
Summary of OsREG640 (All List)

OrganismOryza sativa  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count6744  

Entry Sequences (6744 entries)

LocusGene modelSequenceDescription
AK059848GTGGTGGGCCCCCACEmopamil-binding family protein. 
AK101133CGCGTGGGCCCGGASimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK101133GGGTGGGCCCACGCGTSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein. 
AK061501ACCGGGCCCACAConserved hypothetical protein. 
AK061501TGTGGGCCCGCACGCCACConserved hypothetical protein. 
Os01g0147700AK066686TGTGGGCCCTRegion of unknown function, putative Zinc finger, XS and XH domain containing protein. 
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein. 
AK106766GGGGCCCACAAnkyrin repeat containing protein. 
AK106292AGTGGGCCCAGGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK071324CCGTGGGCCCACACNADH:cytochrome b5 reductase (CBR) family protein. 
Os01g0179000015-092-B11CAGGTGGGCCCCACCTransferase family protein. 
Os01g0180300AK120377GCTGGGCTGGGCCCACACLipoprotein, type 6 family protein. 
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein. 
AK065125CCCGTGGGCCCACCCGlutamyl-tRNA synthetase, class Ic family protein. 
AK065125GCGGGCCCACACGlutamyl-tRNA synthetase, class Ic family protein. 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK105331CGCGTGGGCCCCConserved hypothetical protein. 
Os01g0198100AK119908TGTGGGCCCCConserved hypothetical protein. 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK101456AGCCCATCCAAGGTGGGCCCAAATATP-dependent helicase, DEAH-box family protein. 
Os01g0218700AK064992CGCGTGGGCCCGGCABC transporter, transmembrane region, type 1 domain containing protein. 
AK063996AGGGCCCACAConserved hypothetical protein. 
Os01g0239700AK067723ACCGGGCCCACAASimilar to Leucine-rich receptor-like protein kinase. 
Os01g0246500AK058984GGGGCCCACCTGTCSimilar to Minus dominance protein. 
Os01g0250900AK065179TGTGGGCCCCACGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os01g0253500J100088F12TCTGGGCCCACGAConserved hypothetical protein. 
Os01g0257400AK073920GGTGGGGCCCACCTGZinc finger, CCCH-type domain containing protein. 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
Os01g0273300Os01g0273300CTGGGGCCCACCCBSD domain containing protein. 
Os01g0273800AK109645CAGGTGGGCCCCAFAD dependent oxidoreductase family protein. 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC (PK). 
AK061133AGGTGGGCCCCACCConserved hypothetical protein. 
Os01g0281100AK109672GCGGGCCCACTTGTCAGTGConserved hypothetical protein. 
Os01g0314300AK073419TTTTGGGCCCACCACUncharacterized domain 2 containing protein. 
Os01g0327500AK107756TGTGGGGCCCACTConserved hypothetical protein. 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
Os01g0332100AK120720CAGGTGGGCCCAGCSimilar to Neutral invertase-like protein (Fragment). 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
Os01g0372100J075029A10CCTGGGCCCACAConserved hypothetical protein. 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
AK069619GGGGCCCACCCGProtein of unknown function DUF789 family protein. 
Os01g0534800AK072168CTGACAGGTGGGCCCTSimilar to PRLI-interacting factor K (Fragment). 
Os01g0541900AK069784GGGTGGGCCCCACACGProtein kinase-like domain containing protein. 
S66160GGGTGGGCCCCACGRas-related protein RIC1. 
Os01g0560200AK102003GGGTGGGCCCACCSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0587000AK067605GGGGCCCACTSimilar to Vacuolar ATP synthase subunit d (EC (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
Os01g0595900AK100625AATTGGGCCCACACyclin-like F-box domain containing protein. 
AK069151AGTGGGCCCAGTCyclin-like F-box domain containing protein. 
Os01g0618200AK102319CACTGACAAATGGGCCCACAProtein phosphatase 2C family protein. 
AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein. 
Os01g0626100AK066892TAATGGGCCCACTTGAdaptin, N-terminal domain containing protein. 
AK061752CAAGTGGGCCCCACGSimilar to NADP-isocitrate dehydrogenase. 
Os01g0666500AK102689GGCCGGGCCCACTConserved hypothetical protein. 
Os01g0688200AK120982GCGGGCCCACAAlpha/beta hydrolase family protein. 
AK107426AGTGGGCCCAGGCytidylyltransferase domain containing protein. 
Os01g0691600AK103297CCTGGGCCCACTSimilar to DNA repair helicase XPB2 (EC 3.6.1.-) (XPB homolog 2) (ERCC3 homolog 2) (RAD25 homolog 2) (AtXPB2). 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
AK059936TGTGGGCCCCACASimilar to RNA polymerase II transcriptional coactivator KELP. 
AK104463TGCGGGCCCACCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0716200AK062106TGTGGGCCCCCGCGIQ calmodulin-binding region domain containing protein. 
J075110D21TCCGGGCCCACGCSimilar to Serine acetyltransferase. 
Os01g0723000AK073592TTGTGGGCCCGSimilar to Elongation factor EF-2 (Fragment). 
Os01g0727400AK065692AGGGCCCACGGGConserved hypothetical protein. 
AK065692TGTGGGCCCATATConserved hypothetical protein. 
Os01g0730300AK101207CAGGTGGGCCCACGGHAD-superfamily hydrolase subfamily IIB protein. 
AK121245TGTGGGCCCTReticulon family protein. 
AK072600TTGTGGGCCCCProtein prenyltransferase domain containing protein. 
Os01g0745400AK107872TGTGGGCCCACASec34-like protein family protein. 
AK067731ACGTGGGCCCCHAD-superfamily hydrolase subfamily IIB protein. 
Os01g0764300J090053G03TTATGGGCCCACCCACCACProtein of unknown function DUF155 family protein. 
Os01g0764800AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein. 
Os01g0766400AK073493GTGGTGGGCCCCConserved hypothetical protein. 
Os01g0767100AK109493GGGGCCCACCTSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0767600AK070672GGGGCCCACGGGConserved hypothetical protein. 
AK070672GGTGGGGCCCACGGConserved hypothetical protein. 
Os01g0778700AK064933GCGGGCCCACCTGConserved hypothetical protein. 
AK064933GGTGGGGCCCACCAConserved hypothetical protein. 
AK103408GGGGCCCACGCGTCATCCACCRNA polymerase Rpb5, N-terminal domain containing protein. 
AK072651GGTGGGGCCCACCTCyclin-like F-box domain containing protein. 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
Os01g0818600AK066550TGTGGGCCCGGTLeucine rich repeat, N-terminal domain containing protein. 
AK064237GTGGGGGCCCACGCProtein of unknown function DUF623, plant domain containing protein. 
AK105801AGATGGGCCCACACTGACAG2OG-Fe(II) oxygenase domain containing protein. 
AK068980GGTGGGCCCATCAConserved hypothetical protein. 
AK100543CATGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os01g0835500AK100241GCGGGCCCACTSimilar to Respiratory burst oxidase protein. 
AK073540ACGTGGGCCCCASAC3/GANP family protein. 
AK073540TTGTGGGCCCAAACSAC3/GANP family protein. 
Os01g0837600AK108007CGGGTGGGCCCGGCConserved hypothetical protein 1589, plant family protein. 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
Os01g0846300AK065949CGGGTGGGCCCCSimilar to Protein phosphatase 2C. 
AK062402GGTGGGGCCCACAConserved hypothetical protein. 
AK071410AGTGGGCCCCACCSimilar to Uricase (Fragment). 
AK121602CGGGTGGGGCCCACCGCCCACGCCCAAACProtein of unknown function DUF639 family protein. 
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein. 
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein. 
Os01g0876500J053026A07GGGGCCCACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os01g0877500AK101067GGTGGGCCCGGAProtein of unknown function UPF0054 family protein. 
Os01g0881800AK109594CCACTGACATGTGGGCCCCACAConserved hypothetical protein. 
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein. 
Os01g0908100AK072293AGTGGGCCCTRabGAP/TBC domain containing protein. 
AK073805AGTGGGCCCAGASimilar to Regulatory protein viviparous-1. 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
016-088-H02AACTGGGCCCACCAProtein prenyltransferase domain containing protein. 
AK062434GCGGGCCCACTSimilar to Ubiquitin-like protein SMT3. 
AK062434GGGGCCCACGTSimilar to Ubiquitin-like protein SMT3. 
AK058869GGGGCCCACACUbiquitin-like protein SMT3. 
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
Os01g0923300AK067520GGGGCCCACCCBS domain containing protein. 
AK061690CGGGCCCACAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK068196AGTGGGCCCGTafazzin family protein. 
AK070047ACCGGGCCCACCCSimilar to LacZ (Fragment). 
Os01g0966400AK103064AGTGGGCCCCACALeucine-rich repeat, SDS22 containing protein. 
AK102953TGTGGGCCCTIQ calmodulin-binding region domain containing protein. 
Os02g0115700AK065094CCCGGGCCCACCACatalase isozyme A (EC (CAT-A). 
AK065094GGGGCCCACATCCACCCatalase isozyme A (EC (CAT-A). 
AK070711CGGGCCCACGCGTConserved hypothetical protein. 
AK121372CAGGTGGGCCCACANucleotide-binding, alpha-beta plait domain containing protein. 
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1). 
Os02g0129700AK065610GTGGGGGCCCACCTHypothetical protein. 
AK102708CATGGGCCCACCTZinc finger, RING-type domain containing protein. 
AK109376CGTGTGGGCCCCProteasome subunit alpha type 1 (EC (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
Os02g0135700AK100570GGTGGGCCCCAGDNA polymerase V family protein. 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
AK072039GGCCGTGGGGGCCCACTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
AK070041CCGTGGGCCCACCACSimilar to Phosphoglycerate kinase, cytosolic (EC 
Os02g0177700AK119941CAAGTGGGCCCCACCProtein of unknown function DUF588 family protein. 
AK063815AACTGGGCCCACTProtein transport protein SEC61 gamma subunit. 
AK068102CCCGGGCCCACCCSimilar to PSI type III chlorophyll a/b-binding protein. 
AK104393CCGTGGGCCCCACCCCCCACACSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
Os02g0251900AK109286CCGTGGGCCCCACASimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0282600AK070262GTGTGGGCCCCACAConserved hypothetical protein. 
AK070262GTGTGGGGCCCACAConserved hypothetical protein. 
Os02g0299200AK105486CGGGCCCACAIQ calmodulin-binding region domain containing protein. 
AK100174GGGTGGGCCCGGCMtN3 and saliva related transmembrane protein family protein. 
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein. 
Os02g0304800Os02g0304800TGGGGCCCACGTGProtein prenyltransferase domain containing protein. 
Os02g0441000AK108073CTTGGGCCCACTTGConserved hypothetical protein. 
AK104969GGTGGGCCCGACTCGACConserved hypothetical protein. 
AK120516CCCCCGCGTCGTGGGCCCCACCTGMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0491300J065205O09GGTGGGGCCCACCTConserved hypothetical protein. 
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein. 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
Os02g0513100AK103266CCCGTGGGGGGCCCACASimilar to MtN3 protein precursor. 
Os02g0523800AK072296CTGGGGCCCACTInositol polyphosphate kinase family protein. 
Os02g0534600Os02g0534600TGTGGGGCCCACAConserved hypothetical protein. 
Os02g0548900AK070239TGTGGGCCCCCACHypothetical protein. 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
AK121206AGTGGGCCCCACCCCGTCCGAProtein kinase-like domain containing protein. 
AK073086GGTGGGGCCCACCTGTCSimilar to Glutathione S-transferase. 
AK073526GACAGGTGGGCCCCACCSimilar to EL3 protein. 
Os02g0567000AK068282GTGTGGGCCCATGAConserved hypothetical protein. 
Os02g0573400Os02g0573400CAAGTGGGCCCATCGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
AK070066CCGTGGGCCCCACAProtein of unknown function DUF962 family protein. 
AK070066TGTGGGGCCCACTProtein of unknown function DUF962 family protein. 
Os02g0589400009-182-H08GGGACCCACCTGGGGCCCACCAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK066974CCCACCCGGGCCCACACIQ calmodulin-binding region domain containing protein. 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
Os02g0606800AK073760CCCGGGCCCACAIsochorismatase hydrolase family protein. 
AK101791AGTGGGCCCCSimilar to Adenosine kinase-like protein (Fragment). 
AK063685GGTGGGGCCCACGCGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
AK100650TGTGGGCCCATGASimilar to Amino acid transporter protein-like. 
Os02g0686300AK066567AGAGTGGGCCCGConserved hypothetical protein. 
Os02g0686700AK111294AGGGCCCACTCCProtein of unknown function DUF581 family protein. 
AK111294CGTGGGGCCCACCTProtein of unknown function DUF581 family protein. 
AK102993AACGGGCCCACAConserved hypothetical protein. 
AK060614TGTGGGCCCCACGGalactose oxidase, central domain containing protein. 
Os02g0699700AK072471AGGGCCCACAASimilar to DNA topoisomerase II. 
AK102055TCGTGGGCCCGCSimilar to Carbamoyl phosphate synthetase small subunit (EC 
Os02g0709200AK058999GTCGCGCGCGTGGGCCCCSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC (Imidazole acetol-phosphate transaminase). 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0731700AK072346AGTGGGCCCGCSimilar to CONSTANS-like 1 protein. 
Os02g0733500AK108506TTGTGGGCCCCParvalbumin family protein. 
Os02g0741100AK068712GGTGGGGCCCACASimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 
AK066446GGTGGGGCCCACTTGSimilar to Starch synthase isoform zSTSII-2 (EC 
Os02g0745400AK072229AGGGCCCACGAGlycosyl transferase, family 8 protein. 
Os02g0753000AK121015GCTGGGCCCACTCCSimilar to Trehalose-6-phosphate phosphatase. 
AK105696TATTGGGCCCACGAAmidase family protein. 
AK106639TGTGGGCCCACGTGSimilar to UDP-glucuronosyltransferase. 
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like. 
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
Os02g0761600AK120494GGTGGGCCCCConserved hypothetical protein. 
AK069611CGGGCCCACAMitochondrial phosphate transporter. 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK112100CAAGTGGGCCCTSimilar to DEM2. 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
AK120644GGGGCCCACCTConserved hypothetical protein. 
Os02g0798300AK120999AGGGCCCACTConserved hypothetical protein. 
Os02g0803600AK064750ACAGGTGGGCCCCLongin-like domain containing protein. 
AK064750TGTGGGCCCCALongin-like domain containing protein. 
Os02g0805200AK071591CAGGTGGGCCCGProliferating cell nuclear antigen (PCNA) (Cyclin). 
Os02g0815200AK067252AGGGCCCACASimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29). 
Os02g0817500AK072707GACAGGTGGGCCCCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK069892TTGTGGGCCCCACAAUX/IAA protein family protein. 
Os02g0823400AK105029ATCTGGGCCCACASimilar to S-adenosyl-L-methionine: beta-alanine N-methyltransferase (Fragment). 
AK103528AGTGGGCCCATTTConserved hypothetical protein. 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
Os03g0113700AK103835CTGGGGCCCACCCGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CGGGTGGGCCCCAGProtein prenyltransferase domain containing protein. 
Os03g0113900AK107900GTGTGGGCCCCACCProtein of unknown function DUF584 family protein. 
Os03g0119100AK069519CAAGTGGGCCCTSimilar to Phospholipase D beta 2. 
AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
Os03g0122000AK101458AGAGTGGGCCCATCGTGTCAGTGProtein kinase-like domain containing protein. 
Os03g0124300AK069148ACGCGTGGGCCCCACCConserved hypothetical protein. 
Os03g0130400AK070255TCGTGGGCCCCAdenylate kinase, subfamily protein. 
AK100656CCGTGGGCCCCCACUbiquitin domain containing protein. 
AK100656GGTCCACGTGGGGGCCCACCCUbiquitin domain containing protein. 
Os03g0132000AK105769CGGGTGGGCCCACACGSimilar to 4-coumarate-CoA ligase-like protein. 
Os03g0133300AK064510GGTGGGCCCACAConserved hypothetical protein. 
Os03g0148000AK110468GCCGGGCCCACAProtein of unknown function DUF677 family protein. 
AK121641CGGGCCCACACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
AK121527GTGGGGCCCACTSimilar to Small GTP-binding protein. 
Os03g0154300J065112A07AGGTGGGCCCCACGAAConserved hypothetical protein. 
AK103466CGCGGGGGGGTGGGCCCCACACLupus La protein family protein. 
AK103466CGGGCCCACGTGLupus La protein family protein. 
Os03g0161200AK066932GTGGTGGGCCCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
AK099490CCGTGGGCCCCACCACZinc finger, Dof-type family protein. 
Os03g0169800AK068278GGTGGGCCCCACCTGTHNH nuclease domain containing protein. 
Os03g0171700J065192H12CCCGGGCCCACTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J065192H12GGTGGGCCCATCTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0180100AK108326TCGTGGGCCCCACCCCACCACProtein of unknown function DUF1677, plant family protein. 
Os03g0188200AK058578GGTGGGGCCCACTZinc finger, RING-type domain containing protein. 
Os03g0191200AK070228TGGTGGGCCCGGTWW/Rsp5/WWP domain containing protein. 
AK070573AGTGGGCCCGGCCCGRIM-19 family protein. 
AK058750GGTGGGCCCGSimilar to Myo-inositol-1-phosphate synthase. 
Os03g0206400AK066494GGGTGGGCCCGCConserved hypothetical protein. 
Os03g0206600AK058618GCTGGGCCCACGCProtein of unknown function DUF588 family protein. 
Os03g0213600AK100407TGTGGGGCCCACCConserved hypothetical protein. 
Os03g0222100AK070688CCCGGGCCCACTSimilar to Topoisomerase-like protein. 
Os03g0232600AK068218TATGGGCCCACCTU box domain containing protein. 
AK100620CCCACGGGCCCACCTArmadillo-like helical domain containing protein. 
AK100620GGGGCCCACTArmadillo-like helical domain containing protein. 
Os03g0248600AK073611CGGGTGGGCCCTSimilar to Enolase 2 (EC (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK119298CAGGTGGGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
AK071625AGGGCCCACCTGHeat shock protein DnaJ, N-terminal domain containing protein. 
AK071625CAGGTGGGGCCCACTCCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0256400AK073854GTTTGGGCCGCAGGGCCCACAASimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0260100AK066143TGATGGGCCCACAConserved hypothetical protein. 
AK104129TGTGGGCCCCAClass I low-molecular-weight heat shock protein 17.9. 
AK109239GCGGGCCCACCCACCGCACGCGConserved hypothetical protein. 
AK121750CGGGCCCACCACSimilar to Histone H2A. 
Os03g0288400Os03g0288400GCGGGCCCACCAConserved hypothetical protein. 
Os03g0294200AK069285CCCGGGCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
AK069285CCCGTGGGCCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
AK069285GCTGGGCCCACCTSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
AK069222GGGGCCCACCTConserved hypothetical protein. 
AK071397GGTGGGGCCCACCTGTCUniversal stress protein (Usp) family protein. 
Os03g0306900AK073626CACGTGGGGTCGTGGGCCCCAGTENA/THI-4 protein domain containing protein. 
Os03g0307000J065032I03CTGGGGCCCACGACCCCACGTGHypothetical protein. 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
Os03g0312500AK106657CCCACGTGGGCCCCASimilar to Inhibitor of apoptosis-like protein. 
AK071812AGGGCCCACAASimilar to Galactinol synthase (Fragment). 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065136O13GGGGCCCACCCCCGCGNo apical meristem (NAM) protein domain containing protein. 
AK111509GGTGGGGCCCACCCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK070859CAAGTGGGCCCCACCSimilar to Uroporphyrinogen decarboxylase (EC (URO-D) (UPD) (Fragment). 
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 
AK064815CCCGTGGGCCCCACDormancyauxin associated family protein. 
Os03g0345100AK065579CCATGGGCCCACCRad9 family protein. 
AK059673TGTGGGGCCCACASimilar to Acyl carrier protein 1 (EC (EC 
Os03g0370000AK100033GGTGGGGCCCACCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 
Os03g0373300AK107897TCGTGGGCCCCACGTCTCProtein of unknown function DUF1110 family protein. 
AK069719GGTGGGCCCACCTConserved hypothetical protein. 
Os03g0374500Os03g0374500GGTGGGCCCACCTHypothetical protein. 
Os03g0376000AK059565TGGATGGGCCCACGAemp24/gp25L/p24 family protein. 
AK061515GACAGGTGGGCCCGTTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
AK069928CGTGTGGGCCCGGGCCCGGASimilar to Low affinity calcium transporter CAX2 (Fragment). 
Os03g0405000AK070839AGATGGGCCCACAReticulon family protein. 
Os03g0405100AK108624CCGTGGGCCCAACCRpsU-divergently transcribed family protein. 
AY062181CGGGCCCACCCSimilar to Potential histone-like transcription factor. 
Os03g0415500AK108435TGGTGGGCCCTGGCCCATCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
AK120432TCGTGGGCCCAAGConserved hypothetical protein. 
Os03g0586300AK100442CAAGTGGGCCCCReticulon family protein. 
AK100442CAGGTGGGCCCCReticulon family protein. 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
Os03g0633900AK059181ACGTGGGCCCCACASingle-strand binding protein family protein. 
Os03g0643300AK099445AGTGGGCCCCACCACSimilar to AER123Wp. 
AK099445CAAGTGGGCCCAGASimilar to AER123Wp. 
Os03g0666200AK102364GCGGGCCCACTCTPleckstrin homology-type domain containing protein. 
AK069553TGTGGGCCCCACCGATCCGSimilar to YJR013Wp (Fragment). 
AK103705TGGTGGGCCCAGAHypothetical protein. 
J033048F03CCCACTCCCTGGGGCCCACCTGSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
AK063345TGTGGGCCCACAATetratricopeptide-like helical domain containing protein. 
Os03g0741400AK121838CTGGGGCCCACTSimilar to SUSIBA2. 
Os03g0746800AK101718GGTGGGCCCAACWD-40 repeat containing protein. 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
AK120423GGTGGGCCCTProtein of unknown function UPF0139 family protein. 
AK102002CACGTGGGCCCCPlastocyanin-like domain containing protein. 
AK060387GCCGTTGGGTGGGCCCCACGTSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK073162AGGGCCCACASimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
D13224CAGGTGGGCCCCTubulin beta-1 chain (Beta-1 tubulin). 
D13224CCCGTGGGCCCCACGTTubulin beta-1 chain (Beta-1 tubulin). 
AK103085GGCCCGGGCCCACCACFatty acid hydroxylase domain containing protein. 
Os03g0788800AK071670CAGGTGGGCCCCZinc finger, RING-type domain containing protein. 
AK071670GTGGGGCCCACGCZinc finger, RING-type domain containing protein. 
AK071787CCCGGGCCCACCAProtein of unknown function DUF593 family protein. 
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein). 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
AK105257TCGTGGGCCCCACCProtein of unknown function DUF506, plant family protein. 
Os03g0796800J065024O22CACGTGGGCCCCATCCAConserved hypothetical protein. 
J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein. 
J065024O22TGTGGGCCCGCConserved hypothetical protein. 
AK070229GGTGGGCCCACACPutative small multi-drug export family protein. 
Os03g0808100AK069196CAGGTGGGCCCCACCSimilar to Cellulose synthase-5. 
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein. 
AK071076TGTGGGCCCCACATGTCAGTGSimilar to Peptidyl prolyl isomerase H. 
AK070263TGTGGGCCCTHeavy metal transport/detoxification protein domain containing protein. 
AK101448AGGTGGGCCCAATArmadillo-like helical domain containing protein. 
AK101448TCCGGGCCCACCAArmadillo-like helical domain containing protein. 
Os03g0825900AK109694AGTTGGGCCCACAConserved hypothetical protein. 
Os03g0832600AK120137GGTGGGCCCCACASimilar to Galactokinase (EC (Galactose kinase). 
AK121918GTGTGGGCCCACAGCCCAGCRNA 3'-terminal phosphate cyclase family protein. 
AK067084GGGTGGGCCCCACCTGSimilar to RNA-binding protein RZ-1. 
Os03g0837900AK068346ACCGGGCCCACACStreptomyces cyclase/dehydrase family protein. 
Os03g0850100AK101126ACGTGGGGCCCACCTGNLI interacting factor domain containing protein. 
AK061374GCGGGCCCACCTProtein of unknown function UPF0131 family protein. 
AK061374GGCTGGGCCCACGCGProtein of unknown function UPF0131 family protein. 
Os03g0859500AK070637AGGTGGGCCCTABC transporter related domain containing protein. 
Os04g0126800AK107895CCCGGGCCCACGGGHypothetical protein. 
Os04g0175000AK101746AGGGCCCACAConserved hypothetical protein. 
AK121488CGTGTGGGCCCCAHeavy metal transport/detoxification protein domain containing protein. 
AK068202GTGGTGGGCCCCACCACSimilar to AHM2 (Fragment). 
AK069447CTGGGGCCCACCBacterial transketolase family protein. 
AK068732AGTGGGCCCCACCSimilar to Serine carboxypeptidase I precursor (EC (Carboxypeptidase C). 
AK061121AGGGCCCACCTGTCAGReticulon family protein. 
AK062814GCGTGGGCCCACGCCACACGACGCGTCCSimilar to Quinone-oxidoreductase QR1 (Fragment). 
AK101795AGTGGGCCCCACGSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
AK063862CCCGTGGGGCCCACGCConserved hypothetical protein. 
AK063862GTGGGGGCCCACTCTConserved hypothetical protein. 
AK098921TGTGGGCCCCCACSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit. 
AK058627TGTGGGGCCCACASimilar to DNA-binding protein S1FA. 
Os04g0412900AK073418TGTGGGCCCCACCACSec23/Sec24 trunk region domain containing protein. 
Os04g0435700AK100857CCCACCCGGGCCCACCCGSimilar to UVB-resistance protein UVR8. 
AK105415GCTGGGCCCACTCTNonsense-mediated decay UPF3 domain containing protein. 
AK065178CAGGTGGGCCCCACCCGSimilar to TMV induced protein 1-2. 
AK071311TGTGGGCCCCACCSimilar to 14-3-3-like protein GF14-6. 
Os04g0463400AK059730AGGGCCCACCAProtein of unknown function DUF125, transmembrane family protein. 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
AK064143GGTGGGCCCAAACBTB domain containing protein. 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
Os04g0503500AK099404CGGGCCCACAALeucine-rich repeat, cysteine-containing subtype containing protein. 
Os04g0506300AK063591TCGTGGGCCCCACCCGTMS membrane protein/tumour differentially expressed protein family protein. 
AK073718GGTGGGCCCCSimilar to Ammonium transporter Amt1;2 (Fragment). 
Os04g0512500AK107826TGGTGGGCCCCACCConserved hypothetical protein. 
Os04g0559400AK106376CCTGGGCCCACGCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC (Atbcat-5). 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
AK065648TCTGGGCCCACGATatD-related deoxyribonuclease family protein. 
AK105286GTGGGGCCCACCZinc finger, DHHC-type domain containing protein. 
AK061833CAAGTGGGCCCACCGlycosyl transferase, group 1 domain containing protein. 
Os04g0602800AK100925TATGGGCCCACASimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
AK072824AGATGGGCCCACATGTCAGTGConserved hypothetical protein. 
AK072824GTGGGGCCCACAAGTCAGTGGConserved hypothetical protein. 
Os04g0608300AK111353AGGTGGGCCCCACACGalactokinase family protein. 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK060707TCCGACGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
AK071125GTGGGGCCCACGGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
AK067094GGGGCCCACCCProtein of unknown function UPF0136, Transmembrane family protein. 
AK120899ACATGGGCCCACTTGATPase, V0 complex, subunit H family protein. 
AK120899TTGTGGGCCCAAACATPase, V0 complex, subunit H family protein.