detoxification protein domain containing protein. 
Os02g0582600006-041-F11GGGGCCCAACANONE 
AK059791GGGGCCCAACANONE 
AK102380GGGGCCCAACAHeavy metal transport/detoxification protein domain containing protein. 
J033092A09GGGGCCCAACANONE 
Os02g0614400016-088-D04ACCGGGCCCAATNONE 
AK071805ACCGGGCCCAATConserved hypothetical protein. 
J023108N22ACCGGGCCCAATNONE 
Os02g0622400005-010-C04GTTTGGGCCCTNONE 
AK061679GTTTGGGCCCTConserved hypothetical protein. 
J013058H01GTTTGGGCCCTNONE 
J013095D07GTTTGGGCCCTNONE 
J023054G05GTTTGGGCCCTNONE 
J023093A17GTTTGGGCCCTNONE 
J023146P16GTTTGGGCCCTNONE 
J033089D16GTTTGGGCCCTNONE 
J033099G12GTTTGGGCCCTNONE 
J033131N10GTTTGGGCCCTNONE 
J053073J04GTTTGGGCCCTNONE 
J053074P03GTTTGGGCCCTNONE 
J053075M06GTTTGGGCCCTNONE 
J053088K13GTTTGGGCCCTNONE 
J090039F18GTTTGGGCCCTNONE 
J090045M03GTTTGGGCCCTNONE 
Os02g0638300AK107831AGGGCCCAAAASimilar to Ferredoxin-thioredoxin reductase, variable chain (FTR-V) (Ferredoxin- thioredoxin reductase subunit A) (FTR-A). 
Os02g0646400AK067828AATGGGCCCAAGSimilar to Glutaredoxin. 
J013120N01AATGGGCCCAAGNONE 
J065021N01AATGGGCCCAAGNONE 
J065021N02AATGGGCCCAAGNONE 
J065053O18AATGGGCCCAAGNONE 
J090067J17AATGGGCCCAAGNONE 
Os02g0651500AK066333TGGGGCCCAAGNONE 
AK121865TGGGGCCCAAGHypothetical protein. 
J090038J11TGGGGCCCAAGNONE 
Os02g0667300009-057-D01GTATGGGCCCAAGNONE 
AK058228GTATGGGCCCAAGAlcohol dehydrogenase superfamily, zinc-containing protein. 
AK099066GTATGGGCCCAAGNONE 
Os02g0672600AK070286TATTGGGCCCGCSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174TATTGGGCCCGCNONE 
Os02g0673600009-071-C12TCCGGCCCATGAGGGGCCCAATANONE 
J023037G24TCCGGCCCATGAGGGGCCCAATANONE 
J023038E07TCCGGCCCATGAGGGGCCCAATAORMDL family protein. 
J023142L24TCCGGCCCATGAGGGGCCCAATANONE 
J033115B14TCCGGCCCATGAGGGGCCCAATANONE 
J075004B15TCCGGCCCATGAGGGGCCCAATANONE 
J075067J21TCCGGCCCATGAGGGGCCCAATANONE 
J075072K07TCCGGCCCATGAGGGGCCCAATANONE 
J075147H21TCCGGCCCATGAGGGGCCCAATANONE 
J075154F03TCCGGCCCATGAGGGGCCCAATANONE 
Os02g0679500AK067772AGGGCCCAAAASimilar to Rac GTPase activating protein 1. 
AY364311AGGGCCCAAAANONE 
Os02g0731700AK072346AATTGGGCCCCASimilar to CONSTANS-like 1 protein. 
AK120314AATTGGGCCCCANONE 
Os02g0753200AK067176GTTTGGGCCCAAATConserved hypothetical protein. 
J013097D23GTTTGGGCCCAAATNONE 
J065085J01GTTTGGGCCCAAATNONE 
J065152L23GTTTGGGCCCAAATNONE 
J065162F18GTTTGGGCCCAAATNONE 
J075002K17GTTTGGGCCCAAATNONE 
J075047D24GTTTGGGCCCAAATNONE 
J075064A01GTTTGGGCCCAAATNONE 
J075075C09GTTTGGGCCCAAATNONE 
J075088M01GTTTGGGCCCAAATNONE 
J075130K03GTTTGGGCCCAAATNONE 
J075146K03GTTTGGGCCCAAATNONE 
J090049F07GTTTGGGCCCAAATNONE 
Os02g0754500AK069965TATTGGGCCCACGANONE 
AK105696TATTGGGCCCACGAAmidase family protein. 
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE 
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like. 
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE 
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE 
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE 
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE 
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE 
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE 
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE 
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE 
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE 
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE 
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE 
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE 
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE 
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE 
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE 
Os02g0767100011-054-E05AATTGGGCCCGNONE 
AK063351AATTGGGCCCGNONE 
AK103640AATTGGGCCCGConserved hypothetical protein. 
J090022G11AATTGGGCCCGNONE 
J090072L18AATTGGGCCCGNONE 
Os02g0767900009-154-G01TTTTGGGCCCATAANONE 
009-154-G01TTTTGGGCCCATATNONE 
009-172-H09TTTTGGGCCCATAANONE 
009-172-H09TTTTGGGCCCATATNONE 
AK099885TTTTGGGCCCATAAGlutaredoxin 2 family protein. 
AK099885TTTTGGGCCCATATGlutaredoxin 2 family protein. 
Os02g0771700011-075-D10GTTGGGCCCCNONE 
011-086-E10GTTGGGCCCCNONE 
AK058571GTTGGGCCCCGlycoside hydrolase, family 17 protein. 
AK102185GTTGGGCCCCNONE 
J023001D03GTTGGGCCCCNONE 
J023041N11GTTGGGCCCCNONE 
J033086N13GTTGGGCCCCNONE 
J033106K14GTTGGGCCCCNONE 
J033125P22GTTGGGCCCCNONE 
Os02g0777950J090078H24GTTTGGGCCCAAATConserved hypothetical protein. 
Os02g0816700009-132-E07AGTTGGGCCCAATTNONE 
AK059572AGTTGGGCCCAATTConserved hypothetical protein. 
Os02g0816800013-089-A09AATTGGGCCCAACTNONE 
AK102271AATTGGGCCCAACTNAD-dependent epimerase/dehydratase family protein. 
J013105O04AATTGGGCCCAACTNONE 
J013124I08AATTGGGCCCAACTNONE 
J023002E08AATTGGGCCCAACTNONE 
J023025C01AATTGGGCCCAACTNONE 
J023037O12AATTGGGCCCAACTNONE 
J023049N06AATTGGGCCCAACTNONE 
J023069G18AATTGGGCCCAACTNONE 
J033029M02AATTGGGCCCAACTNONE 
J033037L22AATTGGGCCCAACTNONE 
J033089A08AATTGGGCCCAACTNONE 
J033103L07AATTGGGCCCAACTNONE 
J033125L19AATTGGGCCCAACTNONE 
J090008N20AATTGGGCCCAACTNONE 
J090041F23AATTGGGCCCAACTNONE 
J090092H16AATTGGGCCCAACTNONE 
Os02g0819700AK067374AGGGCCCAATTZinc finger, Zim17-type family protein. 
AK099160AGGGCCCAATTNONE 
J100086K17AGGGCCCAATTNONE 
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein. 
J075055J16GCAGCCCATACAACGGGCCCAACTNONE 
Os03g0130700AK110670GGCTGGGCCCAACANONE 
Os03g0160900J065071D24CGGGCCCAACTNONE 
J065132L03CGGGCCCAACTHypothetical protein. 
J075189L19CGGGCCCAACTNONE 
Os03g0175600AK059981GTTGGGCCCCACSimilar to Nit protein 2 (CUA002). 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
AK065264CTTGGGCCCGCNAD-dependent epimerase/dehydratase family protein. 
Os03g0195900J065063O15ATTGGGCCCGNONE 
Os03g0198400AK059522CTGGCCCAACTTGGGCCCATCCNONE 
AK103101CTGGCCCAACTTGGGCCCATCCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19CTGGCCCAACTTGGGCCCATCCNONE 
J075036K08CTGGCCCAACTTGGGCCCATCCNONE 
J075040J23CTGGCCCAACTTGGGCCCATCCNONE 
J075041H18CTGGCCCAACTTGGGCCCATCCNONE 
J075053H18CTGGCCCAACTTGGGCCCATCCNONE 
J075055K15CTGGCCCAACTTGGGCCCATCCNONE 
J075111K03CTGGCCCAACTTGGGCCCATCCNONE 
J075125B22CTGGCCCAACTTGGGCCCATCCNONE 
J075195L10CTGGCCCAACTTGGGCCCATCCNONE 
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE 
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0263500006-112-E09GTGGGCTTGGGCCCAAAANONE 
009-122-C01GTGGGCTTGGGCCCAAAANONE 
AK106060GTGGGCTTGGGCCCAAAASimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0268300AK102684AGGGCCCAAGSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22AGGGCCCAAGNONE 
J013057J23AGGGCCCAAGNONE 
J013149I10AGGGCCCAAGNONE 
J013149M20AGGGCCCAAGNONE 
J013151D14AGGGCCCAAGNONE 
J013162O11AGGGCCCAAGNONE 
J023001F12AGGGCCCAAGNONE 
J023031B21AGGGCCCAAGNONE 
J023080A07AGGGCCCAAGNONE 
J023081N04AGGGCCCAAGNONE 
J023090C08AGGGCCCAAGNONE 
J023134G05AGGGCCCAAGNONE 
J023139G17AGGGCCCAAGNONE 
J023143I10AGGGCCCAAGNONE 
J023147D04AGGGCCCAAGNONE 
J023147O15AGGGCCCAAGNONE 
J033102K23AGGGCCCAAGNONE 
J033106C17AGGGCCCAAGNONE 
J075033G19AGGGCCCAAGNONE 
J075039J18AGGGCCCAAGNONE 
J075050K20AGGGCCCAAGNONE 
J075075J03AGGGCCCAAGNONE 
J075080E16AGGGCCCAAGNONE 
J075086L08AGGGCCCAAGNONE 
J075091K19AGGGCCCAAGNONE 
J075099O20AGGGCCCAAGNONE 
J075104I06AGGGCCCAAGNONE 
J075137C16AGGGCCCAAGNONE 
J075152G03AGGGCCCAAGNONE 
J075176N12AGGGCCCAAGNONE 
J100086K11AGGGCCCAAGNONE 
Os03g0278900006-049-H12TGGATGGGCTAATGGGCCCAACTNONE 
006-082-A07TGGATGGGCTAATGGGCCCAACTNONE 
009-169-C04TGGATGGGCTAATGGGCCCAACTNONE 
AK066019TGGATGGGCTAATGGGCCCAACTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TGGATGGGCTAATGGGCCCAACTNONE 
AY224460TGGATGGGCTAATGGGCCCAACTNONE 
J065021K17TGGATGGGCTAATGGGCCCAACTNONE 
J065141H24TGGATGGGCTAATGGGCCCAACTNONE 
J065142J20TGGATGGGCTAATGGGCCCAACTNONE 
J065152J03TGGATGGGCTAATGGGCCCAACTNONE 
J065163A13TGGATGGGCTAATGGGCCCAACTNONE 
J065191I21TGGATGGGCTAATGGGCCCAACTNONE 
J065193K12TGGATGGGCTAATGGGCCCAACTNONE 
J075003D01TGGATGGGCTAATGGGCCCAACTNONE 
J075017D24TGGATGGGCTAATGGGCCCAACTNONE 
J075060F20TGGATGGGCTAATGGGCCCAACTNONE 
J075154C11TGGATGGGCTAATGGGCCCAACTNONE 
J075173F04TGGATGGGCTAATGGGCCCAACTNONE 
Os03g0287900009-074-B07TCTGGGCCCAATANONE 
014-027-E07TCTGGGCCCAATANONE 
AK063663TCTGGGCCCAATASimilar to Protein disulfide isomerase. 
J065009N21TCTGGGCCCAATANONE 
Os03g0295800006-107-F02CACGTGGGCCCAACTNONE 
AK106050CACGTGGGCCCAACTNONE 
Os03g0297100006-113-D12ATTTGGGCCCCACANONE 
AK061276ATTTGGGCCCCACASimilar to 40S ribosomal protein S7. 
J033119B03ATTTGGGCCCCACANONE 
J065205G10ATTTGGGCCCCACANONE 
J080069C17ATTTGGGCCCCACANONE 
J100069E15ATTTGGGCCCCACANONE 
J100081D07ATTTGGGCCCCACANONE 
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CGACACGTGGGCCCAACANONE 
J023043K04CGACACGTGGGCCCAACANONE 
J023083I20CGACACGTGGGCCCAACANONE 
J033068F22CGACACGTGGGCCCAACANONE 
J033125P21CGACACGTGGGCCCAACANONE 
J065207A22CGACACGTGGGCCCAACANONE 
J100018D20CGACACGTGGGCCCAACANONE 
J100026L17CGACACGTGGGCCCAACANONE 
J100055D14CGACACGTGGGCCCAACANONE 
J100060P03CGACACGTGGGCCCAACANONE 
J100078A20CGACACGTGGGCCCAACANONE 
Os03g0309800004-019-H07CTTGGGCCCAAGCCCAACNONE 
AK060922CTTGGGCCCAAGCCCAACNONE 
AK098942CTTGGGCCCAAGCCCAACNONE 
AK106141CTTGGGCCCAAGCCCAACNONE 
AK111530CTTGGGCCCAAGCCCAACNONE 
AK111624CTTGGGCCCAAGCCCAACSimilar to PPR2. 
J013024C10CTTGGGCCCAAGCCCAACNONE 
J013043D15CTTGGGCCCAAGCCCAACNONE 
J013108I11CTTGGGCCCAAGCCCAACNONE 
J100058L07CTTGGGCCCAAGCCCAACNONE 
J100071I19CTTGGGCCCAAGCCCAACNONE 
Os03g0324800AK059868AATGGGCCCAAACNONE 
AK071431AATGGGCCCAAACHypothetical protein. 
Os03g0336000AK100067GTTGGGCCCTProtein prenyltransferase domain containing protein. 
J065161K02GTTGGGCCCTNONE 
J065162C21GTTGGGCCCTNONE 
Os03g0347800AK073756AGCCCACAGGGCCCAACAPeptidyl-tRNA hydrolase family protein. 
Os03g0360500009-103-B05ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK059166ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK101285ATTTGGGCCCAAAGTGGCCCAGTProtein of unknown function DUF1077 family protein. 
J033061G19ATTTGGGCCCAAAGTGGCCCAGTNONE 
J065169P12ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075104C18ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075166G07ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075170J04ATTTGGGCCCAAAGTGGCCCAGTNONE 
Os03g0405100AK108624CCGTGGGCCCAACCRpsU-divergently transcribed family protein. 
Os03g0411000AK072079GGGGCCCAAAApoptosis inhibitory 5 family protein. 
AK120207GGGGCCCAAANONE 
J013038J18GGGGCCCAAANONE 
J013063P09GGGGCCCAAANONE 
J013118N09GGGGCCCAAANONE 
J033022P08GGGGCCCAAANONE 
J033043E22GGGGCCCAAANONE 
J033094K23GGGGCCCAAANONE 
J033118J19GGGGCCCAAANONE 
J043010M20GGGGCCCAAANONE 
J065006E09GGGGCCCAAANONE 
J065011M01GGGGCCCAAANONE 
J065044F22GGGGCCCAAANONE 
J065131F15GGGGCCCAAANONE 
J065147G04GGGGCCCAAANONE 
J065154C20GGGGCCCAAANONE 
J065158H17GGGGCCCAAANONE 
J090011G09GGGGCCCAAANONE 
J090030I09GGGGCCCAAANONE 
Os03g0577000012-055-F04AGGGCCCAACCCGCGCNONE 
AK061051AGGGCCCAACCCGCGCSimilar to Ribosomal protein S3 (Fragment). 
AK099146AGGGCCCAACCCGCGCNONE 
J065060A01AGGGCCCAACCCGCGCNONE 
J075079B17AGGGCCCAACCCGCGCNONE 
J075134K12AGGGCCCAACCCGCGCNONE 
J090048F23AGGGCCCAACCCGCGCNONE 
J090072I19AGGGCCCAACCCGCGCNONE 
J100087C19AGGGCCCAACCCGCGCNONE 
J100090C21AGGGCCCAACCCGCGCNONE 
Os03g0578200003-117-B07ACATGGGCCCAATGGGCCCATGANONE 
003-117-B07TCGTGGGCCCAAGNONE 
009-175-C06ACATGGGCCCAATGGGCCCATGANONE 
009-175-C06TCGTGGGCCCAAGNONE 
009-179-H05ACATGGGCCCAATGGGCCCATGANONE 
009-179-H05TCGTGGGCCCAAGNONE 
013-078-G11ACATGGGCCCAATGGGCCCATGANONE 
013-078-G11TCGTGGGCCCAAGNONE 
AK062224ACATGGGCCCAATGGGCCCATGANONE 
AK062224TCGTGGGCCCAAGNONE 
AK120432ACATGGGCCCAATGGGCCCATGAConserved hypothetical protein. 
AK120432TCGTGGGCCCAAGConserved hypothetical protein. 
J013096L16ACATGGGCCCAATGGGCCCATGANONE 
J013096L16TCGTGGGCCCAAGNONE 
J100042G12ACATGGGCCCAATGGGCCCATGANONE 
J100042G12TCGTGGGCCCAAGNONE 
J100069F04ACATGGGCCCAATGGGCCCATGANONE 
J100069F04TCGTGGGCCCAAGNONE 
J100073H14ACATGGGCCCAATGGGCCCATGANONE 
J100073H14TCGTGGGCCCAAGNONE 
Os03g0625900AK101109CGGGCCCAAAAWD40-like domain containing protein. 
Os03g0628900009-062-G01ATTTGGGCCCGGGNONE 
AK103619ATTTGGGCCCGGGPrefoldin domain containing protein. 
J033133L23ATTTGGGCCCGGGNONE 
J100039C17ATTTGGGCCCGGGNONE 
J100048I07ATTTGGGCCCGGGNONE 
J100062E19ATTTGGGCCCGGGNONE 
J100063B11ATTTGGGCCCGGGNONE 
Os03g0712200AK073205GTGGTGGGGCCCAACZinc finger, RanBP2-type domain containing protein. 
AK098968GTGGTGGGGCCCAACNONE 
Os03g0746800AK101718GGTGGGCCCAACWD-40 repeat containing protein. 
Os03g0755000AK068540GAGGCCCATTTGGGCCCAACCSimilar to Serine/threonine kinase (Fragment). 
Os03g0773300AK058587CTTGGGCCCCNONE 
Os03g0784400AK103474AAATGGGCCCAATTProtein of unknown function DUF1692 domain containing protein. 
J023135I15AAATGGGCCCAATTNONE 
J033130D12AAATGGGCCCAATTNONE 
J043035E20AAATGGGCCCAATTNONE 
J065206K15AAATGGGCCCAATTNONE 
J075053J20AAATGGGCCCAATTNONE 
J075129B11AAATGGGCCCAATTNONE 
J090003E22AAATGGGCCCAATTNONE 
J100023E23AAATGGGCCCAATTNONE 
Os03g0785500AK067718ACATGGGCCCAAACProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0786700AK067936AATTGGGCCCATCCN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os03g0791800013-037-A12GGTTGGGCCCCNONE 
AB079798GGTTGGGCCCCNONE 
AK067703GGTTGGGCCCCRad6 (Ubiquitin carrier protein). 
AK120251GGTTGGGCCCCNONE 
J013045G10GGTTGGGCCCCNONE 
J023102B18GGTTGGGCCCCNONE 
J065020J23GGTTGGGCCCCNONE 
J065127I21GGTTGGGCCCCNONE 
J065151E11GGTTGGGCCCCNONE 
J075076B05GGTTGGGCCCCNONE 
J075116C15GGTTGGGCCCCNONE 
J075136A07GGTTGGGCCCCNONE 
J100029G21GGTTGGGCCCCNONE 
J100030K01GGTTGGGCCCCNONE 
J100041J02GGTTGGGCCCCNONE 
J100049C22GGTTGGGCCCCNONE 
J100057G17GGTTGGGCCCCNONE 
J100086L12GGTTGGGCCCCNONE 
Os03g0809300011-024-C02TATTGGGCCCAGATNONE 
016-071-E09TATTGGGCCCAGATNONE 
AK103140TATTGGGCCCAGATProtein phosphatase 2C-like domain containing protein. 
J013030O08TATTGGGCCCAGATNONE 
J013108D19TATTGGGCCCAGATNONE 
J013124D15TATTGGGCCCAGATNONE 
J013128F17TATTGGGCCCAGATNONE 
J013146J06TATTGGGCCCAGATNONE 
J013149D12TATTGGGCCCAGATNONE 
J013154P12TATTGGGCCCAGATNONE 
J013162N01TATTGGGCCCAGATNONE 
J013170G15TATTGGGCCCAGATNONE 
J013170H16TATTGGGCCCAGATNONE 
J023022I09TATTGGGCCCAGATNONE 
J023072B19TATTGGGCCCAGATNONE 
J023106H09TATTGGGCCCAGATNONE 
J023135C03TATTGGGCCCAGATNONE 
J023141C09TATTGGGCCCAGATNONE 
J033091K23TATTGGGCCCAGATNONE 
J033107I05TATTGGGCCCAGATNONE 
J033112M18TATTGGGCCCAGATNONE 
J033120G10TATTGGGCCCAGATNONE 
J033144G06TATTGGGCCCAGATNONE 
J043017L21TATTGGGCCCAGATNONE 
J043024O10TATTGGGCCCAGATNONE 
J053023K04TATTGGGCCCAGATNONE 
J053035D01TATTGGGCCCAGATNONE 
J053037P10TATTGGGCCCAGATNONE 
J053042K15TATTGGGCCCAGATNONE 
J053047C14TATTGGGCCCAGATNONE 
J053054A06TATTGGGCCCAGATNONE 
J053071H03TATTGGGCCCAGATNONE 
J053073G08TATTGGGCCCAGATNONE 
J053090D04TATTGGGCCCAGATNONE 
J053095E17TATTGGGCCCAGATNONE 
J090007O03TATTGGGCCCAGATNONE 
J090024G24TATTGGGCCCAGATNONE 
J090042M08TATTGGGCCCAGATNONE 
J090045I16TATTGGGCCCAGATNONE 
J090051E13TATTGGGCCCAGATNONE 
J090073B15TATTGGGCCCAGATNONE 
J090096F19TATTGGGCCCAGATNONE 
J100030M23TATTGGGCCCAGATNONE 
Os03g0822700005-010-E01AGGTGGGCCCAATNONE 
006-088-H12AGGTGGGCCCAATNONE 
AK061682AGGTGGGCCCAATNONE 
AK101448AGGTGGGCCCAATArmadillo-like helical domain containing protein. 
J023091N05AGGTGGGCCCAATNONE 
Os03g0825900AK109694AGTTGGGCCCACAConserved hypothetical protein. 
Os03g0843500AK067985CGGGCCCAACANONE 
AK101661CGGGCCCAACASimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454CGGGCCCAACANONE 
J080302L23CGGGCCCAACANONE 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
Os03g0852900011-012-A12TCCGGGCCCAACTNONE 
AK100660TCCGGGCCCAACTSimilar to Cleavage and polyadenylation specificity factor, 73 kDa subunit (CPSF 73 kDa subunit). 
J013073D18TCCGGGCCCAACTNONE 
J013152K17TCCGGGCCCAACTNONE 
J023111N01TCCGGGCCCAACTNONE 
J065214G07TCCGGGCCCAACTNONE 
J090080E10TCCGGGCCCAACTNONE 
Os04g0244400006-089-A08ATTGGGCCCTNONE 
AK061168ATTGGGCCCTNONE 
AK103892ATTGGGCCCTGlutaredoxin domain containing protein. 
J033150E08ATTGGGCCCTNONE 
J065063D07ATTGGGCCCTNONE 
J065070L22ATTGGGCCCTNONE 
J075022J16ATTGGGCCCTNONE 
J075136O21ATTGGGCCCTNONE 
J075150O05ATTGGGCCCTNONE 
J075197O15ATTGGGCCCTNONE 
J080307A14ATTGGGCCCTNONE 
J100080A07ATTGGGCCCTNONE 
Os04g0320200012-089-H09AGGGCCCAACANONE 
AK069513AGGGCCCAACAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK104028AGGGCCCAACANONE 
AK119256AGGGCCCAACANONE 
J023020H09AGGGCCCAACANONE 
J065112F21AGGGCCCAACANONE 
J100036M07AGGGCCCAACANONE 
Os04g0432600AK058925CTGGGGCCCAAGConserved hypothetical protein. 
AK103967CTGGGGCCCAAGNONE 
AK121724CTGGGGCCCAAGNONE 
J033081P13CTGGGGCCCAAGNONE 
J033128L11CTGGGGCCCAAGNONE 
J065038G19CTGGGGCCCAAGNONE 
J065129A21CTGGGGCCCAAGNONE 
J065131P11CTGGGGCCCAAGNONE 
J065166I03CTGGGGCCCAAGNONE 
J065181L05CTGGGGCCCAAGNONE 
J100018I15CTGGGGCCCAAGNONE 
J100019H22CTGGGGCCCAAGNONE 
J100037O10CTGGGGCCCAAGNONE 
Os04g0476000Os04g0476000ACCGGGCCCAATATetratricopeptide-like helical domain containing protein. 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0480900AK109889AGTTGGGCTTTGGGCCCCAGlycoside hydrolase, family 5 protein. 
Os04g0482300015-088-C07GGTGGGCCCAAACNONE 
AK064143GGTGGGCCCAAACBTB domain containing protein. 
J065053L16GGTGGGCCCAAACNONE 
J065053N15GGTGGGCCCAAACNONE 
Os04g0492900AK102780AGGGCCCAACTCRS1/YhbY domain containing protein. 
AK120004AGGGCCCAACTNONE 
AK120369AGGGCCCAACTNONE 
Os04g0547600AK109141GGGGCCCAAGPathogenesis-related transcriptional factor and ERF domain containing protein. 
AY339379GGGGCCCAAGNONE 
J065112J12GGGGCCCAAGNONE 
Os04g0551300AK103502AGGGCCCAAAASimilar to Growth regulator like protein. 
Os04g0577000AK073711AATTGGGCCCTUbiquitin fusion degradation protein UFD1 family protein. 
AK119957AATTGGGCCCTNONE 
J013127H04AATTGGGCCCTNONE 
J033035G06AATTGGGCCCTNONE 
J033061G23AATTGGGCCCTNONE 
J033127L07AATTGGGCCCTNONE 
J065015F17AATTGGGCCCTNONE 
J065062G08AATTGGGCCCTNONE 
J065132M07AATTGGGCCCTNONE 
J065155C12AATTGGGCCCTNONE 
J075055I08AATTGGGCCCTNONE 
J075140D07AATTGGGCCCTNONE 
J090055B21AATTGGGCCCTNONE 
J100031D23AATTGGGCCCTNONE 
Os04g0591000006-090-E02ATTGGGCCCCANONE 
AK072902ATTGGGCCCCARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065061E23ATTGGGCCCCANONE 
Os04g0602900AK065982CCTGGGCCCAACTNONE 
AK100414CCTGGGCCCAACTIsoprenylcysteine carboxyl methyltransferase family protein. 
J013045J05CCTGGGCCCAACTNONE 
J065196I21CCTGGGCCCAACTNONE 
J065205B13CCTGGGCCCAACTNONE 
J090017J24CCTGGGCCCAACTNONE 
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03AGCCGTTGGGCCCACCTGTCAGNONE 
J075142E01AGCCGTTGGGCCCACCTGTCAGNONE 
Os04g0658300AK067399ATTTGGGCCCATTASimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0660600009-113-A11CCCGGGCCCAATTNONE 
009-113-A11TTGTGGGCCCAAACNONE 
AK120899CCCGGGCCCAATTATPase, V0 complex, subunit H family protein. 
AK120899TTGTGGGCCCAAACATPase, V0 complex, subunit H family protein. 
J023030J05CCCGGGCCCAATTNONE 
J023030J05TTGTGGGCCCAAACNONE 
J065068M07CCCGGGCCCAATTNONE 
J065068M07TTGTGGGCCCAAACNONE 
J065120G22CCCGGGCCCAATTNONE 
J065120G22TTGTGGGCCCAAACNONE 
J065168J18CCCGGGCCCAATTNONE 
J065168J18TTGTGGGCCCAAACNONE 
J065211M10CCCGGGCCCAATTNONE 
J065211M10TTGTGGGCCCAAACNONE 
J075175E21CCCGGGCCCAATTNONE 
J075175E21TTGTGGGCCCAAACNONE 
J090021C06CCCGGGCCCAATTNONE 
J090021C06TTGTGGGCCCAAACNONE 
J090032P15CCCGGGCCCAATTNONE 
J090032P15TTGTGGGCCCAAACNONE 
J090082E05CCCGGGCCCAATTNONE 
J090082E05TTGTGGGCCCAAACNONE 
J100090O11CCCGGGCCCAATTNONE 
J100090O11TTGTGGGCCCAAACNONE 
Os04g0677033J100048A06CTTGGGCCCGCAConserved hypothetical protein. 
Os04g0679800AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein. 
AK099987CTTGGGCCCCACCTGTCAGTNONE 
J013130B11CTTGGGCCCCACCTGTCAGTNONE 
J065049C17CTTGGGCCCCACCTGTCAGTNONE 
J075191N12CTTGGGCCCCACCTGTCAGTNONE 
J075191P12CTTGGGCCCCACCTGTCAGTNONE 
J100031C07CTTGGGCCCCACCTGTCAGTNONE 
Os04g0684500AK066014TATTGGGCCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os05g0113000AK067079CAAGTGGGCCCAACCAmino acid-binding ACT domain containing protein. 
Os05g0121000009-181-E02GTTTGGGCCCACTAGGCCCAACCNONE 
AK058867GTTTGGGCCCACTAGGCCCAACCNONE 
AK071341GTTTGGGCCCACTAGGCCCAACCProtein of unknown function DUF1218 family protein. 
J023024H24GTTTGGGCCCACTAGGCCCAACCNONE 
J023090B22GTTTGGGCCCACTAGGCCCAACCNONE 
J023111G15GTTTGGGCCCACTAGGCCCAACCNONE 
J023134K14GTTTGGGCCCACTAGGCCCAACCNONE 
J033057C05GTTTGGGCCCACTAGGCCCAACCNONE 
J033067J15GTTTGGGCCCACTAGGCCCAACCNONE 
J033084L15GTTTGGGCCCACTAGGCCCAACCNONE 
J033088B04GTTTGGGCCCACTAGGCCCAACCNONE 
J043027A08GTTTGGGCCCACTAGGCCCAACCNONE 
J043029L03GTTTGGGCCCACTAGGCCCAACCNONE 
J053031K22GTTTGGGCCCACTAGGCCCAACCNONE 
J053046I01GTTTGGGCCCACTAGGCCCAACCNONE 
J053070B05GTTTGGGCCCACTAGGCCCAACCNONE 
J053072C10GTTTGGGCCCACTAGGCCCAACCNONE 
J065097M22GTTTGGGCCCACTAGGCCCAACCNONE 
J065164I17GTTTGGGCCCACTAGGCCCAACCNONE 
J075058I08GTTTGGGCCCACTAGGCCCAACCNONE 
J075064C09GTTTGGGCCCACTAGGCCCAACCNONE 
J080304C16GTTTGGGCCCACTAGGCCCAACCNONE 
J080304H16GTTTGGGCCCACTAGGCCCAACCNONE 
J080306E17GTTTGGGCCCACTAGGCCCAACCNONE 
J080310L03GTTTGGGCCCACTAGGCCCAACCNONE 
J080316J07GTTTGGGCCCACTAGGCCCAACCNONE 
J080317L23GTTTGGGCCCACTAGGCCCAACCNONE 
J080319A10GTTTGGGCCCACTAGGCCCAACCNONE 
J090060F01GTTTGGGCCCACTAGGCCCAACCNONE 
J100042N16GTTTGGGCCCACTAGGCCCAACCNONE 
J100047F05GTTTGGGCCCACTAGGCCCAACCNONE 
J100075J19GTTTGGGCCCACTAGGCCCAACCNONE 
Os05g0182700003-102-E07CCACTGACATGTGGGCCCAACTNONE 
011-019-D04CCACTGACATGTGGGCCCAACTNONE 
013-068-D09CCACTGACATGTGGGCCCAACTNONE 
014-032-G03CCACTGACATGTGGGCCCAACTNONE 
AK065911CCACTGACATGTGGGCCCAACTProtein of unknown function DUF1664 family protein. 
AK104343CCACTGACATGTGGGCCCAACTNONE 
J013045E01CCACTGACATGTGGGCCCAACTNONE 
J013156L15CCACTGACATGTGGGCCCAACTNONE 
J023029P17CCACTGACATGTGGGCCCAACTNONE 
J023134I24CCACTGACATGTGGGCCCAACTNONE 
J033099A10CCACTGACATGTGGGCCCAACTNONE 
J033115L16CCACTGACATGTGGGCCCAACTNONE 
J090007M24CCACTGACATGTGGGCCCAACTNONE 
J090019F02CCACTGACATGTGGGCCCAACTNONE 
Os05g0194600AK102487TTTTGGGCTTAAGGGCCCAATTPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01TTTTGGGCTTAAGGGCCCAATTNONE 
J100041A08TTTTGGGCTTAAGGGCCCAATTNONE 
Os05g0243200009-073-F12GGGGCCCAAAANONE 
AK061317GGGGCCCAAAASimilar to Ribosomal protein L13. 
J065120F21GGGGCCCAAAANONE 
J065185K05GGGGCCCAAAANONE 
Os05g0244600009-176-H11TTATGGGCCCAAATGAAGCCCACNONE 
AK073979TTATGGGCCCAAATGAAGCCCACNucleic acid-binding, OB-fold domain containing protein. 
J065085L13TTATGGGCCCAAATGAAGCCCACNONE 
J065086F22TTATGGGCCCAAATGAAGCCCACNONE 
J065124H03TTATGGGCCCAAATGAAGCCCACNONE 
J065170C22TTATGGGCCCAAATGAAGCCCACNONE 
J065197K01TTATGGGCCCAAATGAAGCCCACNONE 
J075110M09TTATGGGCCCAAATGAAGCCCACNONE 
J090074F17TTATGGGCCCAAATGAAGCCCACNONE 
J100071O17TTATGGGCCCAAATGAAGCCCACNONE 
Os05g0388500AK065313TTTTGGGCCCAATCCGACGSimilar to 50S ribosomal protein L1. 
AK098990TTTTGGGCCCAATCCGACGNONE 
AK104689TTTTGGGCCCAATCCGACGNONE 
J013094L23TTTTGGGCCCAATCCGACGNONE 
J065118O04TTTTGGGCCCAATCCGACGNONE 
Os05g0406800AK062566GGGCCCAACNONE 
AK099640GGGCCCAACLeucine rich repeat, N-terminal domain containing protein. 
J013060B14GGGCCCAACNONE 
J090013F14GGGCCCAACNONE 
J090062E13GGGCCCAACNONE 
J090063D09GGGCCCAACNONE 
J090075H10GGGCCCAACNONE 
J090096E22GGGCCCAACNONE 
Os05g0415400AK107330CAGGTGGGGCCCAACTSimilar to OsNAC6 protein. 
AK119651CAGGTGGGGCCCAACTNONE 
Os05g0461300AK111917AATTGGGCCCCACTCCSimilar to RAB8C. 
AK111946AATTGGGCCCCACTCCNONE 
AK111972AATTGGGCCCCACTCCNONE 
AK112021AATTGGGCCCCACTCCNONE 
J033135H16AATTGGGCCCCACTCCNONE 
J043036O11AATTGGGCCCCACTCCNONE 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0480700AK100850GGTTGGGCCCATCTSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11GGTTGGGCCCATCTNONE 
Os05g0553400AK108452CTGGGGCCCAACCSimilar to Myb-related transcription factor-like protein (MYB transcription factor). 
Os05g0555300009-032-C03GTTTGGGCCCTNONE 
009-125-E08GTTTGGGCCCTNONE 
009-149-C12GTTTGGGCCCTNONE 
009-172-C01GTTTGGGCCCTNONE 
AK062890GTTTGGGCCCTFerredoxin domain containing protein. 
AK062997GTTTGGGCCCTNONE 
Os05g0557200AK062090AGGGCCCAAGNONE 
AK102111AGGGCCCAAGArmadillo-like helical domain containing protein. 
J013047E13AGGGCCCAAGNONE 
J013089P04AGGGCCCAAGNONE 
J013130H17AGGGCCCAAGNONE 
J013132C20AGGGCCCAAGNONE 
J023001E06AGGGCCCAAGNONE 
J023108C09AGGGCCCAAGNONE 
J023125C12AGGGCCCAAGNONE 
J033023O10AGGGCCCAAGNONE 
J033033K16AGGGCCCAAGNONE 
J033064C11AGGGCCCAAGNONE 
J033071P07AGGGCCCAAGNONE 
J033072H14AGGGCCCAAGNONE 
J033084F06AGGGCCCAAGNONE 
J033084H11AGGGCCCAAGNONE 
J033097C05AGGGCCCAAGNONE 
J043009E20AGGGCCCAAGNONE 
J053035M10AGGGCCCAAGNONE 
J053043J22AGGGCCCAAGNONE 
J053082K10AGGGCCCAAGNONE 
J053094N13AGGGCCCAAGNONE 
Os05g0572900AK103180GTTGGGCCCAAGProtein prenyltransferase domain containing protein. 
Os05g0575300AK068873AATTGGGCCCAAGNONE 
J013170P17AATTGGGCCCAAGNONE 
Os05g0596200009-059-G06AGTTGGGCCCAGGNONE 
AK062521AGTTGGGCCCAGGNONE 
AK107887AGTTGGGCCCAGGConserved hypothetical protein. 
AK108209AGTTGGGCCCAGGNONE 
J065154B01AGTTGGGCCCAGGNONE 
Os06g0113600016-067-E03TTATGGGCCCAACTNONE 
AK062095TTATGGGCCCAACTNONE 
AK101235TTATGGGCCCAACTCyclin-like F-box domain containing protein. 
AK122025TTATGGGCCCAACTNONE 
J013022O19TTATGGGCCCAACTNONE 
J023045P05TTATGGGCCCAACTNONE 
J033031K01TTATGGGCCCAACTNONE 
J033034I09TTATGGGCCCAACTNONE 
J033041O04TTATGGGCCCAACTNONE 
J033071K03TTATGGGCCCAACTNONE 
J033075K16TTATGGGCCCAACTNONE 
J033097M01TTATGGGCCCAACTNONE 
J033099M22TTATGGGCCCAACTNONE 
J033108N15TTATGGGCCCAACTNONE 
J033121D18TTATGGGCCCAACTNONE 
J033125O06TTATGGGCCCAACTNONE 
J033139M16TTATGGGCCCAACTNONE 
J033145P18TTATGGGCCCAACTNONE 
J033149D05TTATGGGCCCAACTNONE 
Os06g0114600015-077-E06AGTTGGGCCCACACNONE 
AK067972AGTTGGGCCCACACConserved hypothetical protein. 
Os06g0114700AK061552AGGGCCCAACAProtein of unknown function DUF1218 family protein. 
AK098848AGGGCCCAACANONE 
AK122142AGGGCCCAACANONE 
J013000D16AGGGCCCAACANONE 
Os06g0143000AB014056GGGGCCCAACTNONE 
AK062073GGGGCCCAACTNONE 
AK071301GGGGCCCAACTIron-superoxide dismutase (EC 1.15.1.1). 
J013043A16GGGGCCCAACTNONE 
J023001M11GGGGCCCAACTNONE 
J023087L08GGGGCCCAACTNONE 
J023145K23GGGGCCCAACTNONE 
J033123L01GGGGCCCAACTNONE 
J065127O08GGGGCCCAACTNONE 
Os06g0144000AK068998TTTTGGGCCCCAGBRCT domain containing protein. 
J023001F16TTTTGGGCCCCAGNONE 
Os06g0187900009-171-C09CGGGCCCAAANONE 
AK063879CGGGCCCAAANONE 
AK071765CGGGCCCAAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11CGGGCCCAAANONE 
J033098E13CGGGCCCAAANONE 
J100036J11CGGGCCCAAANONE 
J100047B19CGGGCCCAAANONE 
Os06g0199500AK060939TACTGGGCCCAAGGCCCAAATNONE 
AK064613TACTGGGCCCAAGGCCCAAATSimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138TACTGGGCCCAAGGCCCAAATNONE 
Os06g0220800AK059876AATTGGGCCCATGANONE 
AY739306AATTGGGCCCATGAThioredoxin domain 2 containing protein. 
J075093C09AATTGGGCCCATGANONE 
J100026J18AATTGGGCCCATGANONE 
J100041O16AATTGGGCCCATGANONE 
J100089K16AATTGGGCCCATGANONE 
Os06g0248200Os06g0248200AACGGGCCCAAAANONE 
Os06g0257200J053059P05AATTGGGCCCATGGNONE 
J053059P05TGGGGCCCAACNONE 
J075006K03AATTGGGCCCATGGNONE 
J075006K03TGGGGCCCAACNONE 
J075067F07AATTGGGCCCATGGNONE 
J075067F07TGGGGCCCAACNONE 
J075068F14AATTGGGCCCATGGNONE 
J075068F14TGGGGCCCAACNONE 
J075068H14AATTGGGCCCATGGNONE 
J075068H14TGGGGCCCAACNONE 
J075098N06AATTGGGCCCATGGNONE 
J075098N06TGGGGCCCAACNONE 
J075099F08AATTGGGCCCATGGNONE 
J075099F08TGGGGCCCAACNONE 
J075154G24AATTGGGCCCATGGNONE 
J075154G24TGGGGCCCAACNONE 
J075195H09AATTGGGCCCATGGNONE 
J075195H09TGGGGCCCAACNONE 
Os06g0269300AK064807AGGGCCCAAAANONE 
AK122070AGGGCCCAAAASoluble quinoprotein glucose dehydrogenase domain containing protein. 
J013000D18AGGGCCCAAAANONE 
J023060J19AGGGCCCAAAANONE 
J033028I01AGGGCCCAAAANONE 
J033032M06AGGGCCCAAAANONE 
J033038E05AGGGCCCAAAANONE 
J033106J02AGGGCCCAAAANONE 
Os06g0326500AK068142CTTGGGCCCTMitochondrial glycoprotein family protein. 
AK071483CTTGGGCCCTNONE 
J053065A20CTTGGGCCCTNONE 
J065082D14CTTGGGCCCTNONE 
Os06g0360500AK109778CGGGCCCAAATConserved hypothetical protein. 
Os06g0587300AK069419TGTTGGGCCCACAConserved hypothetical protein. 
AK121885TGTTGGGCCCACANONE 
Os06g0591200009-125-G07GGGGCCCAATTNONE 
009-177-A08GGGGCCCAATTNONE 
AK062563GGGGCCCAATTConserved hypothetical protein. 
AK120112GGGGCCCAATTNONE 
J013025D20GGGGCCCAATTNONE 
J100018M02GGGGCCCAATTNONE 
J100021J11GGGGCCCAATTNONE 
J100024D08GGGGCCCAATTNONE 
J100044L11GGGGCCCAATTNONE 
J100077A22GGGGCCCAATTNONE 
J100090B19GGGGCCCAATTNONE 
Os06g0602600AK121619AATGGGCCCAACAlba, DNA/RNA-binding protein family protein. 
J033044O03AATGGGCCCAACNONE 
J043036G04AATGGGCCCAACNONE 
J075107E08AATGGGCCCAACNONE 
J090060N14AATGGGCCCAACNONE 
J090094K04AATGGGCCCAACNONE 
Os06g0603400AK060002AGGGCCCAAATNONE 
AK060002GGGGCCCAAACNONE 
AK102325AGGGCCCAAATNONE 
AK102325GGGGCCCAAACNONE 
AK106905AGGGCCCAAATSimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
AK106905GGGGCCCAAACSimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
J090039I22AGGGCCCAAATNONE 
J090039I22GGGGCCCAAACNONE 
J100022N15AGGGCCCAAATNONE 
J100022N15GGGGCCCAAACNONE 
J100023E09AGGGCCCAAATNONE 
J100023E09GGGGCCCAAACNONE 
J100052D21AGGGCCCAAATNONE 
J100052D21GGGGCCCAAACNONE 
Os07g0122300015-004-G08CTTGGGCCCTNONE 
AK103212CTTGGGCCCTNONE 
AK119295CTTGGGCCCTProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09CTTGGGCCCTNONE 
J090007P13CTTGGGCCCTNONE 
Os07g0124100014-015-G11GTTGGGCCCACGTGTNONE 
AJ276693GTTGGGCCCACGTGTPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647GTTGGGCCCACGTGTNONE 
Os07g0155200006-036-E03AATTGGGCCCATGTNONE 
006-036-E04AATTGGGCCCATGTNONE 
AK061006AATTGGGCCCATGTProtein of unknown function DUF150 family protein. 
AK104606AATTGGGCCCATGTNONE 
Os07g0158300006-049-G04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK099188CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK104773CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013106F16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013123H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J03CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J033138N08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075011F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075022F10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075071L13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075094B08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075119B21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075140L02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075199O21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080001I17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080005M04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080011P17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026B14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026C12CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080030N16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080035K23CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080039J22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080045D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050C06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050K14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080051I09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053F18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053G10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080055F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080057E22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080058F17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080063C18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080065E02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080066E06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080067O05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080068N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080071O04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074A20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074E14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074L05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075E08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075H07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080078A07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080079H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080F20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080M22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081L04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080090K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080093O13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094A18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094E10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094H06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080096I21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J100081A19CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
Os07g0162600015-024-F04CTTGGGCCCGGANONE 
AK105789CTTGGGCCCGGANONE 
AK106274CTTGGGCCCGGAEsterase/lipase/thioesterase domain containing protein. 
J100026E18CTTGGGCCCGGANONE 
J100037B07CTTGGGCCCGGANONE 
J100090H11CTTGGGCCCGGANONE 
Os07g0205700AK120553GTTTGGGCCCAAGSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24GTTTGGGCCCAAGNONE 
Os07g0213600AK107696TTTTGGGCCCAATPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09TTTTGGGCCCAATNONE 
J100082J05TTTTGGGCCCAATNONE 
Os07g0242600AK065752GTTTGGGCCCAGCCCATAACyclin-like F-box domain containing protein. 
J013037K22GTTTGGGCCCAGCCCATAANONE 
Os07g0296900J075050I18ATTTGGGCCCAATTConserved hypothetical protein. 
Os07g0498900AK073263CTTGGGCCCAGCCCACCAACProtein of unknown function DUF231, plant domain containing protein. 
J033024K20CTTGGGCCCAGCCCACCAACNONE 
J065207I19CTTGGGCCCAGCCCACCAACNONE 
Os07g0570700AK065242AGTTGGGCCCAAGCCCACGTGRibosome recycling factor family protein. 
J013002I12AGTTGGGCCCAAGCCCACGTGNONE 
Os07g0641600AK068478GTTTGGGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
AK073802GTTTGGGCCCAACTNONE 
Os07g0664400006-092-E02AGGGCCCAATGCCCATACNONE 
J065053N04AGGGCCCAATGCCCATACGlucose/ribitol dehydrogenase family protein. 
J065057F09AGGGCCCAATGCCCATACNONE 
J065105C24AGGGCCCAATGCCCATACNONE 
J065192I04AGGGCCCAATGCCCATACNONE 
J065199L10AGGGCCCAATGCCCATACNONE 
J065200C14AGGGCCCAATGCCCATACNONE 
J065214L10AGGGCCCAATGCCCATACNONE 
Os07g0686100AK110915GGTTGGGCCCAGCCAGCCCAGSimilar to Abscisic acid responsive elements-binding factor. 
Os07g0687300AK073043ATTTGGGCCCATAASimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0127600AK058365CGCGTGGGGCCCAACCCCACCACHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373CGCGTGGGGCCCAACCCCACCACNONE 
J013149L10CGCGTGGGGCCCAACCCCACCACNONE 
J075027H17CGCGTGGGGCCCAACCCCACCACNONE 
J075060F10CGCGTGGGGCCCAACCCCACCACNONE 
Os08g0127700012-086-F03GTGGTGGGGTTGGGCCCCACGCGNONE 
AK059350GTGGTGGGGTTGGGCCCCACGCGNONE 
AK099242GTGGTGGGGTTGGGCCCCACGCGNONE 
AK121348GTGGTGGGGTTGGGCCCCACGCGConserved hypothetical protein. 
J033027J18GTGGTGGGGTTGGGCCCCACGCGNONE 
J065012F22GTGGTGGGGTTGGGCCCCACGCGNONE 
J065046N17GTGGTGGGGTTGGGCCCCACGCGNONE 
J065197B02GTGGTGGGGTTGGGCCCCACGCGNONE 
J100018P04GTGGTGGGGTTGGGCCCCACGCGNONE 
J100052C14GTGGTGGGGTTGGGCCCCACGCGNONE 
J100083A12GTGGTGGGGTTGGGCCCCACGCGNONE 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0150800AK101530CTTGGGCCCACTTGSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0435800AK121712AATTGGGCCCACACGAATGGGCCACSimilar to Lipoate protein ligase-like protein. 
J065121P15AATTGGGCCCACACGAATGGGCCACNONE 
Os08g0451101009-086-F06TATTGGGCCCCAProtein of unknown function DUF581 family protein. 
J065021F04TATTGGGCCCCANONE 
J080014E10TATTGGGCCCCANONE 
Os08g0459100AK121795CTTGGGCCCGCCCCCACGTLeucine-rich repeat, cysteine-containing containing protein. 
Os08g0473650J065031A07AATTGGGCCCACGTGTCHypothetical protein. 
J065129E01AATTGGGCCCACGTGTCNONE 
J065134I05AATTGGGCCCACGTGTCNONE 
J065212K13AATTGGGCCCACGTGTCNONE 
J065217M14AATTGGGCCCACGTGTCNONE 
Os08g0517600009-066-H05GCTGGGCCCAAACNONE 
AK073374GCTGGGCCCAAACNONE 
AK105385GCTGGGCCCAAACSAM (and some other nucleotide) binding motif domain containing protein. 
J065165P07GCTGGGCCCAAACNONE 
J075004A12GCTGGGCCCAAACNONE 
J075062F16GCTGGGCCCAAACNONE 
J075115K05GCTGGGCCCAAACNONE 
J075116H09GCTGGGCCCAAACNONE 
Os08g0520100AK059686TTTTGGGCCCACAANONE 
AK120052TTTTGGGCCCACAAPseudouridine synthase domain containing protein. 
Os08g0521400006-047-C11AGGGCCCACCTAGTGGGCCCAATTNONE 
016-014-E07AGGGCCCACCTAGTGGGCCCAATTNONE 
AK070148AGGGCCCACCTAGTGGGCCCAATTNONE 
AK101704AGGGCCCACCTAGTGGGCCCAATTZinc finger, RanBP2-type domain containing protein. 
AK105045AGGGCCCACCTAGTGGGCCCAATTNONE 
J013108K14AGGGCCCACCTAGTGGGCCCAATTNONE 
J013129E16AGGGCCCACCTAGTGGGCCCAATTNONE 
J013159M23AGGGCCCACCTAGTGGGCCCAATTNONE 
J023041G22AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060G13AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060J15AGGGCCCACCTAGTGGGCCCAATTNONE 
J065120J24AGGGCCCACCTAGTGGGCCCAATTNONE 
J065160I01AGGGCCCACCTAGTGGGCCCAATTNONE 
J065179A16AGGGCCCACCTAGTGGGCCCAATTNONE 
J065189K04AGGGCCCACCTAGTGGGCCCAATTNONE 
J090032O15AGGGCCCACCTAGTGGGCCCAATTNONE 
J090045A18AGGGCCCACCTAGTGGGCCCAATTNONE 
J090060B21AGGGCCCACCTAGTGGGCCCAATTNONE 
J090086F23AGGGCCCACCTAGTGGGCCCAATTNONE 
J090098O22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100018K20AGGGCCCACCTAGTGGGCCCAATTNONE 
J100048P22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100052I06AGGGCCCACCTAGTGGGCCCAATTNONE 
Os08g0530200009-166-A09TTTTGGGCCCNONE 
AK062052TTTTGGGCCCNONE 
AK120448TTTTGGGCCCSimilar to 60S ribosomal protein L17. 
J013100M19TTTTGGGCCCNONE 
J023045K22TTTTGGGCCCNONE 
J033046D13TTTTGGGCCCNONE 
J033066N01TTTTGGGCCCNONE 
J033143N05TTTTGGGCCCNONE 
J053070P13TTTTGGGCCCNONE 
J065011C18TTTTGGGCCCNONE 
J065013C23TTTTGGGCCCNONE 
J065016B09TTTTGGGCCCNONE 
J065016C21TTTTGGGCCCNONE 
J065023K18TTTTGGGCCCNONE 
J065028F12TTTTGGGCCCNONE 
J065030L02TTTTGGGCCCNONE 
J065042H15TTTTGGGCCCNONE 
J065078H02TTTTGGGCCCNONE 
J065092D07TTTTGGGCCCNONE 
J065092E01TTTTGGGCCCNONE 
J065104M21TTTTGGGCCCNONE 
J065119P21TTTTGGGCCCNONE 
J065124B15TTTTGGGCCCNONE 
J065146H09TTTTGGGCCCNONE 
J065149L09TTTTGGGCCCNONE 
J065156A09TTTTGGGCCCNONE 
J065157H23TTTTGGGCCCNONE 
J065165L14TTTTGGGCCCNONE 
J065165M18TTTTGGGCCCNONE 
J065172O03TTTTGGGCCCNONE 
J065192M18TTTTGGGCCCNONE 
J065198D21TTTTGGGCCCNONE 
J065200D05TTTTGGGCCCNONE 
J065202B20TTTTGGGCCCNONE 
J065212P11TTTTGGGCCCNONE 
J065215E08TTTTGGGCCCNONE 
J065217P19TTTTGGGCCCNONE 
J075005I19TTTTGGGCCCNONE 
J075134J06TTTTGGGCCCNONE 
J075162G12TTTTGGGCCCNONE 
J075178H07TTTTGGGCCCNONE 
J075186K01TTTTGGGCCCNONE 
J080315I17TTTTGGGCCCNONE 
J080318P19TTTTGGGCCCNONE 
J090004H16TTTTGGGCCCNONE 
J090020A16TTTTGGGCCCNONE 
J090047J12TTTTGGGCCCNONE 
J090080E07TTTTGGGCCCNONE 
J090090H23TTTTGGGCCCNONE 
J100021G24TTTTGGGCCCNONE 
J100037L04TTTTGGGCCCNONE 
J100043L09TTTTGGGCCCNONE 
J100044A10TTTTGGGCCCNONE 
Os08g0557100AK070743AATTGGGCCCAGTANONE 
AK101214AATTGGGCCCAGTASimilar to Nucleic acid-binding protein precursor. 
AK105901AATTGGGCCCAGTANONE 
J033031B04AATTGGGCCCAGTANONE 
J080004F08AATTGGGCCCAGTANONE 
J080004H12AATTGGGCCCAGTANONE 
J080005H08AATTGGGCCCAGTANONE 
J080005I02AATTGGGCCCAGTANONE 
J080008N16AATTGGGCCCAGTANONE 
J080009H23AATTGGGCCCAGTANONE 
J080012H17AATTGGGCCCAGTANONE 
J080012J21AATTGGGCCCAGTANONE 
J080013I20AATTGGGCCCAGTANONE 
J080016E07AATTGGGCCCAGTANONE 
J080018O04AATTGGGCCCAGTANONE 
J080020B18AATTGGGCCCAGTANONE 
J080021I16AATTGGGCCCAGTANONE 
J080022N01AATTGGGCCCAGTANONE 
J080023G08AATTGGGCCCAGTANONE 
J080023N09AATTGGGCCCAGTANONE 
J080024J24AATTGGGCCCAGTANONE 
J080025M12AATTGGGCCCAGTANONE 
J080028A22AATTGGGCCCAGTANONE 
J080028I01AATTGGGCCCAGTANONE 
J080029D22AATTGGGCCCAGTANONE 
J080030M02AATTGGGCCCAGTANONE 
J080031B06AATTGGGCCCAGTANONE 
J080035G08AATTGGGCCCAGTANONE 
J080036F19AATTGGGCCCAGTANONE 
J080038P14AATTGGGCCCAGTANONE 
J080039C17AATTGGGCCCAGTANONE 
J080043A10AATTGGGCCCAGTANONE 
J080044H02AATTGGGCCCAGTANONE 
J080044P12AATTGGGCCCAGTANONE 
J080047L06AATTGGGCCCAGTANONE 
J080050L06AATTGGGCCCAGTANONE 
J080052J11AATTGGGCCCAGTANONE 
J080052M10AATTGGGCCCAGTANONE 
J080053E20AATTGGGCCCAGTANONE 
J080054J01AATTGGGCCCAGTANONE 
J080059N09AATTGGGCCCAGTANONE 
J080064F19AATTGGGCCCAGTANONE 
J080064N22AATTGGGCCCAGTANONE 
J080065K14AATTGGGCCCAGTANONE 
J080065M12AATTGGGCCCAGTANONE 
J080068O07AATTGGGCCCAGTANONE 
J080076P20AATTGGGCCCAGTANONE 
J080087D08AATTGGGCCCAGTANONE 
J080087H16AATTGGGCCCAGTANONE 
J080090N23AATTGGGCCCAGTANONE 
J080091H04AATTGGGCCCAGTANONE 
J080091P13AATTGGGCCCAGTANONE 
J080094O15AATTGGGCCCAGTANONE 
J080094P14AATTGGGCCCAGTANONE 
J080095I07AATTGGGCCCAGTANONE 
J080097E22AATTGGGCCCAGTANONE 
Os08g0563300009-007-B01ATATGGGCCCAANONE 
AK062315ATATGGGCCCAASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
J065095F04ATATGGGCCCAANONE 
Os09g0112400AK109186AATTGGGCCCAAATSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0274100009-112-B02AGTTGGGCCCGCANONE 
AK062823AGTTGGGCCCGCAConserved hypothetical protein. 
Os09g0327300AK059603AGGGCCCAAAASimilar to Plastid 5,10-methylene-tetrahydrofolate dehydrogenase (Fragment). 
J100073E06AGGGCCCAAAANONE 
Os09g0348800AK063411CCACGGCCCACCTGTGGGCCCAAACConserved hypothetical protein. 
Os09g0355400AK105685ATTTGGGCCCATTANONE 
Os09g0467400AK066610AGTTGGGCCCTProtein of unknown function DUF6, transmembrane domain containing protein. 
Os09g0537600006-054-B05AGTGGGCCCAACANONE 
AK061004AGTGGGCCCAACASimilar to Cyclophilin-like protein (Single domain cyclophilin type peptidyl- prolyl cis-trans isomerase). 
J065104J20AGTGGGCCCAACANONE 
J075029H16AGTGGGCCCAACANONE 
Os09g0542200006-092-A09AGATGGGCCCAAATNONE 
AK064887AGATGGGCCCAAATThioredoxin fold domain containing protein. 
AK104804AGATGGGCCCAAATNONE 
J013000K12AGATGGGCCCAAATNONE 
J013170A19AGATGGGCCCAAATNONE 
J033103B02AGATGGGCCCAAATNONE 
J065196J20AGATGGGCCCAAATNONE 
J075037H17AGATGGGCCCAAATNONE 
J075069H14AGATGGGCCCAAATNONE 
J075071C16AGATGGGCCCAAATNONE 
J075095N02AGATGGGCCCAAATNONE 
J075136N03AGATGGGCCCAAATNONE 
J075192L16AGATGGGCCCAAATNONE 
J100057N23AGATGGGCCCAAATNONE 
J100060O07AGATGGGCCCAAATNONE 
J100062F10AGATGGGCCCAAATNONE 
J100077I08AGATGGGCCCAAATNONE 
J100086B07AGATGGGCCCAAATNONE 
J100088L14AGATGGGCCCAAATNONE 
Os09g0565200004-007-A08ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-045-E10ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-051-A01ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-079-G03ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-C05ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-E11ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-111-E07ATATGGGCCGTGATTTGGGCCCATGGNONE 
AK069121ATATGGGCCGTGATTTGGGCCCATGGSimilar to Nucleic acid-binding protein precursor. 
AK104354ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013090J23ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013093C19ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023007A14ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023099J21ATATGGGCCGTGATTTGGGCCCATGGNONE 
J065023L09ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075060J06ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075092C03ATATGGGCCGTGATTTGGGCCCATGGNONE 
Os11g0153700AK058576TAGGCCCATATGTGGGCCCAACASimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0167300AK071335GGGGCCCAACAProtein of unknown function DUF537 family protein. 
AK101314GGGGCCCAACANONE 
Os11g0175500015-087-F02TTTTGGGCCCCACANONE 
AK064320TTTTGGGCCCCACAZinc finger, RING-type domain containing protein. 
AK101592TTTTGGGCCCCACANONE 
Os11g0220300AK068820AATTGGGCCCCAGConserved hypothetical protein. 
Os11g0244200AK107883ATTGGGCCCAACTSimilar to Pisum sativum 17.9 kDa heat shock protein (hsp17.9) (Fragment). 
Os11g0490600AK067664GGTTGGGCCCCConserved hypothetical protein. 
Os11g0549690J065085G07AGTGGGCCGGGCCCAACTConserved hypothetical protein. 
J065085G07ATTTGGGCCCACCTGTConserved hypothetical protein. 
J065218B08AGTGGGCCGGGCCCAACTNONE 
J065218B08ATTTGGGCCCACCTGTNONE 
J090036H16AGTGGGCCGGGCCCAACTNONE 
J090036H16ATTTGGGCCCACCTGTNONE 
Os12g0143150009-090-F09GGGGCCCAAATUbiquitin domain containing protein. 
J013121D01GGGGCCCAAATNONE 
J065129G09GGGGCCCAAATNONE 
J080311D13GGGGCCCAAATNONE 
J090014O10GGGGCCCAAATNONE 
J090045E21GGGGCCCAAATNONE 
J100047D12GGGGCCCAAATNONE 
Os12g0150100009-047-B11AAATGGGCCCAATNONE 
AK105075AAATGGGCCCAATSimilar to 60S ribosomal protein L26A. 
J013067G22AAATGGGCCCAATNONE 
J033103F08AAATGGGCCCAATNONE 
J065029P11AAATGGGCCCAATNONE 
J065043B18AAATGGGCCCAATNONE 
J065123E16AAATGGGCCCAATNONE 
J065141O20AAATGGGCCCAATNONE 
J065161O04AAATGGGCCCAATNONE 
J065201M07AAATGGGCCCAATNONE 
J075058I23AAATGGGCCCAATNONE 
J075172J08AAATGGGCCCAATNONE 
J100040L13AAATGGGCCCAATNONE 
Os12g0190100AK109819AGGGCCCAATSimilar to Auxin-independent growth promoter-like protein. 
Os12g0228900J033132F01AATTGGGCCCNONE 
J043003P05AATTGGGCCCNONE 
J065079N16AATTGGGCCCNONE 
J065141L03AATTGGGCCCNONE 
J075001I21AATTGGGCCCNONE 
J075032L11AATTGGGCCCNONE 
J075126O12AATTGGGCCCNONE 
J100079E06AATTGGGCCCNONE 
Os12g0287200009-067-B11GCCGGCCCATTTGGGCCCAATTNONE 
009-130-F06GCCGGCCCATTTGGGCCCAATTNONE 
009-185-H10GCCGGCCCATTTGGGCCCAATTNONE 
AF338343GCCGGCCCATTTGGGCCCAATTNONE 
AK063847GCCGGCCCATTTGGGCCCAATTSimilar to Mago nashi protein. 
AK121477GCCGGCCCATTTGGGCCCAATTNONE 
J023149H05GCCGGCCCATTTGGGCCCAATTNONE 
J065019G18GCCGGCCCATTTGGGCCCAATTNONE 
J065049J18GCCGGCCCATTTGGGCCCAATTNONE 
J065143C22GCCGGCCCATTTGGGCCCAATTNONE 
J075130D23GCCGGCCCATTTGGGCCCAATTNONE 
J090014I22GCCGGCCCATTTGGGCCCAATTNONE 
J090018A06GCCGGCCCATTTGGGCCCAATTNONE 
J090053H11GCCGGCCCATTTGGGCCCAATTNONE 
J090080N13GCCGGCCCATTTGGGCCCAATTNONE 
J100019H19GCCGGCCCATTTGGGCCCAATTNONE 
Os12g0294100AK111535CGGGCCCAACTWD40-like domain containing protein. 
J013030D09CGGGCCCAACTNONE 
J013153J16CGGGCCCAACTNONE 
J033079N17CGGGCCCAACTNONE 
J090002M14CGGGCCCAACTNONE 
J090071M08CGGGCCCAACTNONE 
J090090E07CGGGCCCAACTNONE 
Os12g0565800AK072828AGGGCCCAATZinc finger, TTF-type domain containing protein. 
Os12g0599900AK101252CCATGGGCCCAACTTetratricopeptide region domain containing protein. 
J033032F05CCATGGGCCCAACTNONE 
Os12g0611000AK111837ATTGGGCCCAAACSimilar to Zinc-finger protein Lsd1. 
Os12g0638100012-096-H01ATTTGGGCCCATCTNONE 
AK059245ATTTGGGCCCATCTNONE 
J033071D06ATTTGGGCCCATCTNONE 
J033090A15ATTTGGGCCCATCTNONE 
J033090A18ATTTGGGCCCATCTNONE 
J033098M15ATTTGGGCCCATCTNONE 
J033111F01ATTTGGGCCCATCTNONE 
J033111I05ATTTGGGCCCATCTNONE 
J033117B13ATTTGGGCCCATCTNONE 
J033127C21ATTTGGGCCCATCTNONE 
J053025M14ATTTGGGCCCATCTNONE 
J053032E24ATTTGGGCCCATCTNONE 
J053089K20ATTTGGGCCCATCTNONE 
J065010A05ATTTGGGCCCATCTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.