version

Summary of OsREG640 (All List)

OrganismOryza sativa  
IDOsREG640  
SequenceGGGCCCAC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count6744  

Entry Sequences (6744 entries)

LocusGene modelSequenceDescription
Os01g0103600006-072-A01GTGGTGGGCCCCCACNONE 
AK059848GTGGTGGGCCCCCACEmopamil-binding family protein. 
AK102848GTGGTGGGCCCCCACNONE 
J033036P20GTGGTGGGCCCCCACNONE 
J065171N21GTGGTGGGCCCCCACNONE 
J065209M02GTGGTGGGCCCCCACNONE 
J075067A03GTGGTGGGCCCCCACNONE 
J075110C09GTGGTGGGCCCCCACNONE 
Os01g0131600006-030-A03CGCGTGGGCCCGGANONE 
006-030-A03GGGTGGGCCCACGCGTNONE 
006-049-C10CGCGTGGGCCCGGANONE 
006-049-C10GGGTGGGCCCACGCGTNONE 
006-054-E02CGCGTGGGCCCGGANONE 
006-054-E02GGGTGGGCCCACGCGTNONE 
011-035-H02CGCGTGGGCCCGGANONE 
011-035-H02GGGTGGGCCCACGCGTNONE 
011-036-E04CGCGTGGGCCCGGANONE 
011-036-E04GGGTGGGCCCACGCGTNONE 
012-047-C08CGCGTGGGCCCGGANONE 
012-047-C08GGGTGGGCCCACGCGTNONE 
012-079-F08CGCGTGGGCCCGGANONE 
012-079-F08GGGTGGGCCCACGCGTNONE 
012-097-C02CGCGTGGGCCCGGANONE 
012-097-C02GGGTGGGCCCACGCGTNONE 
012-100-A07CGCGTGGGCCCGGANONE 
012-100-A07GGGTGGGCCCACGCGTNONE 
013-015-H05CGCGTGGGCCCGGANONE 
013-015-H05GGGTGGGCCCACGCGTNONE 
013-047-A03CGCGTGGGCCCGGANONE 
013-047-A03GGGTGGGCCCACGCGTNONE 
013-051-B05CGCGTGGGCCCGGANONE 
013-051-B05GGGTGGGCCCACGCGTNONE 
013-061-G02CGCGTGGGCCCGGANONE 
013-061-G02GGGTGGGCCCACGCGTNONE 
013-077-H02CGCGTGGGCCCGGANONE 
013-077-H02GGGTGGGCCCACGCGTNONE 
015-005-D04CGCGTGGGCCCGGANONE 
015-005-D04GGGTGGGCCCACGCGTNONE 
015-064-B06CGCGTGGGCCCGGANONE 
015-064-B06GGGTGGGCCCACGCGTNONE 
015-072-D02CGCGTGGGCCCGGANONE 
015-072-D02GGGTGGGCCCACGCGTNONE 
016-073-E09CGCGTGGGCCCGGANONE 
016-073-E09GGGTGGGCCCACGCGTNONE 
016-088-H03CGCGTGGGCCCGGANONE 
016-088-H03GGGTGGGCCCACGCGTNONE 
AK062063CGCGTGGGCCCGGANONE 
AK062063GGGTGGGCCCACGCGTNONE 
AK101133CGCGTGGGCCCGGASimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK101133GGGTGGGCCCACGCGTSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277CGCGTGGGCCCGGANONE 
AK102277GGGTGGGCCCACGCGTNONE 
AK119645CGCGTGGGCCCGGANONE 
AK119645GGGTGGGCCCACGCGTNONE 
AY341828CGCGTGGGCCCGGANONE 
AY341828GGGTGGGCCCACGCGTNONE 
J013036O08CGCGTGGGCCCGGANONE 
J013036O08GGGTGGGCCCACGCGTNONE 
J013037M17CGCGTGGGCCCGGANONE 
J013037M17GGGTGGGCCCACGCGTNONE 
J013039B11CGCGTGGGCCCGGANONE 
J013039B11GGGTGGGCCCACGCGTNONE 
J013039L20CGCGTGGGCCCGGANONE 
J013039L20GGGTGGGCCCACGCGTNONE 
J013047B20CGCGTGGGCCCGGANONE 
J013047B20GGGTGGGCCCACGCGTNONE 
J013048E23CGCGTGGGCCCGGANONE 
J013048E23GGGTGGGCCCACGCGTNONE 
J013051E12CGCGTGGGCCCGGANONE 
J013051E12GGGTGGGCCCACGCGTNONE 
J013051F12CGCGTGGGCCCGGANONE 
J013051F12GGGTGGGCCCACGCGTNONE 
J013056B05CGCGTGGGCCCGGANONE 
J013056B05GGGTGGGCCCACGCGTNONE 
J013057N24CGCGTGGGCCCGGANONE 
J013057N24GGGTGGGCCCACGCGTNONE 
J013064D21CGCGTGGGCCCGGANONE 
J013064D21GGGTGGGCCCACGCGTNONE 
J013065G24CGCGTGGGCCCGGANONE 
J013065G24GGGTGGGCCCACGCGTNONE 
J013075L13CGCGTGGGCCCGGANONE 
J013075L13GGGTGGGCCCACGCGTNONE 
J013075L24CGCGTGGGCCCGGANONE 
J013075L24GGGTGGGCCCACGCGTNONE 
J013092F04CGCGTGGGCCCGGANONE 
J013092F04GGGTGGGCCCACGCGTNONE 
J013092F10CGCGTGGGCCCGGANONE 
J013092F10GGGTGGGCCCACGCGTNONE 
J013092M16CGCGTGGGCCCGGANONE 
J013092M16GGGTGGGCCCACGCGTNONE 
J013096K06CGCGTGGGCCCGGANONE 
J013096K06GGGTGGGCCCACGCGTNONE 
J013111F10CGCGTGGGCCCGGANONE 
J013111F10GGGTGGGCCCACGCGTNONE 
J013120B17CGCGTGGGCCCGGANONE 
J013120B17GGGTGGGCCCACGCGTNONE 
J013120P07CGCGTGGGCCCGGANONE 
J013120P07GGGTGGGCCCACGCGTNONE 
J013122F18CGCGTGGGCCCGGANONE 
J013122F18GGGTGGGCCCACGCGTNONE 
J013122H23CGCGTGGGCCCGGANONE 
J013122H23GGGTGGGCCCACGCGTNONE 
J013126I15CGCGTGGGCCCGGANONE 
J013126I15GGGTGGGCCCACGCGTNONE 
J013126L17CGCGTGGGCCCGGANONE 
J013126L17GGGTGGGCCCACGCGTNONE 
J013129C15CGCGTGGGCCCGGANONE 
J013129C15GGGTGGGCCCACGCGTNONE 
J013146A04CGCGTGGGCCCGGANONE 
J013146A04GGGTGGGCCCACGCGTNONE 
J013146A06CGCGTGGGCCCGGANONE 
J013146A06GGGTGGGCCCACGCGTNONE 
J013153F01CGCGTGGGCCCGGANONE 
J013153F01GGGTGGGCCCACGCGTNONE 
J013156O06CGCGTGGGCCCGGANONE 
J013156O06GGGTGGGCCCACGCGTNONE 
J013162D05CGCGTGGGCCCGGANONE 
J013162D05GGGTGGGCCCACGCGTNONE 
J023008N04CGCGTGGGCCCGGANONE 
J023008N04GGGTGGGCCCACGCGTNONE 
J023010D06CGCGTGGGCCCGGANONE 
J023010D06GGGTGGGCCCACGCGTNONE 
J023011I23CGCGTGGGCCCGGANONE 
J023011I23GGGTGGGCCCACGCGTNONE 
J023023I15CGCGTGGGCCCGGANONE 
J023023I15GGGTGGGCCCACGCGTNONE 
J023025C08CGCGTGGGCCCGGANONE 
J023025C08GGGTGGGCCCACGCGTNONE 
J023029H02CGCGTGGGCCCGGANONE 
J023029H02GGGTGGGCCCACGCGTNONE 
J023033C18CGCGTGGGCCCGGANONE 
J023033C18GGGTGGGCCCACGCGTNONE 
J023037D21CGCGTGGGCCCGGANONE 
J023037D21GGGTGGGCCCACGCGTNONE 
J023049F17CGCGTGGGCCCGGANONE 
J023049F17GGGTGGGCCCACGCGTNONE 
J023052B15CGCGTGGGCCCGGANONE 
J023052B15GGGTGGGCCCACGCGTNONE 
J023061D03CGCGTGGGCCCGGANONE 
J023061D03GGGTGGGCCCACGCGTNONE 
J023062M01CGCGTGGGCCCGGANONE 
J023062M01GGGTGGGCCCACGCGTNONE 
J023089D24CGCGTGGGCCCGGANONE 
J023089D24GGGTGGGCCCACGCGTNONE 
J023109J20CGCGTGGGCCCGGANONE 
J023109J20GGGTGGGCCCACGCGTNONE 
J023109M21CGCGTGGGCCCGGANONE 
J023109M21GGGTGGGCCCACGCGTNONE 
J023120N04CGCGTGGGCCCGGANONE 
J023120N04GGGTGGGCCCACGCGTNONE 
J023122A04CGCGTGGGCCCGGANONE 
J023122A04GGGTGGGCCCACGCGTNONE 
J023134F23CGCGTGGGCCCGGANONE 
J023134F23GGGTGGGCCCACGCGTNONE 
J023149E20CGCGTGGGCCCGGANONE 
J023149E20GGGTGGGCCCACGCGTNONE 
J033022A12CGCGTGGGCCCGGANONE 
J033022A12GGGTGGGCCCACGCGTNONE 
J033022C04CGCGTGGGCCCGGANONE 
J033022C04GGGTGGGCCCACGCGTNONE 
J033024K06CGCGTGGGCCCGGANONE 
J033024K06GGGTGGGCCCACGCGTNONE 
J033026F23CGCGTGGGCCCGGANONE 
J033026F23GGGTGGGCCCACGCGTNONE 
J033029J19CGCGTGGGCCCGGANONE 
J033029J19GGGTGGGCCCACGCGTNONE 
J033040H20CGCGTGGGCCCGGANONE 
J033040H20GGGTGGGCCCACGCGTNONE 
J033042P21CGCGTGGGCCCGGANONE 
J033042P21GGGTGGGCCCACGCGTNONE 
J033043F14CGCGTGGGCCCGGANONE 
J033043F14GGGTGGGCCCACGCGTNONE 
J033044G11CGCGTGGGCCCGGANONE 
J033044G11GGGTGGGCCCACGCGTNONE 
J033052L10CGCGTGGGCCCGGANONE 
J033052L10GGGTGGGCCCACGCGTNONE 
J033052O03CGCGTGGGCCCGGANONE 
J033052O03GGGTGGGCCCACGCGTNONE 
J033052P03CGCGTGGGCCCGGANONE 
J033052P03GGGTGGGCCCACGCGTNONE 
J033079B20CGCGTGGGCCCGGANONE 
J033079B20GGGTGGGCCCACGCGTNONE 
J033089D21CGCGTGGGCCCGGANONE 
J033089D21GGGTGGGCCCACGCGTNONE 
J033094P04CGCGTGGGCCCGGANONE 
J033094P04GGGTGGGCCCACGCGTNONE 
J033103N02CGCGTGGGCCCGGANONE 
J033103N02GGGTGGGCCCACGCGTNONE 
J033110J19CGCGTGGGCCCGGANONE 
J033110J19GGGTGGGCCCACGCGTNONE 
J033114E17CGCGTGGGCCCGGANONE 
J033114E17GGGTGGGCCCACGCGTNONE 
J033115K04CGCGTGGGCCCGGANONE 
J033115K04GGGTGGGCCCACGCGTNONE 
J033119I06CGCGTGGGCCCGGANONE 
J033119I06GGGTGGGCCCACGCGTNONE 
J033121L10CGCGTGGGCCCGGANONE 
J033121L10GGGTGGGCCCACGCGTNONE 
J033123H14CGCGTGGGCCCGGANONE 
J033123H14GGGTGGGCCCACGCGTNONE 
J033136H10CGCGTGGGCCCGGANONE 
J033136H10GGGTGGGCCCACGCGTNONE 
J033139L07CGCGTGGGCCCGGANONE 
J033139L07GGGTGGGCCCACGCGTNONE 
J033143G23CGCGTGGGCCCGGANONE 
J033143G23GGGTGGGCCCACGCGTNONE 
J043021F16CGCGTGGGCCCGGANONE 
J043021F16GGGTGGGCCCACGCGTNONE 
J080304G01CGCGTGGGCCCGGANONE 
J080304G01GGGTGGGCCCACGCGTNONE 
J080305H24CGCGTGGGCCCGGANONE 
J080305H24GGGTGGGCCCACGCGTNONE 
J080309B11CGCGTGGGCCCGGANONE 
J080309B11GGGTGGGCCCACGCGTNONE 
J080315N09CGCGTGGGCCCGGANONE 
J080315N09GGGTGGGCCCACGCGTNONE 
J080319J20CGCGTGGGCCCGGANONE 
J080319J20GGGTGGGCCCACGCGTNONE 
J090014D01CGCGTGGGCCCGGANONE 
J090014D01GGGTGGGCCCACGCGTNONE 
J090067F08CGCGTGGGCCCGGANONE 
J090067F08GGGTGGGCCCACGCGTNONE 
J090079P18CGCGTGGGCCCGGANONE 
J090079P18GGGTGGGCCCACGCGTNONE 
J090082K13CGCGTGGGCCCGGANONE 
J090082K13GGGTGGGCCCACGCGTNONE 
J090093K17CGCGTGGGCCCGGANONE 
J090093K17GGGTGGGCCCACGCGTNONE 
J090099G18CGCGTGGGCCCGGANONE 
J090099G18GGGTGGGCCCACGCGTNONE 
J100022K14CGCGTGGGCCCGGANONE 
J100022K14GGGTGGGCCCACGCGTNONE 
J100052G17CGCGTGGGCCCGGANONE 
J100052G17GGGTGGGCCCACGCGTNONE 
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0144600006-037-H02ACCGGGCCCACANONE 
006-037-H02TGTGGGCCCGCACGCCACNONE 
AK061501ACCGGGCCCACAConserved hypothetical protein. 
AK061501TGTGGGCCCGCACGCCACConserved hypothetical protein. 
AK102823ACCGGGCCCACANONE 
AK102823TGTGGGCCCGCACGCCACNONE 
J033108P10ACCGGGCCCACANONE 
J033108P10TGTGGGCCCGCACGCCACNONE 
J043026K08ACCGGGCCCACANONE 
J043026K08TGTGGGCCCGCACGCCACNONE 
J090009H21ACCGGGCCCACANONE 
J090009H21TGTGGGCCCGCACGCCACNONE 
Os01g0145200J100017K24CAAGTGGGCCCAGTANONE 
Os01g0147700AK066686TGTGGGCCCTRegion of unknown function, putative Zinc finger, XS and XH domain containing protein. 
Os01g0150000006-053-H07CCCGTGGGCCCCACACNONE 
006-081-C11CCCGTGGGCCCCACACNONE 
009-050-D04CCCGTGGGCCCCACACNONE 
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18CCCGTGGGCCCCACACNONE 
J023112H22CCCGTGGGCCCCACACNONE 
J065048P05CCCGTGGGCCCCACACNONE 
J100068N20CCCGTGGGCCCCACACNONE 
J100073A02CCCGTGGGCCCCACACNONE 
Os01g0150100J023078H07CTTGGGCCCACCTGTCNONE 
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein. 
AK106766GGGGCCCACAAnkyrin repeat containing protein. 
Os01g0159800015-032-D03AGTGGGCCCAGGNONE 
AK106292AGTGGGCCCAGGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J053031O06AGTGGGCCCAGGNONE 
J053035H22AGTGGGCCCAGGNONE 
J065095A07AGTGGGCCCAGGNONE 
J100017I21AGTGGGCCCAGGNONE 
Os01g0174300012-006-G02CCGTGGGCCCACACNONE 
AK071324CCGTGGGCCCACACNADH:cytochrome b5 reductase (CBR) family protein. 
AK104306CCGTGGGCCCACACNONE 
J023089J04CCGTGGGCCCACACNONE 
J023107J15CCGTGGGCCCACACNONE 
J033084J16CCGTGGGCCCACACNONE 
J065097O20CCGTGGGCCCACACNONE 
J065099J15CCGTGGGCCCACACNONE 
J090006K02CCGTGGGCCCACACNONE 
J090023L17CCGTGGGCCCACACNONE 
J090088G14CCGTGGGCCCACACNONE 
Os01g0179000015-092-B11CAGGTGGGCCCCACCTransferase family protein. 
J033107B12CAGGTGGGCCCCACCNONE 
Os01g0180300AK120377GCTGGGCTGGGCCCACACLipoprotein, type 6 family protein. 
J013071N06GCTGGGCTGGGCCCACACNONE 
J023088F12GCTGGGCTGGGCCCACACNONE 
J100027H24GCTGGGCTGGGCCCACACNONE 
J100053K15GCTGGGCTGGGCCCACACNONE 
J100082M15GCTGGGCTGGGCCCACACNONE 
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein. 
AK102544CACTGACAGCCCGGGCCCACCNONE 
J023047L21CACTGACAGCCCGGGCCCACCNONE 
J023135I09CACTGACAGCCCGGGCCCACCNONE 
J033028G17CACTGACAGCCCGGGCCCACCNONE 
J065164L07CACTGACAGCCCGGGCCCACCNONE 
J065193F22CACTGACAGCCCGGGCCCACCNONE 
J075035I10CACTGACAGCCCGGGCCCACCNONE 
J075168H15CACTGACAGCCCGGGCCCACCNONE 
Os01g0185200009-146-B06CCCGTGGGCCCACCCNONE 
009-146-B06GCGGGCCCACACNONE 
009-163-F01CCCGTGGGCCCACCCNONE 
009-163-F01GCGGGCCCACACNONE 
AK062984CCCGTGGGCCCACCCNONE 
AK062984GCGGGCCCACACNONE 
AK065125CCCGTGGGCCCACCCGlutamyl-tRNA synthetase, class Ic family protein. 
AK065125GCGGGCCCACACGlutamyl-tRNA synthetase, class Ic family protein. 
AK105222CCCGTGGGCCCACCCNONE 
AK105222GCGGGCCCACACNONE 
AK111284CCCGTGGGCCCACCCNONE 
AK111284GCGGGCCCACACNONE 
Os01g0185300011-055-A05CGTGTGGGGCCCACGTGNONE 
015-007-B11CGTGTGGGGCCCACGTGNONE 
015-062-F05CGTGTGGGGCCCACGTGNONE 
015-078-C11CGTGTGGGGCCCACGTGNONE 
016-068-F07CGTGTGGGGCCCACGTGNONE 
016-074-F08CGTGTGGGGCCCACGTGNONE 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK098922CGTGTGGGGCCCACGTGNONE 
J013000G12CGTGTGGGGCCCACGTGNONE 
J013001P14CGTGTGGGGCCCACGTGNONE 
J013002O23CGTGTGGGGCCCACGTGNONE 
J013096L23CGTGTGGGGCCCACGTGNONE 
J013097F24CGTGTGGGGCCCACGTGNONE 
J013120N24CGTGTGGGGCCCACGTGNONE 
J023007C15CGTGTGGGGCCCACGTGNONE 
J023119O12CGTGTGGGGCCCACGTGNONE 
J033039O11CGTGTGGGGCCCACGTGNONE 
J033043L11CGTGTGGGGCCCACGTGNONE 
J033061A07CGTGTGGGGCCCACGTGNONE 
J033076M13CGTGTGGGGCCCACGTGNONE 
J033082B04CGTGTGGGGCCCACGTGNONE 
J033143H15CGTGTGGGGCCCACGTGNONE 
J043013A02CGTGTGGGGCCCACGTGNONE 
J043036N21CGTGTGGGGCCCACGTGNONE 
J065013M09CGTGTGGGGCCCACGTGNONE 
J065082E22CGTGTGGGGCCCACGTGNONE 
J065093G01CGTGTGGGGCCCACGTGNONE 
J065120L06CGTGTGGGGCCCACGTGNONE 
J065135D03CGTGTGGGGCCCACGTGNONE 
J065197C10CGTGTGGGGCCCACGTGNONE 
J100024J10CGTGTGGGGCCCACGTGNONE 
J100042M22CGTGTGGGGCCCACGTGNONE 
J100077E12CGTGTGGGGCCCACGTGNONE 
J100084P03CGTGTGGGGCCCACGTGNONE 
Os01g0186900013-032-B12CGCGTGGGCCCCNONE 
013-069-C11CGCGTGGGCCCCNONE 
AK105323CGCGTGGGCCCCNONE 
AK105331CGCGTGGGCCCCConserved hypothetical protein. 
AK106168CGCGTGGGCCCCNONE 
J065023I10CGCGTGGGCCCCNONE 
J065182I03CGCGTGGGCCCCNONE 
J075116O22CGCGTGGGCCCCNONE 
J090082G13CGCGTGGGCCCCNONE 
J100060H12CGCGTGGGCCCCNONE 
Os01g0198100AK119908TGTGGGCCCCConserved hypothetical protein. 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
Os01g0212100AK065467AGCCCATCCAAGGTGGGCCCAAATNONE 
AK101456AGCCCATCCAAGGTGGGCCCAAATATP-dependent helicase, DEAH-box family protein. 
Os01g0218700AK064992CGCGTGGGCCCGGCABC transporter, transmembrane region, type 1 domain containing protein. 
Os01g0221500012-036-F06AGGGCCCACANONE 
AK063996AGGGCCCACAConserved hypothetical protein. 
J065061G22AGGGCCCACANONE 
J065098K21AGGGCCCACANONE 
J065214G03AGGGCCCACANONE 
J065218L03AGGGCCCACANONE 
J080301D09AGGGCCCACANONE 
Os01g0239700AK067723ACCGGGCCCACAASimilar to Leucine-rich receptor-like protein kinase. 
AK122130ACCGGGCCCACAANONE 
Os01g0246500AK058984GGGGCCCACCTGTCSimilar to Minus dominance protein. 
Os01g0250900AK065179TGTGGGCCCCACGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
J013002D15TGTGGGCCCCACGNONE 
J013037K03TGTGGGCCCCACGNONE 
J013091F03TGTGGGCCCCACGNONE 
J013127B14TGTGGGCCCCACGNONE 
Os01g0253500J100088F12TCTGGGCCCACGAConserved hypothetical protein. 
Os01g0257400AK073920GGTGGGGCCCACCTGZinc finger, CCCH-type domain containing protein. 
Os01g0270100006-096-H09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-009-C10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-054-E06GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
014-085-F09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK073275GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK104155GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
J033025K21GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075065H10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075143G10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J100059J02GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
Os01g0271700J065184P16AGGGCCCACGTNONE 
J075182E21AGGGCCCACGTNONE 
J075191M19AGGGCCCACGTNONE 
J090021E22AGGGCCCACGTNONE 
Os01g0273300Os01g0273300CTGGGGCCCACCCBSD domain containing protein. 
Os01g0273800AK109645CAGGTGGGCCCCAFAD dependent oxidoreductase family protein. 
Os01g0276700011-014-A12GGGTGGGCCCCACCTGTCAGTNONE 
012-092-G12GGGTGGGCCCCACCTGTCAGTNONE 
AK103164GGGTGGGCCCCACCTGTCAGTNONE 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09GGGTGGGCCCCACCTGTCAGTNONE 
J023084I02GGGTGGGCCCCACCTGTCAGTNONE 
J033027F20GGGTGGGCCCCACCTGTCAGTNONE 
J033029M06GGGTGGGCCCCACCTGTCAGTNONE 
J033039K13GGGTGGGCCCCACCTGTCAGTNONE 
J033057C24GGGTGGGCCCCACCTGTCAGTNONE 
J033058G20GGGTGGGCCCCACCTGTCAGTNONE 
J033060A14GGGTGGGCCCCACCTGTCAGTNONE 
J033061M21GGGTGGGCCCCACCTGTCAGTNONE 
J033068M10GGGTGGGCCCCACCTGTCAGTNONE 
J033074K16GGGTGGGCCCCACCTGTCAGTNONE 
J033076C11GGGTGGGCCCCACCTGTCAGTNONE 
J033093O13GGGTGGGCCCCACCTGTCAGTNONE 
J033119H20GGGTGGGCCCCACCTGTCAGTNONE 
J033121D22GGGTGGGCCCCACCTGTCAGTNONE 
J033129N11GGGTGGGCCCCACCTGTCAGTNONE 
J033131E12GGGTGGGCCCCACCTGTCAGTNONE 
J033150L07GGGTGGGCCCCACCTGTCAGTNONE 
J053024N17GGGTGGGCCCCACCTGTCAGTNONE 
J053034G19GGGTGGGCCCCACCTGTCAGTNONE 
J053035E18GGGTGGGCCCCACCTGTCAGTNONE 
J053046M01GGGTGGGCCCCACCTGTCAGTNONE 
J053047P04GGGTGGGCCCCACCTGTCAGTNONE 
J053048B06GGGTGGGCCCCACCTGTCAGTNONE 
J053050M22GGGTGGGCCCCACCTGTCAGTNONE 
J053053E09GGGTGGGCCCCACCTGTCAGTNONE 
J053053I07GGGTGGGCCCCACCTGTCAGTNONE 
J053059K03GGGTGGGCCCCACCTGTCAGTNONE 
J053059P12GGGTGGGCCCCACCTGTCAGTNONE 
J053060C12GGGTGGGCCCCACCTGTCAGTNONE 
J053060H24GGGTGGGCCCCACCTGTCAGTNONE 
J053064D19GGGTGGGCCCCACCTGTCAGTNONE 
J053066L15GGGTGGGCCCCACCTGTCAGTNONE 
J053073I02GGGTGGGCCCCACCTGTCAGTNONE 
J053083E15GGGTGGGCCCCACCTGTCAGTNONE 
J053094D05GGGTGGGCCCCACCTGTCAGTNONE 
J053094P18GGGTGGGCCCCACCTGTCAGTNONE 
J053095C15GGGTGGGCCCCACCTGTCAGTNONE 
J053095C21GGGTGGGCCCCACCTGTCAGTNONE 
J053099N16GGGTGGGCCCCACCTGTCAGTNONE 
J090025O19GGGTGGGCCCCACCTGTCAGTNONE 
J090049N22GGGTGGGCCCCACCTGTCAGTNONE 
J090050F17GGGTGGGCCCCACCTGTCAGTNONE 
Os01g0277700006-081-F10AGGTGGGCCCCACCNONE 
014-013-D02AGGTGGGCCCCACCNONE 
AK061133AGGTGGGCCCCACCConserved hypothetical protein. 
AK099198AGGTGGGCCCCACCNONE 
J023115B14AGGTGGGCCCCACCNONE 
J065017F22AGGTGGGCCCCACCNONE 
J065090C03AGGTGGGCCCCACCNONE 
J065165H07AGGTGGGCCCCACCNONE 
Os01g0281100AK109672GCGGGCCCACTTGTCAGTGConserved hypothetical protein. 
J065013K07GCGGGCCCACTTGTCAGTGNONE 
J065040E15GCGGGCCCACTTGTCAGTGNONE 
J065127F12GCGGGCCCACTTGTCAGTGNONE 
J075155K23GCGGGCCCACTTGTCAGTGNONE 
Os01g0314300AK073419TTTTGGGCCCACCACUncharacterized domain 2 containing protein. 
AK104939TTTTGGGCCCACCACNONE 
J033044B03TTTTGGGCCCACCACNONE 
J033060E12TTTTGGGCCCACCACNONE 
J043037E21TTTTGGGCCCACCACNONE 
J065019O18TTTTGGGCCCACCACNONE 
J065025P22TTTTGGGCCCACCACNONE 
J065042P06TTTTGGGCCCACCACNONE 
J065074C19TTTTGGGCCCACCACNONE 
J065074E13TTTTGGGCCCACCACNONE 
J065094E05TTTTGGGCCCACCACNONE 
J065108N08TTTTGGGCCCACCACNONE 
J065134L13TTTTGGGCCCACCACNONE 
J065152N24TTTTGGGCCCACCACNONE 
J065162N24TTTTGGGCCCACCACNONE 
J065170P16TTTTGGGCCCACCACNONE 
J065177M20TTTTGGGCCCACCACNONE 
J065187N01TTTTGGGCCCACCACNONE 
J075012N12TTTTGGGCCCACCACNONE 
J075046C17TTTTGGGCCCACCACNONE 
J075055N06TTTTGGGCCCACCACNONE 
J075141H03TTTTGGGCCCACCACNONE 
J075150M11TTTTGGGCCCACCACNONE 
J090005B16TTTTGGGCCCACCACNONE 
J090079L11TTTTGGGCCCACCACNONE 
J100039F16TTTTGGGCCCACCACNONE 
Os01g0323600J023095C13GGGTGGGCCCCACTCCNONE 
Os01g0327500AK107756TGTGGGGCCCACTConserved hypothetical protein. 
Os01g0331900013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE 
AK064784GTGTGGGGCCCACGTGGGTCCCANONE 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE 
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE 
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE 
Os01g0332100AK120720CAGGTGGGCCCAGCSimilar to Neutral invertase-like protein (Fragment). 
AY187621CAGGTGGGCCCAGCNONE 
J080021I24CAGGTGGGCCCAGCNONE 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0372100J075029A10CCTGGGCCCACAConserved hypothetical protein. 
Os01g0391100012-001-B05CCTGGGCCCACTTGNONE 
012-053-F01CCTGGGCCCACTTGNONE 
AK063499CCTGGGCCCACTTGNONE 
J065021A04CCTGGGCCCACTTGNONE 
J065076H06CCTGGGCCCACTTGNONE 
J065181E05CCTGGGCCCACTTGNONE 
J065187A05CCTGGGCCCACTTGNONE 
J075036C17CCTGGGCCCACTTGNONE 
J075051C18CCTGGGCCCACTTGNONE 
J075063L16CCTGGGCCCACTTGNONE 
J075079M08CCTGGGCCCACTTGNONE 
J075112H15CCTGGGCCCACTTGNONE 
J075135F10CCTGGGCCCACTTGNONE 
J075164H06CCTGGGCCCACTTGNONE 
J075195N02CCTGGGCCCACTTGNONE 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
AK069619GGGGCCCACCCGProtein of unknown function DUF789 family protein. 
Os01g0534800AK072168CTGACAGGTGGGCCCTSimilar to PRLI-interacting factor K (Fragment). 
AK104278CTGACAGGTGGGCCCTNONE 
Os01g0541900AK069784GGGTGGGCCCCACACGProtein kinase-like domain containing protein. 
J013033M01GGGTGGGCCCCACACGNONE 
J013159H24GGGTGGGCCCCACACGNONE 
J023008E13GGGTGGGCCCCACACGNONE 
J023030I11GGGTGGGCCCCACACGNONE 
J065137G08GGGTGGGCCCCACACGNONE 
J065139H16GGGTGGGCCCCACACGNONE 
J065154K13GGGTGGGCCCCACACGNONE 
J075176C02GGGTGGGCCCCACACGNONE 
Os01g0558600006-120-G12GGGTGGGCCCCACGNONE 
J013100N20GGGTGGGCCCCACGNONE 
J033043P09GGGTGGGCCCCACGNONE 
J033125M18GGGTGGGCCCCACGNONE 
J053043N11GGGTGGGCCCCACGNONE 
J065008E07GGGTGGGCCCCACGNONE 
J065080O16GGGTGGGCCCCACGNONE 
J075002G24GGGTGGGCCCCACGNONE 
J075123C09GGGTGGGCCCCACGNONE 
S66160GGGTGGGCCCCACGRas-related protein RIC1. 
Os01g0560200AK102003GGGTGGGCCCACCSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06GGGTGGGCCCACCNONE 
J065092F14GGGTGGGCCCACCNONE 
J065106D04GGGTGGGCCCACCNONE 
J065194K23GGGTGGGCCCACCNONE 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0587000AK067605GGGGCCCACTSimilar to Vacuolar ATP synthase subunit d (EC 3.6.3.14) (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
Os01g0595900AK100625AATTGGGCCCACACyclin-like F-box domain containing protein. 
Os01g0596300016-083-D09AGTGGGCCCAGTNONE 
AK069151AGTGGGCCCAGTCyclin-like F-box domain containing protein. 
J023007D17AGTGGGCCCAGTNONE 
J065141M02AGTGGGCCCAGTNONE 
Os01g0618200AK102319CACTGACAAATGGGCCCACAProtein phosphatase 2C family protein. 
AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein. 
Os01g0626100AK066892TAATGGGCCCACTTGAdaptin, N-terminal domain containing protein. 
J013050G23TAATGGGCCCACTTGNONE 
J013060F03TAATGGGCCCACTTGNONE 
J013088A19TAATGGGCCCACTTGNONE 
J013105M18TAATGGGCCCACTTGNONE 
J013108D15TAATGGGCCCACTTGNONE 
J013118M09TAATGGGCCCACTTGNONE 
J023009J17TAATGGGCCCACTTGNONE 
J023078I22TAATGGGCCCACTTGNONE 
J023103F15TAATGGGCCCACTTGNONE 
J023105B22TAATGGGCCCACTTGNONE 
J033024C18TAATGGGCCCACTTGNONE 
J033032N02TAATGGGCCCACTTGNONE 
J033041E20TAATGGGCCCACTTGNONE 
J033068L19TAATGGGCCCACTTGNONE 
J033076E16TAATGGGCCCACTTGNONE 
J033084J03TAATGGGCCCACTTGNONE 
J033090A13TAATGGGCCCACTTGNONE 
J033106C19TAATGGGCCCACTTGNONE 
J033116N13TAATGGGCCCACTTGNONE 
J033127C24TAATGGGCCCACTTGNONE 
J033129M02TAATGGGCCCACTTGNONE 
J033145J02TAATGGGCCCACTTGNONE 
J043005F08TAATGGGCCCACTTGNONE 
J043007L22TAATGGGCCCACTTGNONE 
J043031E03TAATGGGCCCACTTGNONE 
J043035J19TAATGGGCCCACTTGNONE 
J053027K20TAATGGGCCCACTTGNONE 
J065058I24TAATGGGCCCACTTGNONE 
J065078A06TAATGGGCCCACTTGNONE 
J065085E09TAATGGGCCCACTTGNONE 
J065093L04TAATGGGCCCACTTGNONE 
J065099H07TAATGGGCCCACTTGNONE 
J065102D09TAATGGGCCCACTTGNONE 
J065136J19TAATGGGCCCACTTGNONE 
J065182P21TAATGGGCCCACTTGNONE 
J065200F03TAATGGGCCCACTTGNONE 
J090004E22TAATGGGCCCACTTGNONE 
J090013K22TAATGGGCCCACTTGNONE 
J090019A03TAATGGGCCCACTTGNONE 
J090057B09TAATGGGCCCACTTGNONE 
J090066F19TAATGGGCCCACTTGNONE 
J090071M22TAATGGGCCCACTTGNONE 
J090075E16TAATGGGCCCACTTGNONE 
J090086D23TAATGGGCCCACTTGNONE 
Os01g0654500013-057-E05CAAGTGGGCCCCACGNONE 
AF155333CAAGTGGGCCCCACGNONE 
AK061752CAAGTGGGCCCCACGSimilar to NADP-isocitrate dehydrogenase. 
D21069CAAGTGGGCCCCACGNONE 
Os01g0666500AK102689GGCCGGGCCCACTConserved hypothetical protein. 
Os01g0688200AK120982GCGGGCCCACAAlpha/beta hydrolase family protein. 
Os01g0691500AK073675AGTGGGCCCAGGNONE 
AK107426AGTGGGCCCAGGCytidylyltransferase domain containing protein. 
J013055P17AGTGGGCCCAGGNONE 
J033050M21AGTGGGCCCAGGNONE 
Os01g0691600AK103297CCTGGGCCCACTSimilar to DNA repair helicase XPB2 (EC 3.6.1.-) (XPB homolog 2) (ERCC3 homolog 2) (RAD25 homolog 2) (AtXPB2). 
Os01g0694800015-093-H11GTGGGACCCACGTGGGCCCCACANONE 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os01g0706000006-098-D12TGTGGGCCCCACANONE 
AK059936TGTGGGCCCCACASimilar to RNA polymerase II transcriptional coactivator KELP. 
AK070545TGTGGGCCCCACANONE 
AK104192TGTGGGCCCCACANONE 
J023055M24TGTGGGCCCCACANONE 
J033102J04TGTGGGCCCCACANONE 
J065050P18TGTGGGCCCCACANONE 
J065076D07TGTGGGCCCCACANONE 
J065078O14TGTGGGCCCCACANONE 
J065104L13TGTGGGCCCCACANONE 
J065115J23TGTGGGCCCCACANONE 
J065143P08TGTGGGCCCCACANONE 
J065178N17TGTGGGCCCCACANONE 
J065179H14TGTGGGCCCCACANONE 
J065187J06TGTGGGCCCCACANONE 
J075047B18TGTGGGCCCCACANONE 
Os01g0707300AK059962TGCGGGCCCACCTNONE 
AK104463TGCGGGCCCACCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0716200AK062106TGTGGGCCCCCGCGIQ calmodulin-binding region domain containing protein. 
AK098920TGTGGGCCCCCGCGNONE 
J013002N06TGTGGGCCCCCGCGNONE 
J013050O19TGTGGGCCCCCGCGNONE 
J013074N19TGTGGGCCCCCGCGNONE 
J013127F17TGTGGGCCCCCGCGNONE 
J013155C17TGTGGGCCCCCGCGNONE 
J013158K07TGTGGGCCCCCGCGNONE 
J053086D01TGTGGGCCCCCGCGNONE 
Os01g0720700J033124M22TCCGGGCCCACGCNONE 
J065006G21TCCGGGCCCACGCNONE 
J065025M24TCCGGGCCCACGCNONE 
J065041J02TCCGGGCCCACGCNONE 
J065044B14TCCGGGCCCACGCNONE 
J065061J06TCCGGGCCCACGCNONE 
J065116L21TCCGGGCCCACGCNONE 
J075030F18TCCGGGCCCACGCNONE 
J075034K17TCCGGGCCCACGCNONE 
J075063I02TCCGGGCCCACGCNONE 
J075110D21TCCGGGCCCACGCSimilar to Serine acetyltransferase. 
J075188L15TCCGGGCCCACGCNONE 
J075197B17TCCGGGCCCACGCNONE 
Os01g0723000AK073592TTGTGGGCCCGSimilar to Elongation factor EF-2 (Fragment). 
AK102586TTGTGGGCCCGNONE 
J033048F11TTGTGGGCCCGNONE 
J033098E24TTGTGGGCCCGNONE 
Os01g0727400AK065692AGGGCCCACGGGConserved hypothetical protein. 
AK065692TGTGGGCCCATATConserved hypothetical protein. 
Os01g0730300AK101207CAGGTGGGCCCACGGHAD-superfamily hydrolase subfamily IIB protein. 
AK109542CAGGTGGGCCCACGGNONE 
Os01g0736900AK062151TGTGGGCCCTNONE 
AK065226TGTGGGCCCTNONE 
AK121245TGTGGGCCCTReticulon family protein. 
J013070F01TGTGGGCCCTNONE 
J013156J22TGTGGGCCCTNONE 
J023067B03TGTGGGCCCTNONE 
J023082O14TGTGGGCCCTNONE 
J023087F01TGTGGGCCCTNONE 
J023099G09TGTGGGCCCTNONE 
J023147M08TGTGGGCCCTNONE 
J033028C13TGTGGGCCCTNONE 
J033060K07TGTGGGCCCTNONE 
J033140C08TGTGGGCCCTNONE 
J033142C08TGTGGGCCCTNONE 
J043005M06TGTGGGCCCTNONE 
J043010C19TGTGGGCCCTNONE 
J043030H20TGTGGGCCCTNONE 
J065006K03TGTGGGCCCTNONE 
J065056E13TGTGGGCCCTNONE 
J065067O06TGTGGGCCCTNONE 
J065117P05TGTGGGCCCTNONE 
J065169I07TGTGGGCCCTNONE 
J080304L01TGTGGGCCCTNONE 
J080319G10TGTGGGCCCTNONE 
J090002N09TGTGGGCCCTNONE 
J090008E16TGTGGGCCCTNONE 
J090010L14TGTGGGCCCTNONE 
J090033C23TGTGGGCCCTNONE 
J090038D19TGTGGGCCCTNONE 
J090051E24TGTGGGCCCTNONE 
J090051H09TGTGGGCCCTNONE 
J090058A20TGTGGGCCCTNONE 
J090058B16TGTGGGCCCTNONE 
J090081I15TGTGGGCCCTNONE 
J090083P18TGTGGGCCCTNONE 
J090089J07TGTGGGCCCTNONE 
J090096D13TGTGGGCCCTNONE 
J100036N19TGTGGGCCCTNONE 
J100043M11TGTGGGCCCTNONE 
J100046C12TGTGGGCCCTNONE 
J100072C01TGTGGGCCCTNONE 
J100088P11TGTGGGCCCTNONE 
Os01g0737900012-087-D12TTGTGGGCCCCNONE 
AK072600TTGTGGGCCCCProtein prenyltransferase domain containing protein. 
J023006E12TTGTGGGCCCCNONE 
J023130A18TTGTGGGCCCCNONE 
J023134O05TTGTGGGCCCCNONE 
Os01g0745400AK107872TGTGGGCCCACASec34-like protein family protein. 
Os01g0749400AK064990ACGTGGGCCCCNONE 
AK067731ACGTGGGCCCCHAD-superfamily hydrolase subfamily IIB protein. 
AK103775ACGTGGGCCCCNONE 
J023001B06ACGTGGGCCCCNONE 
Os01g0764300J090053G03TTATGGGCCCACCCACCACProtein of unknown function DUF155 family protein. 
Os01g0764800AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein. 
Os01g0766400AK073493GTGGTGGGCCCCConserved hypothetical protein. 
Os01g0767100AK109493GGGGCCCACCTSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0767600AK070672GGGGCCCACGGGConserved hypothetical protein. 
AK070672GGTGGGGCCCACGGConserved hypothetical protein. 
J013131M12GGGGCCCACGGGNONE 
J013131M12GGTGGGGCCCACGGNONE 
J023027B15GGGGCCCACGGGNONE 
J023027B15GGTGGGGCCCACGGNONE 
J023059I06GGGGCCCACGGGNONE 
J023059I06GGTGGGGCCCACGGNONE 
J023095L05GGGGCCCACGGGNONE 
J023095L05GGTGGGGCCCACGGNONE 
J033033E20GGGGCCCACGGGNONE 
J033033E20GGTGGGGCCCACGGNONE 
J033105F24GGGGCCCACGGGNONE 
J033105F24GGTGGGGCCCACGGNONE 
J033148N05GGGGCCCACGGGNONE 
J033148N05GGTGGGGCCCACGGNONE 
J065060H14GGGGCCCACGGGNONE 
J065060H14GGTGGGGCCCACGGNONE 
J090093E17GGGGCCCACGGGNONE 
J090093E17GGTGGGGCCCACGGNONE 
Os01g0778700AK064933GCGGGCCCACCTGConserved hypothetical protein. 
AK064933GGTGGGGCCCACCAConserved hypothetical protein. 
Os01g0805800006-057-H04GGGGCCCACGCGTCATCCACCNONE 
006-106-H01GGGGCCCACGCGTCATCCACCNONE 
AK059963GGGGCCCACGCGTCATCCACCNONE 
AK103408GGGGCCCACGCGTCATCCACCRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0812200003-009-E06GGTGGGGCCCACCTNONE 
AK072651GGTGGGGCCCACCTCyclin-like F-box domain containing protein. 
AK104334GGTGGGGCCCACCTNONE 
J013030E13GGTGGGGCCCACCTNONE 
J013169M21GGTGGGGCCCACCTNONE 
J023012J16GGTGGGGCCCACCTNONE 
J023103F22GGTGGGGCCCACCTNONE 
J023123A01GGTGGGGCCCACCTNONE 
J023131F07GGTGGGGCCCACCTNONE 
J023146I01GGTGGGGCCCACCTNONE 
J033040K02GGTGGGGCCCACCTNONE 
J033079F06GGTGGGGCCCACCTNONE 
J033105G06GGTGGGGCCCACCTNONE 
J033117E08GGTGGGGCCCACCTNONE 
J043030C01GGTGGGGCCCACCTNONE 
J053043H16GGTGGGGCCCACCTNONE 
J053061H01GGTGGGGCCCACCTNONE 
J065044A03GGTGGGGCCCACCTNONE 
J065068E12GGTGGGGCCCACCTNONE 
J065069D09GGTGGGGCCCACCTNONE 
J065143M19GGTGGGGCCCACCTNONE 
J065193C10GGTGGGGCCCACCTNONE 
J065209D07GGTGGGGCCCACCTNONE 
J090083C17GGTGGGGCCCACCTNONE 
J090086G06GGTGGGGCCCACCTNONE 
J090093I09GGTGGGGCCCACCTNONE 
J100023G21GGTGGGGCCCACCTNONE 
J100025D15GGTGGGGCCCACCTNONE 
J100034B13GGTGGGGCCCACCTNONE 
J100040F10GGTGGGGCCCACCTNONE 
J100051E15GGTGGGGCCCACCTNONE 
J100056L08GGTGGGGCCCACCTNONE 
J100057H04GGTGGGGCCCACCTNONE 
J100085K20GGTGGGGCCCACCTNONE 
J100088G21GGTGGGGCCCACCTNONE 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0818600AK066550TGTGGGCCCGGTLeucine rich repeat, N-terminal domain containing protein. 
Os01g0823500016-059-D03GTGGGGGCCCACGCNONE 
AK064237GTGGGGGCCCACGCProtein of unknown function DUF623, plant domain containing protein. 
Os01g0830500006-117-F06AGATGGGCCCACACTGACAGNONE 
AK061475AGATGGGCCCACACTGACAGNONE 
AK105801AGATGGGCCCACACTGACAG2OG-Fe(II) oxygenase domain containing protein. 
J065168H17AGATGGGCCCACACTGACAGNONE 
J065211O10AGATGGGCCCACACTGACAGNONE 
Os01g0832200004-009-E08GGTGGGCCCATCANONE 
009-103-F06GGTGGGCCCATCANONE 
AK060017GGTGGGCCCATCANONE 
AK068980GGTGGGCCCATCAConserved hypothetical protein. 
J023085I24GGTGGGCCCATCANONE 
J090016I03GGTGGGCCCATCANONE 
J090078K06GGTGGGCCCATCANONE 
Os01g0834200AK069188CATGGGCCCACANONE 
AK100543CATGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os01g0835500AK100241GCGGGCCCACTSimilar to Respiratory burst oxidase protein. 
Os01g0836400AK068741TTGTGGGCCCAAACNONE 
AK073540ACGTGGGCCCCASAC3/GANP family protein. 
AK073540TTGTGGGCCCAAACSAC3/GANP family protein. 
J023019D11ACGTGGGCCCCANONE 
J023019D11TTGTGGGCCCAAACNONE 
J023139O22ACGTGGGCCCCANONE 
J023139O22TTGTGGGCCCAAACNONE 
J033042J20ACGTGGGCCCCANONE 
J033042J20TTGTGGGCCCAAACNONE 
J033046M18ACGTGGGCCCCANONE 
J033046M18TTGTGGGCCCAAACNONE 
J033124J09ACGTGGGCCCCANONE 
J033124J09TTGTGGGCCCAAACNONE 
J090015E05ACGTGGGCCCCANONE 
J090015E05TTGTGGGCCCAAACNONE 
J090076J09ACGTGGGCCCCANONE 
J090076J09TTGTGGGCCCAAACNONE 
Os01g0837600AK108007CGGGTGGGCCCGGCConserved hypothetical protein 1589, plant family protein. 
J065005C19CGGGTGGGCCCGGCNONE 
J065025H20CGGGTGGGCCCGGCNONE 
J065061E22CGGGTGGGCCCGGCNONE 
J065065F14CGGGTGGGCCCGGCNONE 
J065083O21CGGGTGGGCCCGGCNONE 
J065201G05CGGGTGGGCCCGGCNONE 
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
Os01g0846300AK065949CGGGTGGGCCCCSimilar to Protein phosphatase 2C. 
Os01g0860700009-026-D05GGTGGGGCCCACANONE 
AK062402GGTGGGGCCCACAConserved hypothetical protein. 
Os01g0865100016-066-A05AGTGGGCCCCACCNONE 
AK065779AGTGGGCCCCACCNONE 
AK071410AGTGGGCCCCACCSimilar to Uricase (Fragment). 
J013039E23AGTGGGCCCCACCNONE 
J023024I07AGTGGGCCCCACCNONE 
J065160J15AGTGGGCCCCACCNONE 
J090052J17AGTGGGCCCCACCNONE 
Os01g0866300006-029-F08GGCCGGGCCCACTNONE 
006-074-E10GGCCGGGCCCACTNONE 
006-079-E11GGCCGGGCCCACTNONE 
009-048-A05GGCCGGGCCCACTNONE 
AK059875GGCCGGGCCCACTNONE 
J043005O17GGCCGGGCCCACTNONE 
Os01g0869000AK067351CGGGTGGGGCCCACCGCCCACGCCCAAACNONE 
AK121602CGGGTGGGGCCCACCGCCCACGCCCAAACProtein of unknown function DUF639 family protein. 
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein. 
AK070678TTTGGGCTGGGGCCCACATGTCAGTGNONE 
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
AK072312GTTGGGCCCACCTGGGCCTGGNONE 
AK103428GTTGGGCCCACCTGGGCCTGGNONE 
Os01g0874700011-001-F02ACGTGGGCCCCACCNONE 
012-048-H01ACGTGGGCCCCACCNONE 
012-094-B02ACGTGGGCCCCACCNONE 
AK073077ACGTGGGCCCCACCNONE 
AK105447ACGTGGGCCCCACCNONE 
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein. 
J100026G07ACGTGGGCCCCACCNONE 
J100030F07ACGTGGGCCCCACCNONE 
J100066J18ACGTGGGCCCCACCNONE 
J100077G12ACGTGGGCCCCACCNONE 
J100081K23ACGTGGGCCCCACCNONE 
Os01g0876500J053026A07GGGGCCCACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17GGGGCCCACACNONE 
Os01g0877500AK101067GGTGGGCCCGGAProtein of unknown function UPF0054 family protein. 
Os01g0881800AK109594CCACTGACATGTGGGCCCCACAConserved hypothetical protein. 
J065066N18CCACTGACATGTGGGCCCCACANONE 
Os01g0905400012-077-F08CGGGCCCACCTGTCAGTGNONE 
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein. 
Os01g0908100AK072293AGTGGGCCCTRabGAP/TBC domain containing protein. 
J065010B13AGTGGGCCCTNONE 
J065010M12AGTGGGCCCTNONE 
J065047C19AGTGGGCCCTNONE 
J065069B18AGTGGGCCCTNONE 
J065071K24AGTGGGCCCTNONE 
J065142P04AGTGGGCCCTNONE 
J065170E11AGTGGGCCCTNONE 
Os01g0911700012-079-H01AGTGGGCCCAGANONE 
012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-088-G05AGTGGGCCCAGANONE 
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-099-A01AGTGGGCCCAGANONE 
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-009-H07AGTGGGCCCAGANONE 
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-035-H12AGTGGGCCCAGANONE 
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
016-054-G03AGTGGGCCCAGANONE 
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
AK073805AGTGGGCCCAGASimilar to Regulatory protein viviparous-1. 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
AK105441AGTGGGCCCAGANONE 
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033069I02AGTGGGCCCAGANONE 
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033086K01AGTGGGCCCAGANONE 
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
Os01g0913800011-060-B02AACTGGGCCCACCANONE 
016-088-H02AACTGGGCCCACCAProtein prenyltransferase domain containing protein. 
Os01g0918200009-034-H02GCGGGCCCACTNONE 
009-034-H02GGGGCCCACGTNONE 
AK062434GCGGGCCCACTSimilar to Ubiquitin-like protein SMT3. 
AK062434GGGGCCCACGTSimilar to Ubiquitin-like protein SMT3. 
AK103092GCGGGCCCACTNONE 
AK103092GGGGCCCACGTNONE 
J065093P18GCGGGCCCACTNONE 
J065093P18GGGGCCCACGTNONE 
J065137C15GCGGGCCCACTNONE 
J065137C15GGGGCCCACGTNONE 
J065156G01GCGGGCCCACTNONE 
J065156G01GGGGCCCACGTNONE 
J065206H16GCGGGCCCACTNONE 
J065206H16GGGGCCCACGTNONE 
J065209D03GCGGGCCCACTNONE 
J065209D03GGGGCCCACGTNONE 
J075073K05GCGGGCCCACTNONE 
J075073K05GGGGCCCACGTNONE 
J075099B17GCGGGCCCACTNONE 
J075099B17GGGGCCCACGTNONE 
J075166N04GCGGGCCCACTNONE 
J075166N04GGGGCCCACGTNONE 
Os01g0918300009-036-G04GGGGCCCACACNONE 
009-128-H04GGGGCCCACACNONE 
009-189-D06GGGGCCCACACNONE 
AB016030GGGGCCCACACNONE 
AK058869GGGGCCCACACUbiquitin-like protein SMT3. 
AK069668GGGGCCCACACNONE 
J023026B05GGGGCCCACACNONE 
J053042E12GGGGCCCACACNONE 
J053045P19GGGGCCCACACNONE 
J053078C24GGGGCCCACACNONE 
J065038J05GGGGCCCACACNONE 
J065170B12GGGGCCCACACNONE 
J065174C07GGGGCCCACACNONE 
J075002G06GGGGCCCACACNONE 
J075024O07GGGGCCCACACNONE 
J075068H04GGGGCCCACACNONE 
J075071H14GGGGCCCACACNONE 
J075095G03GGGGCCCACACNONE 
J075117O08GGGGCCCACACNONE 
J075118J23GGGGCCCACACNONE 
J075124P18GGGGCCCACACNONE 
J100057D06GGGGCCCACACNONE 
J100063L03GGGGCCCACACNONE 
X99608GGGGCCCACACNONE 
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CCCGGGCCCACGTGTCNONE 
J013109E03CCCGGGCCCACGTGTCNONE 
J023081J12CCCGGGCCCACGTGTCNONE 
J023091E24CCCGGGCCCACGTGTCNONE 
J033022A01CCCGGGCCCACGTGTCNONE 
J033074C13CCCGGGCCCACGTGTCNONE 
J065199E03CCCGGGCCCACGTGTCNONE 
J075172O04CCCGGGCCCACGTGTCNONE 
J090007G18CCCGGGCCCACGTGTCNONE 
J090052B17CCCGGGCCCACGTGTCNONE 
J090074H01CCCGGGCCCACGTGTCNONE 
J100043J09CCCGGGCCCACGTGTCNONE 
J100059J05CCCGGGCCCACGTGTCNONE 
Os01g0923300AK067520GGGGCCCACCCBS domain containing protein. 
Os01g0924000004-020-C09CGGGCCCACAANONE 
005-014-A06CGGGCCCACAANONE 
009-085-G12CGGGCCCACAANONE 
009-123-A08CGGGCCCACAANONE 
009-134-A05CGGGCCCACAANONE 
009-137-F06CGGGCCCACAANONE 
016-016-B08CGGGCCCACAANONE 
AF050674CGGGCCCACAANONE 
AK061690CGGGCCCACAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797CGGGCCCACAANONE 
J013040A15CGGGCCCACAANONE 
J013104L20CGGGCCCACAANONE 
J013127E12CGGGCCCACAANONE 
J013158O05CGGGCCCACAANONE 
J023012E09CGGGCCCACAANONE 
J023126L23CGGGCCCACAANONE 
J023143B03CGGGCCCACAANONE 
J065005B16CGGGCCCACAANONE 
J065101J15CGGGCCCACAANONE 
J065105K16CGGGCCCACAANONE 
J065155K16CGGGCCCACAANONE 
J065171M17CGGGCCCACAANONE 
J065182F07CGGGCCCACAANONE 
J065187D10CGGGCCCACAANONE 
J065194I24CGGGCCCACAANONE 
J065207E24CGGGCCCACAANONE 
J075001C24CGGGCCCACAANONE 
J075090O10CGGGCCCACAANONE 
J075095H17CGGGCCCACAANONE 
J075109M24CGGGCCCACAANONE 
J075123C18CGGGCCCACAANONE 
J075148G22CGGGCCCACAANONE 
J090009B09CGGGCCCACAANONE 
J090075K17CGGGCCCACAANONE 
J090081H23CGGGCCCACAANONE 
J090097H21CGGGCCCACAANONE 
J100063P14CGGGCCCACAANONE 
Os01g0931300012-055-E05AGTGGGCCCGNONE 
AK068196AGTGGGCCCGTafazzin family protein. 
AK099213AGTGGGCCCGNONE 
Os01g0952600AK067525ACCGGGCCCACCCNONE 
AK070047ACCGGGCCCACCCSimilar to LacZ (Fragment). 
Os01g0966400AK103064AGTGGGCCCCACALeucine-rich repeat, SDS22 containing protein. 
J023043O12AGTGGGCCCCACANONE 
J053084D04AGTGGGCCCCACANONE 
J090021L08AGTGGGCCCCACANONE 
Os02g0105500AK063929TGTGGGCCCTNONE 
AK102953TGTGGGCCCTIQ calmodulin-binding region domain containing protein. 
Os02g0115700AK065094CCCGGGCCCACCACatalase isozyme A (EC 1.11.1.6) (CAT-A). 
AK065094GGGGCCCACATCCACCCatalase isozyme A (EC 1.11.1.6) (CAT-A). 
AK099231CCCGGGCCCACCANONE 
AK099231GGGGCCCACATCCACCNONE 
AK099923CCCGGGCCCACCANONE 
AK099923GGGGCCCACATCCACCNONE 
X61626CCCGGGCCCACCANONE 
X61626GGGGCCCACATCCACCNONE 
Os02g0121100012-035-F06CGGGCCCACGCGTNONE 
013-031-H05CGGGCCCACGCGTNONE 
013-058-E11CGGGCCCACGCGTNONE 
014-010-D01CGGGCCCACGCGTNONE 
AK070711CGGGCCCACGCGTConserved hypothetical protein. 
AK119758CGGGCCCACGCGTNONE 
J013033G12CGGGCCCACGCGTNONE 
J023007M16CGGGCCCACGCGTNONE 
J023020K20CGGGCCCACGCGTNONE 
J023061H10CGGGCCCACGCGTNONE 
J033027H20CGGGCCCACGCGTNONE 
J033051E18CGGGCCCACGCGTNONE 
J090005F12CGGGCCCACGCGTNONE 
J090017A20CGGGCCCACGCGTNONE 
J090018G11CGGGCCCACGCGTNONE 
J090062C18CGGGCCCACGCGTNONE 
J100027N10CGGGCCCACGCGTNONE 
J100032L14CGGGCCCACGCGTNONE 
J100045C14CGGGCCCACGCGTNONE 
J100061M09CGGGCCCACGCGTNONE 
J100062K11CGGGCCCACGCGTNONE 
J100064H11CGGGCCCACGCGTNONE 
J100074H16CGGGCCCACGCGTNONE 
J100082N01CGGGCCCACGCGTNONE 
Os02g0122800AK062255CAGGTGGGCCCACANONE 
AK121372CAGGTGGGCCCACANucleotide-binding, alpha-beta plait domain containing protein. 
J013056N24CAGGTGGGCCCACANONE 
J023037M12CAGGTGGGCCCACANONE 
J023099B21CAGGTGGGCCCACANONE 
J023126J16CAGGTGGGCCCACANONE 
J033031J05CAGGTGGGCCCACANONE 
J033048L07CAGGTGGGCCCACANONE 
J033052J23CAGGTGGGCCCACANONE 
J033076F24CAGGTGGGCCCACANONE 
J033085F01CAGGTGGGCCCACANONE 
J033101I11CAGGTGGGCCCACANONE 
J033128E01CAGGTGGGCCCACANONE 
J100070N12CAGGTGGGCCCACANONE 
Os02g0123200016-017-F04AGGTGGGCCCCACCTGNONE 
J033057C03AGGTGGGCCCCACCTGNONE 
J033087C11AGGTGGGCCCCACCTGNONE 
J033108J20AGGTGGGCCCCACCTGNONE 
J043015P08AGGTGGGCCCCACCTGNONE 
Os02g0125300006-047-E06CTCGCGCGTGCGTGGGCCCCACCNONE 
006-088-F09CTCGCGCGTGCGTGGGCCCCACCNONE 
006-106-F10CTCGCGCGTGCGTGGGCCCCACCNONE 
AB025926CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061564CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061953CTCGCGCGTGCGTGGGCCCCACCNONE 
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21CTCGCGCGTGCGTGGGCCCCACCNONE 
J023097A08CTCGCGCGTGCGTGGGCCCCACCNONE 
J023133F03CTCGCGCGTGCGTGGGCCCCACCNONE 
J033022C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033073C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033116O09CTCGCGCGTGCGTGGGCCCCACCNONE 
J033120E01CTCGCGCGTGCGTGGGCCCCACCNONE 
J065088M19CTCGCGCGTGCGTGGGCCCCACCNONE 
J065135O04CTCGCGCGTGCGTGGGCCCCACCNONE 
J080304J03CTCGCGCGTGCGTGGGCCCCACCNONE 
J090001K14CTCGCGCGTGCGTGGGCCCCACCNONE 
J090038D04CTCGCGCGTGCGTGGGCCCCACCNONE 
J090045G09CTCGCGCGTGCGTGGGCCCCACCNONE 
J090076E12CTCGCGCGTGCGTGGGCCCCACCNONE 
J090077D21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100018J19CTCGCGCGTGCGTGGGCCCCACCNONE 
J100029M12CTCGCGCGTGCGTGGGCCCCACCNONE 
J100049D07CTCGCGCGTGCGTGGGCCCCACCNONE 
J100067G21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100090D05CTCGCGCGTGCGTGGGCCCCACCNONE 
Os02g0129700AK065610GTGGGGGCCCACCTHypothetical protein. 
J013031M24GTGGGGGCCCACCTNONE 
J075043J08GTGGGGGCCCACCTNONE 
J075142N23GTGGGGGCCCACCTNONE 
Os02g0130300011-005-D07CATGGGCCCACCTNONE 
011-041-B06CATGGGCCCACCTNONE 
015-099-D11CATGGGCCCACCTNONE 
016-049-D06CATGGGCCCACCTNONE 
AK102708CATGGGCCCACCTZinc finger, RING-type domain containing protein. 
Os02g0133800006-092-D12CGTGTGGGCCCCNONE 
006-111-G01CGTGTGGGCCCCNONE 
AK103646CGTGTGGGCCCCNONE 
AK109376CGTGTGGGCCCCProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CGTGTGGGCCCCNONE 
J033135B19CGTGTGGGCCCCNONE 
J065200F01CGTGTGGGCCCCNONE 
J065213J11CGTGTGGGCCCCNONE 
J075031N16CGTGTGGGCCCCNONE 
J075032N17CGTGTGGGCCCCNONE 
J075047P04CGTGTGGGCCCCNONE 
J075063D01CGTGTGGGCCCCNONE 
J075105F23CGTGTGGGCCCCNONE 
J075121E16CGTGTGGGCCCCNONE 
J075176F10CGTGTGGGCCCCNONE 
J075182M16CGTGTGGGCCCCNONE 
J075190E09CGTGTGGGCCCCNONE 
J075191B14CGTGTGGGCCCCNONE 
J100055J24CGTGTGGGCCCCNONE 
J100066H24CGTGTGGGCCCCNONE 
J100073N01CGTGTGGGCCCCNONE 
Os02g0135700AK100570GGTGGGCCCCAGDNA polymerase V family protein. 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
Os02g0148400AK070451GGCCGTGGGGGCCCACTNONE 
AK072039GGCCGTGGGGGCCCACTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10GGCCGTGGGGGCCCACTNONE 
Os02g0169300006-023-D12CCGTGGGCCCACCACNONE 
006-062-B01CCGTGGGCCCACCACNONE 
015-049-F11CCGTGGGCCCACCACNONE 
015-057-G02CCGTGGGCCCACCACNONE 
015-092-F04CCGTGGGCCCACCACNONE 
015-095-H02CCGTGGGCCCACCACNONE 
015-097-B07CCGTGGGCCCACCACNONE 
AK070041CCGTGGGCCCACCACSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07CCGTGGGCCCACCACNONE 
J013134H23CCGTGGGCCCACCACNONE 
J013134J23CCGTGGGCCCACCACNONE 
J023036N24CCGTGGGCCCACCACNONE 
J023049C06CCGTGGGCCCACCACNONE 
J023077E10CCGTGGGCCCACCACNONE 
J023077F10CCGTGGGCCCACCACNONE 
J023105N12CCGTGGGCCCACCACNONE 
J033036O12CCGTGGGCCCACCACNONE 
J033064P11CCGTGGGCCCACCACNONE 
J033079F01CCGTGGGCCCACCACNONE 
J033123M22CCGTGGGCCCACCACNONE 
J033143E10CCGTGGGCCCACCACNONE 
J075013D12CCGTGGGCCCACCACNONE 
Os02g0177700AK119941CAAGTGGGCCCCACCProtein of unknown function DUF588 family protein. 
Os02g0178400009-151-B08AACTGGGCCCACTNONE 
AK063815AACTGGGCCCACTProtein transport protein SEC61 gamma subunit. 
AK121516AACTGGGCCCACTNONE 
J033026A17AACTGGGCCCACTNONE 
J065011K14AACTGGGCCCACTNONE 
J065056D01AACTGGGCCCACTNONE 
J065061L22AACTGGGCCCACTNONE 
J065076M01AACTGGGCCCACTNONE 
J075092E14AACTGGGCCCACTNONE 
Os02g0197600003-113-H08CCCGGGCCCACCCNONE 
003-129-H06CCCGGGCCCACCCNONE 
006-021-H09CCCGGGCCCACCCNONE 
006-022-B05CCCGGGCCCACCCNONE 
006-022-G12CCCGGGCCCACCCNONE 
006-023-A02CCCGGGCCCACCCNONE 
006-023-C02CCCGGGCCCACCCNONE 
006-023-G09CCCGGGCCCACCCNONE 
006-024-D12CCCGGGCCCACCCNONE 
006-025-C09CCCGGGCCCACCCNONE 
006-025-E01CCCGGGCCCACCCNONE 
006-026-A11CCCGGGCCCACCCNONE 
006-026-A12CCCGGGCCCACCCNONE 
006-028-E11CCCGGGCCCACCCNONE 
006-028-G03CCCGGGCCCACCCNONE 
006-029-A09CCCGGGCCCACCCNONE 
006-029-A12CCCGGGCCCACCCNONE 
006-029-D01CCCGGGCCCACCCNONE 
006-029-F12CCCGGGCCCACCCNONE 
006-029-G12CCCGGGCCCACCCNONE 
006-030-A08CCCGGGCCCACCCNONE 
006-030-C09CCCGGGCCCACCCNONE 
006-030-G06CCCGGGCCCACCCNONE 
006-031-D06CCCGGGCCCACCCNONE 
006-032-C01CCCGGGCCCACCCNONE 
006-034-B07CCCGGGCCCACCCNONE 
006-035-G01CCCGGGCCCACCCNONE 
006-036-H12CCCGGGCCCACCCNONE 
006-040-C01CCCGGGCCCACCCNONE 
006-041-G12CCCGGGCCCACCCNONE 
006-041-H02CCCGGGCCCACCCNONE 
006-041-H11CCCGGGCCCACCCNONE 
006-042-B01CCCGGGCCCACCCNONE 
006-042-F10CCCGGGCCCACCCNONE 
006-043-C04CCCGGGCCCACCCNONE 
006-044-D10CCCGGGCCCACCCNONE 
006-048-D11CCCGGGCCCACCCNONE 
006-049-D07CCCGGGCCCACCCNONE 
006-050-H05CCCGGGCCCACCCNONE 
006-051-D10CCCGGGCCCACCCNONE 
006-051-E05CCCGGGCCCACCCNONE 
006-053-C07CCCGGGCCCACCCNONE 
006-054-B10CCCGGGCCCACCCNONE 
006-054-C12CCCGGGCCCACCCNONE 
006-054-G08CCCGGGCCCACCCNONE 
006-055-D12CCCGGGCCCACCCNONE 
006-056-C04CCCGGGCCCACCCNONE 
006-056-H06CCCGGGCCCACCCNONE 
006-057-E07CCCGGGCCCACCCNONE 
006-058-C12CCCGGGCCCACCCNONE 
006-059-B06CCCGGGCCCACCCNONE 
006-059-B09CCCGGGCCCACCCNONE 
006-059-D05CCCGGGCCCACCCNONE 
006-060-D07CCCGGGCCCACCCNONE 
006-061-D01CCCGGGCCCACCCNONE 
006-061-G09CCCGGGCCCACCCNONE 
006-062-A12CCCGGGCCCACCCNONE 
006-062-D04CCCGGGCCCACCCNONE 
006-062-G01CCCGGGCCCACCCNONE 
006-063-C10CCCGGGCCCACCCNONE 
006-064-A10CCCGGGCCCACCCNONE 
006-067-E04CCCGGGCCCACCCNONE 
006-067-H11CCCGGGCCCACCCNONE 
006-069-G08CCCGGGCCCACCCNONE 
006-071-G06CCCGGGCCCACCCNONE 
006-073-E06CCCGGGCCCACCCNONE 
006-074-B12CCCGGGCCCACCCNONE 
006-074-F06CCCGGGCCCACCCNONE 
006-074-H01CCCGGGCCCACCCNONE 
006-076-D12CCCGGGCCCACCCNONE 
006-077-C08CCCGGGCCCACCCNONE 
006-083-H01CCCGGGCCCACCCNONE 
006-083-H09CCCGGGCCCACCCNONE 
006-084-C02CCCGGGCCCACCCNONE 
006-086-D05CCCGGGCCCACCCNONE 
006-086-E09CCCGGGCCCACCCNONE 
006-087-D04CCCGGGCCCACCCNONE 
006-087-E12CCCGGGCCCACCCNONE 
006-088-A01CCCGGGCCCACCCNONE 
006-088-H09CCCGGGCCCACCCNONE 
006-089-G01CCCGGGCCCACCCNONE 
006-090-G01CCCGGGCCCACCCNONE 
006-092-H10CCCGGGCCCACCCNONE 
006-096-G12CCCGGGCCCACCCNONE 
006-097-C04CCCGGGCCCACCCNONE 
006-098-B06CCCGGGCCCACCCNONE 
006-099-A02CCCGGGCCCACCCNONE 
006-099-B05CCCGGGCCCACCCNONE 
006-100-F02CCCGGGCCCACCCNONE 
006-100-F07CCCGGGCCCACCCNONE 
006-104-A01CCCGGGCCCACCCNONE 
006-107-F06CCCGGGCCCACCCNONE 
006-109-A05CCCGGGCCCACCCNONE 
006-110-G03CCCGGGCCCACCCNONE 
006-111-A06CCCGGGCCCACCCNONE 
006-111-C12CCCGGGCCCACCCNONE 
006-112-B03CCCGGGCCCACCCNONE 
006-113-A02CCCGGGCCCACCCNONE 
006-113-H06CCCGGGCCCACCCNONE 
006-115-D11CCCGGGCCCACCCNONE 
006-116-F11CCCGGGCCCACCCNONE 
006-117-A10CCCGGGCCCACCCNONE 
006-117-C01CCCGGGCCCACCCNONE 
006-117-D08CCCGGGCCCACCCNONE 
006-118-B12CCCGGGCCCACCCNONE 
006-118-D08CCCGGGCCCACCCNONE 
006-118-E11CCCGGGCCCACCCNONE 
006-118-H08CCCGGGCCCACCCNONE 
006-119-C10CCCGGGCCCACCCNONE 
006-120-H11CCCGGGCCCACCCNONE 
009-025-G09CCCGGGCCCACCCNONE 
009-061-H06CCCGGGCCCACCCNONE 
009-070-E02CCCGGGCCCACCCNONE 
009-077-A07CCCGGGCCCACCCNONE 
009-114-A07CCCGGGCCCACCCNONE 
009-115-G02CCCGGGCCCACCCNONE 
009-123-C06CCCGGGCCCACCCNONE 
009-125-H03CCCGGGCCCACCCNONE 
009-127-H11CCCGGGCCCACCCNONE 
009-136-G03CCCGGGCCCACCCNONE 
009-154-B05CCCGGGCCCACCCNONE 
009-162-B02CCCGGGCCCACCCNONE 
009-176-D09CCCGGGCCCACCCNONE 
009-178-F10CCCGGGCCCACCCNONE 
009-190-F05CCCGGGCCCACCCNONE 
009-200-C08CCCGGGCCCACCCNONE 
011-064-H10CCCGGGCCCACCCNONE 
AK060143CCCGGGCCCACCCNONE 
AK060970CCCGGGCCCACCCNONE 
AK068102CCCGGGCCCACCCSimilar to PSI type III chlorophyll a/b-binding protein. 
AK104096CCCGGGCCCACCCNONE 
AK104215CCCGGGCCCACCCNONE 
AK104348CCCGGGCCCACCCNONE 
AK104385CCCGGGCCCACCCNONE 
AK104392CCCGGGCCCACCCNONE 
AK104446CCCGGGCCCACCCNONE 
AK104458CCCGGGCCCACCCNONE 
AK104469CCCGGGCCCACCCNONE 
AK104522CCCGGGCCCACCCNONE 
AK104535CCCGGGCCCACCCNONE 
AK104557CCCGGGCCCACCCNONE 
AK104636CCCGGGCCCACCCNONE 
AK104646CCCGGGCCCACCCNONE 
AK104734CCCGGGCCCACCCNONE 
AK106085CCCGGGCCCACCCNONE 
AK109398CCCGGGCCCACCCNONE 
AK119554CCCGGGCCCACCCNONE 
J013044I21CCCGGGCCCACCCNONE 
J013090N21CCCGGGCCCACCCNONE 
J013130I24CCCGGGCCCACCCNONE 
J023038D09CCCGGGCCCACCCNONE 
J023064C23CCCGGGCCCACCCNONE 
J023088A09CCCGGGCCCACCCNONE 
J023105K12CCCGGGCCCACCCNONE 
J065022M15CCCGGGCCCACCCNONE 
J075062L23CCCGGGCCCACCCNONE 
J075069B05CCCGGGCCCACCCNONE 
J075072D15CCCGGGCCCACCCNONE 
J075090E24CCCGGGCCCACCCNONE 
J075126D14CCCGGGCCCACCCNONE 
J075154L21CCCGGGCCCACCCNONE 
J075165F23CCCGGGCCCACCCNONE 
J075166D04CCCGGGCCCACCCNONE 
J080003O05CCCGGGCCCACCCNONE 
J080005L07CCCGGGCCCACCCNONE 
J080008K15CCCGGGCCCACCCNONE 
J080009A07CCCGGGCCCACCCNONE 
J080009F05CCCGGGCCCACCCNONE 
J080010M06CCCGGGCCCACCCNONE 
J080011E06CCCGGGCCCACCCNONE 
J080011H20CCCGGGCCCACCCNONE 
J080018I05CCCGGGCCCACCCNONE 
J080021N17CCCGGGCCCACCCNONE 
J080036E20CCCGGGCCCACCCNONE 
J080040E22CCCGGGCCCACCCNONE 
J080044D19CCCGGGCCCACCCNONE 
J080045C21CCCGGGCCCACCCNONE 
J080047B08CCCGGGCCCACCCNONE 
J080048E24CCCGGGCCCACCCNONE 
J080053D19CCCGGGCCCACCCNONE 
J080053N09CCCGGGCCCACCCNONE 
J080054A19CCCGGGCCCACCCNONE 
J080061O16CCCGGGCCCACCCNONE 
J080064P15CCCGGGCCCACCCNONE 
J080065M06CCCGGGCCCACCCNONE 
J080067G11CCCGGGCCCACCCNONE 
J080072M09CCCGGGCCCACCCNONE 
J080079I15CCCGGGCCCACCCNONE 
J080082I12CCCGGGCCCACCCNONE 
J080083K21CCCGGGCCCACCCNONE 
J080096H12CCCGGGCCCACCCNONE 
J080096J10CCCGGGCCCACCCNONE 
J080097O13CCCGGGCCCACCCNONE 
J080305P05CCCGGGCCCACCCNONE 
J080311C21CCCGGGCCCACCCNONE 
J080317C16CCCGGGCCCACCCNONE 
Os02g0208900003-126-D10TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK066171TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK070031TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK121183TGTGGGCCCCACACACCCCAGGCCCCACCAACSimilar to ZIGA2 protein (Fragment). 
J013031N09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J013045O19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023102A14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023145E14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033033E15TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033041H19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033050E09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065191H21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065193C21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J075068F07TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
Os02g0219900004-018-E11CCGTGGGCCCCACCCCCCACACNONE 
AK060915CCGTGGGCCCCACCCCCCACACNONE 
AK099194CCGTGGGCCCCACCCCCCACACNONE 
AK104206CCGTGGGCCCCACCCCCCACACNONE 
AK104393CCGTGGGCCCCACCCCCCACACSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07CCGTGGGCCCCACCCCCCACACNONE 
Os02g0251900AK109286CCGTGGGCCCCACASimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0282600AK070262GTGTGGGCCCCACAConserved hypothetical protein. 
AK070262GTGTGGGGCCCACAConserved hypothetical protein. 
J023041L18GTGTGGGCCCCACANONE 
J023041L18GTGTGGGGCCCACANONE 
Os02g0299200AK105486CGGGCCCACAIQ calmodulin-binding region domain containing protein. 
Os02g0301100006-029-F04GGGTGGGCCCGGCNONE 
012-005-F07GGGTGGGCCCGGCNONE 
013-093-H10GGGTGGGCCCGGCNONE 
015-042-B01GGGTGGGCCCGGCNONE 
016-017-F09GGGTGGGCCCGGCNONE 
016-079-B07GGGTGGGCCCGGCNONE 
016-079-G03GGGTGGGCCCGGCNONE 
016-087-F11GGGTGGGCCCGGCNONE 
AK071676GGGTGGGCCCGGCNONE 
AK100174GGGTGGGCCCGGCMtN3 and saliva related transmembrane protein family protein. 
AK104411GGGTGGGCCCGGCNONE 
AK104467GGGTGGGCCCGGCNONE 
J023069G02GGGTGGGCCCGGCNONE 
J023108F17GGGTGGGCCCGGCNONE 
J033042B04GGGTGGGCCCGGCNONE 
J033128D06GGGTGGGCCCGGCNONE 
J033138I12GGGTGGGCCCGGCNONE 
J053064K16GGGTGGGCCCGGCNONE 
J065088A12GGGTGGGCCCGGCNONE 
J065102L08GGGTGGGCCCGGCNONE 
J065104L14GGGTGGGCCCGGCNONE 
J065117M20GGGTGGGCCCGGCNONE 
J065117N14GGGTGGGCCCGGCNONE 
J065120H23GGGTGGGCCCGGCNONE 
J065135F06GGGTGGGCCCGGCNONE 
J065138J17GGGTGGGCCCGGCNONE 
J065138P06GGGTGGGCCCGGCNONE 
J065156G16GGGTGGGCCCGGCNONE 
J065163M20GGGTGGGCCCGGCNONE 
J065176A14GGGTGGGCCCGGCNONE 
J065182C02GGGTGGGCCCGGCNONE 
J065200C05GGGTGGGCCCGGCNONE 
J065213J22GGGTGGGCCCGGCNONE 
J065217D24GGGTGGGCCCGGCNONE 
J075009H03GGGTGGGCCCGGCNONE 
J075020D10GGGTGGGCCCGGCNONE 
J075026L24GGGTGGGCCCGGCNONE 
J075028L01GGGTGGGCCCGGCNONE 
J075057O09GGGTGGGCCCGGCNONE 
J075089A20GGGTGGGCCCGGCNONE 
J075094J15GGGTGGGCCCGGCNONE 
J075103B11GGGTGGGCCCGGCNONE 
J075143L13GGGTGGGCCCGGCNONE 
J075153K15GGGTGGGCCCGGCNONE 
J075161P22GGGTGGGCCCGGCNONE 
J075166J06GGGTGGGCCCGGCNONE 
J075177G06GGGTGGGCCCGGCNONE 
J075198N06GGGTGGGCCCGGCNONE 
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein. 
Os02g0304800Os02g0304800TGGGGCCCACGTGProtein prenyltransferase domain containing protein. 
Os02g0441000AK108073CTTGGGCCCACTTGConserved hypothetical protein. 
Os02g0461900009-042-C04GGTGGGCCCGACTCGACNONE 
AF140492GGTGGGCCCGACTCGACNONE 
AK072619GGTGGGCCCGACTCGACNONE 
AK104969GGTGGGCCCGACTCGACConserved hypothetical protein. 
AK119466GGTGGGCCCGACTCGACNONE 
Os02g0475300AK072737CCCCCGCGTCGTGGGCCCCACCTGNONE 
AK120516CCCCCGCGTCGTGGGCCCCACCTGMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0491300J065205O09GGTGGGGCCCACCTConserved hypothetical protein. 
Os02g0502500011-068-G11GCTGGGCCCACGTGTCNONE 
AK100111GCTGGGCCCACGTGTCNONE 
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein. 
J013074C19GCTGGGCCCACGTGTCNONE 
J013153K16GCTGGGCCCACGTGTCNONE 
J023078O21GCTGGGCCCACGTGTCNONE 
J033127M18GCTGGGCCCACGTGTCNONE 
J043038D17GCTGGGCCCACGTGTCNONE 
J065090L08GCTGGGCCCACGTGTCNONE 
J065110P16GCTGGGCCCACGTGTCNONE 
J065163C03GCTGGGCCCACGTGTCNONE 
J065213D23GCTGGGCCCACGTGTCNONE 
J090010M14GCTGGGCCCACGTGTCNONE 
J090016E02GCTGGGCCCACGTGTCNONE 
J090044J20GCTGGGCCCACGTGTCNONE 
J090091M16GCTGGGCCCACGTGTCNONE 
J090099I23GCTGGGCCCACGTGTCNONE 
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
Os02g0513100AK103266CCCGTGGGGGGCCCACASimilar to MtN3 protein precursor. 
Os02g0523800AK072296CTGGGGCCCACTInositol polyphosphate kinase family protein. 
J065081E24CTGGGGCCCACTNONE 
Os02g0534600Os02g0534600TGTGGGGCCCACAConserved hypothetical protein. 
Os02g0548900AK070239TGTGGGCCCCCACHypothetical protein. 
J023045K14TGTGGGCCCCCACNONE 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
Os02g0559300AK100088AGTGGGCCCCACCCCGTCCGANONE 
AK121206AGTGGGCCCCACCCCGTCCGAProtein kinase-like domain containing protein. 
J023003H24AGTGGGCCCCACCCCGTCCGANONE 
J023088A16AGTGGGCCCCACCCCGTCCGANONE 
J023100K01AGTGGGCCCCACCCCGTCCGANONE 
J023127H24AGTGGGCCCCACCCCGTCCGANONE 
Os02g0564000AJ486976GGTGGGGCCCACCTGTCNONE 
AK073086GGTGGGGCCCACCTGTCSimilar to Glutathione S-transferase. 
J065021E14GGTGGGGCCCACCTGTCNONE 
J065139E02GGTGGGGCCCACCTGTCNONE 
J065165G05GGTGGGGCCCACCTGTCNONE 
J065181H16GGTGGGGCCCACCTGTCNONE 
J065217K07GGTGGGGCCCACCTGTCNONE 
J065218L13GGTGGGGCCCACCTGTCNONE 
J100082K21GGTGGGGCCCACCTGTCNONE 
J100084K19GGTGGGGCCCACCTGTCNONE 
Os02g0564100006-072-A11GACAGGTGGGCCCCACCNONE 
AK073526GACAGGTGGGCCCCACCSimilar to EL3 protein. 
AK105951GACAGGTGGGCCCCACCNONE 
J100045C15GACAGGTGGGCCCCACCNONE 
Os02g0567000AK068282GTGTGGGCCCATGAConserved hypothetical protein. 
J075034A17GTGTGGGCCCATGANONE 
J075129I09GTGTGGGCCCATGANONE 
Os02g0573400Os02g0573400CAAGTGGGCCCATCGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os02g0578800009-044-A06CCGTGGGCCCCACANONE 
009-044-A06TGTGGGGCCCACTNONE 
AK070066CCGTGGGCCCCACAProtein of unknown function DUF962 family protein. 
AK070066TGTGGGGCCCACTProtein of unknown function DUF962 family protein. 
Os02g0589400009-182-H08GGGACCCACCTGGGGCCCACCAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
009-199-B01GGGACCCACCTGGGGCCCACCANONE 
011-015-G12GGGACCCACCTGGGGCCCACCANONE 
J023113C24GGGACCCACCTGGGGCCCACCANONE 
Os02g0600200009-154-A06CCCACCCGGGCCCACACNONE 
AK058978CCCACCCGGGCCCACACNONE 
AK066974CCCACCCGGGCCCACACIQ calmodulin-binding region domain containing protein. 
Os02g0601800AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
Os02g0606800AK073760CCCGGGCCCACAIsochorismatase hydrolase family protein. 
J100033B19CCCGGGCCCACANONE 
J100047E15CCCGGGCCCACANONE 
J100058A18CCCGGGCCCACANONE 
J100068L14CCCGGGCCCACANONE 
J100089I02CCCGGGCCCACANONE 
Os02g0625500011-025-C06AGTGGGCCCCNONE 
AB050624AGTGGGCCCCNONE 
AK059188AGTGGGCCCCNONE 
AK059771AGTGGGCCCCNONE 
AK101791AGTGGGCCCCSimilar to Adenosine kinase-like protein (Fragment). 
AY224510AGTGGGCCCCNONE 
J013152H02AGTGGGCCCCNONE 
J023012P09AGTGGGCCCCNONE 
J023127D16AGTGGGCCCCNONE 
J033024G01AGTGGGCCCCNONE 
J033025L19AGTGGGCCCCNONE 
J033080M04AGTGGGCCCCNONE 
J033101A08AGTGGGCCCCNONE 
J033121L12AGTGGGCCCCNONE 
J043017N15AGTGGGCCCCNONE 
J065207J01AGTGGGCCCCNONE 
J090049G12AGTGGGCCCCNONE 
J100036A07AGTGGGCCCCNONE 
J100076C04AGTGGGCCCCNONE 
J100080N22AGTGGGCCCCNONE 
Os02g0649300014-043-A05GGTGGGGCCCACGCGTNONE 
AK063685GGTGGGGCCCACGCGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0666200006-021-D11CTGGCCCACCAGGGCCCACGCNONE 
006-022-F02CTGGCCCACCAGGGCCCACGCNONE 
006-022-H11CTGGCCCACCAGGGCCCACGCNONE 
006-024-C03CTGGCCCACCAGGGCCCACGCNONE 
006-026-G05CTGGCCCACCAGGGCCCACGCNONE 
006-027-F11CTGGCCCACCAGGGCCCACGCNONE 
006-028-G06CTGGCCCACCAGGGCCCACGCNONE 
006-028-H05CTGGCCCACCAGGGCCCACGCNONE 
006-030-H06CTGGCCCACCAGGGCCCACGCNONE 
006-030-H12CTGGCCCACCAGGGCCCACGCNONE 
006-031-C07CTGGCCCACCAGGGCCCACGCNONE 
006-031-G01CTGGCCCACCAGGGCCCACGCNONE 
006-033-F09CTGGCCCACCAGGGCCCACGCNONE 
006-035-A01CTGGCCCACCAGGGCCCACGCNONE 
006-035-A12CTGGCCCACCAGGGCCCACGCNONE 
006-035-F04CTGGCCCACCAGGGCCCACGCNONE 
006-036-G09CTGGCCCACCAGGGCCCACGCNONE 
006-038-A01CTGGCCCACCAGGGCCCACGCNONE 
006-038-A03CTGGCCCACCAGGGCCCACGCNONE 
006-039-D08CTGGCCCACCAGGGCCCACGCNONE 
006-042-C11CTGGCCCACCAGGGCCCACGCNONE 
006-042-H06CTGGCCCACCAGGGCCCACGCNONE 
006-044-E01CTGGCCCACCAGGGCCCACGCNONE 
006-045-E05CTGGCCCACCAGGGCCCACGCNONE 
006-046-G05CTGGCCCACCAGGGCCCACGCNONE 
006-047-A03CTGGCCCACCAGGGCCCACGCNONE 
006-048-H08CTGGCCCACCAGGGCCCACGCNONE 
006-052-A07CTGGCCCACCAGGGCCCACGCNONE 
006-053-A05CTGGCCCACCAGGGCCCACGCNONE 
006-054-G06CTGGCCCACCAGGGCCCACGCNONE 
006-056-D10CTGGCCCACCAGGGCCCACGCNONE 
006-057-B07CTGGCCCACCAGGGCCCACGCNONE 
006-058-F12CTGGCCCACCAGGGCCCACGCNONE 
006-060-D01CTGGCCCACCAGGGCCCACGCNONE 
006-061-A12CTGGCCCACCAGGGCCCACGCNONE 
006-062-E02CTGGCCCACCAGGGCCCACGCNONE 
006-063-F11CTGGCCCACCAGGGCCCACGCNONE 
006-063-H02CTGGCCCACCAGGGCCCACGCNONE 
006-066-F12CTGGCCCACCAGGGCCCACGCNONE 
006-067-H12CTGGCCCACCAGGGCCCACGCNONE 
006-068-B09CTGGCCCACCAGGGCCCACGCNONE 
006-068-D08CTGGCCCACCAGGGCCCACGCNONE 
006-071-A12CTGGCCCACCAGGGCCCACGCNONE 
006-072-H06CTGGCCCACCAGGGCCCACGCNONE 
006-074-A02CTGGCCCACCAGGGCCCACGCNONE 
006-074-F10CTGGCCCACCAGGGCCCACGCNONE 
006-077-H10CTGGCCCACCAGGGCCCACGCNONE 
006-078-G02CTGGCCCACCAGGGCCCACGCNONE 
006-081-B03CTGGCCCACCAGGGCCCACGCNONE 
006-084-H01CTGGCCCACCAGGGCCCACGCNONE 
006-084-H02CTGGCCCACCAGGGCCCACGCNONE 
006-084-H04CTGGCCCACCAGGGCCCACGCNONE 
006-087-H08CTGGCCCACCAGGGCCCACGCNONE 
006-090-B08CTGGCCCACCAGGGCCCACGCNONE 
006-091-E10CTGGCCCACCAGGGCCCACGCNONE 
006-093-G02CTGGCCCACCAGGGCCCACGCNONE 
006-094-B12CTGGCCCACCAGGGCCCACGCNONE 
006-094-E03CTGGCCCACCAGGGCCCACGCNONE 
006-095-G07CTGGCCCACCAGGGCCCACGCNONE 
006-095-H07CTGGCCCACCAGGGCCCACGCNONE 
006-097-G08CTGGCCCACCAGGGCCCACGCNONE 
006-098-E12CTGGCCCACCAGGGCCCACGCNONE 
006-099-A04CTGGCCCACCAGGGCCCACGCNONE 
006-099-E08CTGGCCCACCAGGGCCCACGCNONE 
006-103-F12CTGGCCCACCAGGGCCCACGCNONE 
006-104-G02CTGGCCCACCAGGGCCCACGCNONE 
006-105-F02CTGGCCCACCAGGGCCCACGCNONE 
006-107-D12CTGGCCCACCAGGGCCCACGCNONE 
006-108-F10CTGGCCCACCAGGGCCCACGCNONE 
006-108-H05CTGGCCCACCAGGGCCCACGCNONE 
006-110-G11CTGGCCCACCAGGGCCCACGCNONE 
006-111-D10CTGGCCCACCAGGGCCCACGCNONE 
006-111-E03CTGGCCCACCAGGGCCCACGCNONE 
006-111-H01CTGGCCCACCAGGGCCCACGCNONE 
006-113-C12CTGGCCCACCAGGGCCCACGCNONE 
006-114-C10CTGGCCCACCAGGGCCCACGCNONE 
006-115-B02CTGGCCCACCAGGGCCCACGCNONE 
006-117-D11CTGGCCCACCAGGGCCCACGCNONE 
006-117-E01CTGGCCCACCAGGGCCCACGCNONE 
009-131-C02CTGGCCCACCAGGGCCCACGCNONE 
009-133-G05CTGGCCCACCAGGGCCCACGCNONE 
009-152-E01CTGGCCCACCAGGGCCCACGCNONE 
009-154-E08CTGGCCCACCAGGGCCCACGCNONE 
009-196-C11CTGGCCCACCAGGGCCCACGCNONE 
012-010-E10CTGGCCCACCAGGGCCCACGCNONE 
013-018-C05CTGGCCCACCAGGGCCCACGCNONE 
013-074-A06CTGGCCCACCAGGGCCCACGCNONE 
013-078-E06CTGGCCCACCAGGGCCCACGCNONE 
AB009665CTGGCCCACCAGGGCCCACGCNONE 
AF022737CTGGCCCACCAGGGCCCACGCNONE 
AJ224327CTGGCCCACCAGGGCCCACGCNONE 
AK061769CTGGCCCACCAGGGCCCACGCNONE 
AK103807CTGGCCCACCAGGGCCCACGCAquaporin. 
AK104658CTGGCCCACCAGGGCCCACGCNONE 
J013065I12CTGGCCCACCAGGGCCCACGCNONE 
J013067L09CTGGCCCACCAGGGCCCACGCNONE 
J013089I10CTGGCCCACCAGGGCCCACGCNONE 
J013095N22CTGGCCCACCAGGGCCCACGCNONE 
J013130E17CTGGCCCACCAGGGCCCACGCNONE 
J013131A06CTGGCCCACCAGGGCCCACGCNONE 
J013154E06CTGGCCCACCAGGGCCCACGCNONE 
J023004D16CTGGCCCACCAGGGCCCACGCNONE 
J023010A15CTGGCCCACCAGGGCCCACGCNONE 
J023010H04CTGGCCCACCAGGGCCCACGCNONE 
J023049K10CTGGCCCACCAGGGCCCACGCNONE 
J023056H24CTGGCCCACCAGGGCCCACGCNONE 
J023064J12CTGGCCCACCAGGGCCCACGCNONE 
J023078I06CTGGCCCACCAGGGCCCACGCNONE 
J023081D05CTGGCCCACCAGGGCCCACGCNONE 
J023099I19CTGGCCCACCAGGGCCCACGCNONE 
J023100F05CTGGCCCACCAGGGCCCACGCNONE 
J023131F16CTGGCCCACCAGGGCCCACGCNONE 
J033025F16CTGGCCCACCAGGGCCCACGCNONE 
J033028F10CTGGCCCACCAGGGCCCACGCNONE 
J033058H13CTGGCCCACCAGGGCCCACGCNONE 
J033064P18CTGGCCCACCAGGGCCCACGCNONE 
J033070H04CTGGCCCACCAGGGCCCACGCNONE 
J033107P20CTGGCCCACCAGGGCCCACGCNONE 
J033114E09CTGGCCCACCAGGGCCCACGCNONE 
J033125G23CTGGCCCACCAGGGCCCACGCNONE 
J033136G05CTGGCCCACCAGGGCCCACGCNONE 
J033147A07CTGGCCCACCAGGGCCCACGCNONE 
J053048M24CTGGCCCACCAGGGCCCACGCNONE 
J053056K02CTGGCCCACCAGGGCCCACGCNONE 
J053057N24CTGGCCCACCAGGGCCCACGCNONE 
J053060C13CTGGCCCACCAGGGCCCACGCNONE 
J065053C22CTGGCCCACCAGGGCCCACGCNONE 
J065067J11CTGGCCCACCAGGGCCCACGCNONE 
J065085A01CTGGCCCACCAGGGCCCACGCNONE 
J065189K01CTGGCCCACCAGGGCCCACGCNONE 
J075024G24CTGGCCCACCAGGGCCCACGCNONE 
J075060O04CTGGCCCACCAGGGCCCACGCNONE 
J075075M07CTGGCCCACCAGGGCCCACGCNONE 
J075090A10CTGGCCCACCAGGGCCCACGCNONE 
J075110P11CTGGCCCACCAGGGCCCACGCNONE 
J075114H02CTGGCCCACCAGGGCCCACGCNONE 
J075127L13CTGGCCCACCAGGGCCCACGCNONE 
J075151B19CTGGCCCACCAGGGCCCACGCNONE 
J075187M17CTGGCCCACCAGGGCCCACGCNONE 
J075198E22CTGGCCCACCAGGGCCCACGCNONE 
J080006J20CTGGCCCACCAGGGCCCACGCNONE 
J080081J10CTGGCCCACCAGGGCCCACGCNONE 
J080087C03CTGGCCCACCAGGGCCCACGCNONE 
J090029E22CTGGCCCACCAGGGCCCACGCNONE 
J090037C19CTGGCCCACCAGGGCCCACGCNONE 
J090037P10CTGGCCCACCAGGGCCCACGCNONE 
J090047M10CTGGCCCACCAGGGCCCACGCNONE 
J090055K05CTGGCCCACCAGGGCCCACGCNONE 
J090057N19CTGGCCCACCAGGGCCCACGCNONE 
J090062M13CTGGCCCACCAGGGCCCACGCNONE 
J090066F22CTGGCCCACCAGGGCCCACGCNONE 
J090066N12CTGGCCCACCAGGGCCCACGCNONE 
J090071K08CTGGCCCACCAGGGCCCACGCNONE 
J090080F16CTGGCCCACCAGGGCCCACGCNONE 
J090081J21CTGGCCCACCAGGGCCCACGCNONE 
J090083F22CTGGCCCACCAGGGCCCACGCNONE 
J090083I12CTGGCCCACCAGGGCCCACGCNONE 
J090088B16CTGGCCCACCAGGGCCCACGCNONE 
J090088E01CTGGCCCACCAGGGCCCACGCNONE 
J090091C11CTGGCCCACCAGGGCCCACGCNONE 
J090091F17CTGGCCCACCAGGGCCCACGCNONE 
J090097A05CTGGCCCACCAGGGCCCACGCNONE 
J090098B15CTGGCCCACCAGGGCCCACGCNONE 
J100018B04CTGGCCCACCAGGGCCCACGCNONE 
J100021J08CTGGCCCACCAGGGCCCACGCNONE 
J100026M12CTGGCCCACCAGGGCCCACGCNONE 
J100032F02CTGGCCCACCAGGGCCCACGCNONE 
J100034B03CTGGCCCACCAGGGCCCACGCNONE 
J100037D13CTGGCCCACCAGGGCCCACGCNONE 
J100041C16CTGGCCCACCAGGGCCCACGCNONE 
J100044D14CTGGCCCACCAGGGCCCACGCNONE 
J100044E21CTGGCCCACCAGGGCCCACGCNONE 
J100047M16CTGGCCCACCAGGGCCCACGCNONE 
J100051D22CTGGCCCACCAGGGCCCACGCNONE 
J100056M13CTGGCCCACCAGGGCCCACGCNONE 
J100061J12CTGGCCCACCAGGGCCCACGCNONE 
J100065A22CTGGCCCACCAGGGCCCACGCNONE 
J100067L12CTGGCCCACCAGGGCCCACGCNONE 
J100068F06CTGGCCCACCAGGGCCCACGCNONE 
J100070C24CTGGCCCACCAGGGCCCACGCNONE 
J100072N09CTGGCCCACCAGGGCCCACGCNONE 
J100073A10CTGGCCCACCAGGGCCCACGCNONE 
J100073B15CTGGCCCACCAGGGCCCACGCNONE 
J100077F05CTGGCCCACCAGGGCCCACGCNONE 
J100078B03CTGGCCCACCAGGGCCCACGCNONE 
J100078F01CTGGCCCACCAGGGCCCACGCNONE 
J100079B08CTGGCCCACCAGGGCCCACGCNONE 
J100083J06CTGGCCCACCAGGGCCCACGCNONE 
Os02g0670900003-115-B09TGTGGGCCCATGANONE 
005-004-F12TGTGGGCCCATGANONE 
006-037-B11TGTGGGCCCATGANONE 
006-094-B07TGTGGGCCCATGANONE 
011-020-A12TGTGGGCCCATGANONE 
AK061649TGTGGGCCCATGANONE 
AK061743TGTGGGCCCATGANONE 
AK064827TGTGGGCCCATGANONE 
AK100650TGTGGGCCCATGASimilar to Amino acid transporter protein-like. 
AK119517TGTGGGCCCATGANONE 
J013000F07TGTGGGCCCATGANONE 
J013027M02TGTGGGCCCATGANONE 
J013027M22TGTGGGCCCATGANONE 
J013031G16TGTGGGCCCATGANONE 
J013044H17TGTGGGCCCATGANONE 
J013045G22TGTGGGCCCATGANONE 
J013059N20TGTGGGCCCATGANONE 
J013063G15TGTGGGCCCATGANONE 
J013064J09TGTGGGCCCATGANONE 
J013089F14TGTGGGCCCATGANONE 
J013099L15TGTGGGCCCATGANONE 
J013119A08TGTGGGCCCATGANONE 
J013119B13TGTGGGCCCATGANONE 
J013126K07TGTGGGCCCATGANONE 
J023019J06TGTGGGCCCATGANONE 
J023019K19TGTGGGCCCATGANONE 
J023038I17TGTGGGCCCATGANONE 
J023042O17TGTGGGCCCATGANONE 
J023060G23TGTGGGCCCATGANONE 
J023064A12TGTGGGCCCATGANONE 
J023072G01TGTGGGCCCATGANONE 
J023108K16TGTGGGCCCATGANONE 
J023111D04TGTGGGCCCATGANONE 
J023134O14TGTGGGCCCATGANONE 
J023142P09TGTGGGCCCATGANONE 
J033039F01TGTGGGCCCATGANONE 
J033068J18TGTGGGCCCATGANONE 
J033117B05TGTGGGCCCATGANONE 
J033118I01TGTGGGCCCATGANONE 
J033136E10TGTGGGCCCATGANONE 
J033140C15TGTGGGCCCATGANONE 
J043024E09TGTGGGCCCATGANONE 
J043038B21TGTGGGCCCATGANONE 
J090005F19TGTGGGCCCATGANONE 
J090022N04TGTGGGCCCATGANONE 
J090023F15TGTGGGCCCATGANONE 
J090038O19TGTGGGCCCATGANONE 
J090042N22TGTGGGCCCATGANONE 
J090051C06TGTGGGCCCATGANONE 
J090063O09TGTGGGCCCATGANONE 
J090079N05TGTGGGCCCATGANONE 
J090096L17TGTGGGCCCATGANONE 
J100038G08TGTGGGCCCATGANONE 
J100041F17TGTGGGCCCATGANONE 
J100042G15TGTGGGCCCATGANONE 
J100042N11TGTGGGCCCATGANONE 
J100048B10TGTGGGCCCATGANONE 
J100056C24TGTGGGCCCATGANONE 
J100059K07TGTGGGCCCATGANONE 
J100069A06TGTGGGCCCATGANONE 
J100077B01TGTGGGCCCATGANONE 
J100089D17TGTGGGCCCATGANONE 
Os02g0677700AK119947TGTGGGCCCCACANONE 
Os02g0686300AK066567AGAGTGGGCCCGConserved hypothetical protein. 
Os02g0686700AK111294AGGGCCCACTCCProtein of unknown function DUF581 family protein. 
AK111294CGTGGGGCCCACCTProtein of unknown function DUF581 family protein. 
Os02g0697200015-013-B10AACGGGCCCACANONE 
AK059475AACGGGCCCACANONE 
AK102993AACGGGCCCACAConserved hypothetical protein. 
J033079I18AACGGGCCCACANONE 
J033082A14AACGGGCCCACANONE 
J065047H08AACGGGCCCACANONE 
J065131M14AACGGGCCCACANONE 
Os02g0698100009-089-H10TGTGGGCCCCACGNONE 
AK060614TGTGGGCCCCACGGalactose oxidase, central domain containing protein. 
J090039P20TGTGGGCCCCACGNONE 
Os02g0699700AK072471AGGGCCCACAASimilar to DNA topoisomerase II. 
Os02g0708100AK059630TCGTGGGCCCGCNONE 
AK102055TCGTGGGCCCGCSimilar to Carbamoyl phosphate synthetase small subunit (EC 6.3.5.5). 
Os02g0709200AK058999GTCGCGCGCGTGGGCCCCSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase). 
AK099074GTCGCGCGCGTGGGCCCCNONE 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0725100AK071759TTGTGGGCCCCNONE 
Os02g0731700AK072346AGTGGGCCCGCSimilar to CONSTANS-like 1 protein. 
AK120314AGTGGGCCCGCNONE 
Os02g0733500AK108506TTGTGGGCCCCParvalbumin family protein. 
Os02g0741100AK068712GGTGGGGCCCACASimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK071144GGTGGGGCCCACANONE 
J065056A02GGTGGGGCCCACANONE 
J065212F10GGTGGGGCCCACANONE 
J080005J10GGTGGGGCCCACANONE 
J080013A11GGTGGGGCCCACANONE 
J080015E01GGTGGGGCCCACANONE 
J080022G23GGTGGGGCCCACANONE 
J080025C13GGTGGGGCCCACANONE 
J080026P14GGTGGGGCCCACANONE 
J080027D22GGTGGGGCCCACANONE 
J080027G13GGTGGGGCCCACANONE 
J080027L23GGTGGGGCCCACANONE 
J080027N23GGTGGGGCCCACANONE 
J080028F21GGTGGGGCCCACANONE 
J080028J18GGTGGGGCCCACANONE 
J080028P22GGTGGGGCCCACANONE 
J080038P04GGTGGGGCCCACANONE 
J080042M11GGTGGGGCCCACANONE 
J080043B19GGTGGGGCCCACANONE 
J080045J23GGTGGGGCCCACANONE 
J080047B06GGTGGGGCCCACANONE 
J080052F04GGTGGGGCCCACANONE 
J080057F01GGTGGGGCCCACANONE 
J080057G03GGTGGGGCCCACANONE 
J080060H12GGTGGGGCCCACANONE 
J080061L12GGTGGGGCCCACANONE 
J080062J17GGTGGGGCCCACANONE 
J080062M22GGTGGGGCCCACANONE 
J080072C01GGTGGGGCCCACANONE 
J080075F01GGTGGGGCCCACANONE 
J080076A09GGTGGGGCCCACANONE 
J080076I01GGTGGGGCCCACANONE 
J080077D01GGTGGGGCCCACANONE 
J080077F19GGTGGGGCCCACANONE 
J080079L19GGTGGGGCCCACANONE 
J080088B03GGTGGGGCCCACANONE 
J080090J15GGTGGGGCCCACANONE 
J080092J21GGTGGGGCCCACANONE 
J080095J12GGTGGGGCCCACANONE 
J090012C05GGTGGGGCCCACANONE 
J090039K19GGTGGGGCCCACANONE 
J090078L12GGTGGGGCCCACANONE 
Os02g0744700AF395537GACACGTGGGCCCCACACNONE 
AF395537GGTGGGGCCCACTTGNONE 
AJ308110GACACGTGGGCCCCACACNONE 
AJ308110GGTGGGGCCCACTTGNONE 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
AK066446GGTGGGGCCCACTTGSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0745400AK072229AGGGCCCACGAGlycosyl transferase, family 8 protein. 
AK108072AGGGCCCACGANONE 
Os02g0753000AK121015GCTGGGCCCACTCCSimilar to Trehalose-6-phosphate phosphatase. 
Os02g0754500AK069965TATTGGGCCCACGANONE 
AK105696TATTGGGCCCACGAAmidase family protein. 
Os02g0755600014-024-D06TGTGGGCCCACGTGNONE 
015-039-F09TGTGGGCCCACGTGNONE 
AK064105TGTGGGCCCACGTGNONE 
AK106639TGTGGGCCCACGTGSimilar to UDP-glucuronosyltransferase. 
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE 
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like. 
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE 
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE 
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE 
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE 
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE 
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE 
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE 
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE 
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE 
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE 
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE 
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE 
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE 
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE 
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE 
Os02g0761600AK120494GGTGGGCCCCConserved hypothetical protein. 
Os02g0767500005-017-F10CGGGCCCACANONE 
AB016065CGGGCCCACANONE 
AK069611CGGGCCCACAMitochondrial phosphate transporter. 
J013020K11CGGGCCCACANONE 
J013066I18CGGGCCCACANONE 
J023012D02CGGGCCCACANONE 
J023020J16CGGGCCCACANONE 
J023022H13CGGGCCCACANONE 
J023044N15CGGGCCCACANONE 
J023067E15CGGGCCCACANONE 
J023079C06CGGGCCCACANONE 
J023080B07CGGGCCCACANONE 
J023081G11CGGGCCCACANONE 
J023091H22CGGGCCCACANONE 
J023092J03CGGGCCCACANONE 
J023114D02CGGGCCCACANONE 
J023121J15CGGGCCCACANONE 
J023128G10CGGGCCCACANONE 
J023132B15CGGGCCCACANONE 
J023140G10CGGGCCCACANONE 
J023142B10CGGGCCCACANONE 
J033026C15CGGGCCCACANONE 
J033029F21CGGGCCCACANONE 
J033037I09CGGGCCCACANONE 
J033046D11CGGGCCCACANONE 
J033081L20CGGGCCCACANONE 
J033097J19CGGGCCCACANONE 
J033125D19CGGGCCCACANONE 
J033125I04CGGGCCCACANONE 
J033141M21CGGGCCCACANONE 
J033143K08CGGGCCCACANONE 
J053091N01CGGGCCCACANONE 
J065093C20CGGGCCCACANONE 
J065104K11CGGGCCCACANONE 
J065143L16CGGGCCCACANONE 
J065205I23CGGGCCCACANONE 
J090057C12CGGGCCCACANONE 
J090075P11CGGGCCCACANONE 
Os02g0768600006-034-F01GGGTGGGCCCACCTGNONE 
006-046-G07GGGTGGGCCCACCTGNONE 
006-054-C07GGGTGGGCCCACCTGNONE 
006-056-F07GGGTGGGCCCACCTGNONE 
006-100-C02GGGTGGGCCCACCTGNONE 
AK059725GGGTGGGCCCACCTGNONE 
AK098996GGGTGGGCCCACCTGNONE 
AK099120GGGTGGGCCCACCTGNONE 
AK104659GGGTGGGCCCACCTGNONE 
J065043H04GGGTGGGCCCACCTGNONE 
J075034N21GGGTGGGCCCACCTGNONE 
J075145C18GGGTGGGCCCACCTGNONE 
J080016H01GGGTGGGCCCACCTGNONE 
J080040F01GGGTGGGCCCACCTGNONE 
J080047L23GGGTGGGCCCACCTGNONE 
J080049B22GGGTGGGCCCACCTGNONE 
J080062J16GGGTGGGCCCACCTGNONE 
J080064C23GGGTGGGCCCACCTGNONE 
J080064L22GGGTGGGCCCACCTGNONE 
J080077N01GGGTGGGCCCACCTGNONE 
J080097G17GGGTGGGCCCACCTGNONE 
J100065L15GGGTGGGCCCACCTGNONE 
J100066K23GGGTGGGCCCACCTGNONE 
J100088C07GGGTGGGCCCACCTGNONE 
J100090H09GGGTGGGCCCACCTGNONE 
Os02g0782700005-009-B03CTGACAGGTGGGCCCCACCACNONE 
006-065-C12CTGACAGGTGGGCCCCACCACNONE 
011-016-A10CTGACAGGTGGGCCCCACCACNONE 
011-027-G10CTGACAGGTGGGCCCCACCACNONE 
011-078-C10CTGACAGGTGGGCCCCACCACNONE 
012-039-F02CTGACAGGTGGGCCCCACCACNONE 
012-059-F07CTGACAGGTGGGCCCCACCACNONE 
012-088-B06CTGACAGGTGGGCCCCACCACNONE 
012-088-C06CTGACAGGTGGGCCCCACCACNONE 
012-090-F01CTGACAGGTGGGCCCCACCACNONE 
015-002-C09CTGACAGGTGGGCCCCACCACNONE 
015-004-C04CTGACAGGTGGGCCCCACCACNONE 
015-024-F11CTGACAGGTGGGCCCCACCACNONE 
015-038-C01CTGACAGGTGGGCCCCACCACNONE 
015-053-H02CTGACAGGTGGGCCCCACCACNONE 
015-057-G04CTGACAGGTGGGCCCCACCACNONE 
016-010-H02CTGACAGGTGGGCCCCACCACNONE 
016-018-C07CTGACAGGTGGGCCCCACCACNONE 
016-048-B11CTGACAGGTGGGCCCCACCACNONE 
016-062-D03CTGACAGGTGGGCCCCACCACNONE 
016-077-H03CTGACAGGTGGGCCCCACCACNONE 
AF193803CTGACAGGTGGGCCCCACCACNONE 
AK064027CTGACAGGTGGGCCCCACCACNONE 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK119643CTGACAGGTGGGCCCCACCACNONE 
AK119885CTGACAGGTGGGCCCCACCACNONE 
J013021I16CTGACAGGTGGGCCCCACCACNONE 
J013049O14CTGACAGGTGGGCCCCACCACNONE 
J013063K17CTGACAGGTGGGCCCCACCACNONE 
J013072M15CTGACAGGTGGGCCCCACCACNONE 
J023027O06CTGACAGGTGGGCCCCACCACNONE 
J023065O13CTGACAGGTGGGCCCCACCACNONE 
J033061L05CTGACAGGTGGGCCCCACCACNONE 
J033071D23CTGACAGGTGGGCCCCACCACNONE 
J033091P12CTGACAGGTGGGCCCCACCACNONE 
J033124J07CTGACAGGTGGGCCCCACCACNONE 
J033144H23CTGACAGGTGGGCCCCACCACNONE 
J033145H23CTGACAGGTGGGCCCCACCACNONE 
J065063N13CTGACAGGTGGGCCCCACCACNONE 
J065186B09CTGACAGGTGGGCCCCACCACNONE 
J075055I18CTGACAGGTGGGCCCCACCACNONE 
J075177O06CTGACAGGTGGGCCCCACCACNONE 
J090008G10CTGACAGGTGGGCCCCACCACNONE 
J090050I24CTGACAGGTGGGCCCCACCACNONE 
J090062F21CTGACAGGTGGGCCCCACCACNONE 
J090071M09CTGACAGGTGGGCCCCACCACNONE 
J090078M03CTGACAGGTGGGCCCCACCACNONE 
J100018N15CTGACAGGTGGGCCCCACCACNONE 
J100035P04CTGACAGGTGGGCCCCACCACNONE 
J100037E03CTGACAGGTGGGCCCCACCACNONE 
J100045D04CTGACAGGTGGGCCCCACCACNONE 
J100062C01CTGACAGGTGGGCCCCACCACNONE 
J100065C13CTGACAGGTGGGCCCCACCACNONE 
J100068N10CTGACAGGTGGGCCCCACCACNONE 
J100074A11CTGACAGGTGGGCCCCACCACNONE 
J100077G20CTGACAGGTGGGCCCCACCACNONE 
Os02g0789600AK101046CAAGTGGGCCCTNONE 
AK112100CAAGTGGGCCCTSimilar to DEM2. 
Os02g0792600J090091O08CTGACAGGTGGGGCCCACGCNONE 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0797600004-004-A08GGGGCCCACCTNONE 
006-050-H07GGGGCCCACCTNONE 
006-092-B02GGGGCCCACCTNONE 
006-100-B08GGGGCCCACCTNONE 
013-037-D09GGGGCCCACCTNONE 
013-068-H02GGGGCCCACCTNONE 
AK060857GGGGCCCACCTNONE 
AK098882GGGGCCCACCTNONE 
AK104474GGGGCCCACCTNONE 
AK120644GGGGCCCACCTConserved hypothetical protein. 
J013001F21GGGGCCCACCTNONE 
J013074D07GGGGCCCACCTNONE 
J013096H23GGGGCCCACCTNONE 
J013098H07GGGGCCCACCTNONE 
J013132L13GGGGCCCACCTNONE 
J013134K05GGGGCCCACCTNONE 
J013155B15GGGGCCCACCTNONE 
J023002L17GGGGCCCACCTNONE 
J023013B08GGGGCCCACCTNONE 
J023087I01GGGGCCCACCTNONE 
J033071O04GGGGCCCACCTNONE 
J065161N23GGGGCCCACCTNONE 
J075055G11GGGGCCCACCTNONE 
J075106J02GGGGCCCACCTNONE 
J080009D06GGGGCCCACCTNONE 
J080009N22GGGGCCCACCTNONE 
J080016L03GGGGCCCACCTNONE 
J080023E17GGGGCCCACCTNONE 
J080027A12GGGGCCCACCTNONE 
J080036M24GGGGCCCACCTNONE 
J080038N07GGGGCCCACCTNONE 
J080041A04GGGGCCCACCTNONE 
J080042K11GGGGCCCACCTNONE 
J080050A04GGGGCCCACCTNONE 
J080053G16GGGGCCCACCTNONE 
J080063D03GGGGCCCACCTNONE 
J080063F07GGGGCCCACCTNONE 
J080067H13GGGGCCCACCTNONE 
J080068F12GGGGCCCACCTNONE 
J080072G17GGGGCCCACCTNONE 
J080072I06GGGGCCCACCTNONE 
J080072J24GGGGCCCACCTNONE 
J080076G09GGGGCCCACCTNONE 
J080085H10GGGGCCCACCTNONE 
J080092I17GGGGCCCACCTNONE 
J080092N20GGGGCCCACCTNONE 
J080093G10GGGGCCCACCTNONE 
J090074C23GGGGCCCACCTNONE 
J090083O18GGGGCCCACCTNONE 
J100046M05GGGGCCCACCTNONE 
J100050N16GGGGCCCACCTNONE 
J100054D07GGGGCCCACCTNONE 
J100054O11GGGGCCCACCTNONE 
J100055F04GGGGCCCACCTNONE 
J100055H22GGGGCCCACCTNONE 
J100063A05GGGGCCCACCTNONE 
J100063I24GGGGCCCACCTNONE 
J100067I12GGGGCCCACCTNONE 
J100074A22GGGGCCCACCTNONE 
J100078B22GGGGCCCACCTNONE 
J100079B03GGGGCCCACCTNONE 
Os02g0798300AK120999AGGGCCCACTConserved hypothetical protein. 
Os02g0803600AK064750ACAGGTGGGCCCCLongin-like domain containing protein. 
AK064750TGTGGGCCCCALongin-like domain containing protein. 
Os02g0805200AK071591CAGGTGGGCCCGProliferating cell nuclear antigen (PCNA) (Cyclin). 
J023105C08CAGGTGGGCCCGNONE 
J033030H07CAGGTGGGCCCGNONE 
J033050M24CAGGTGGGCCCGNONE 
J033069B10CAGGTGGGCCCGNONE 
J033121A16CAGGTGGGCCCGNONE 
J053023M14CAGGTGGGCCCGNONE 
J053033A15CAGGTGGGCCCGNONE 
J053054H14CAGGTGGGCCCGNONE 
J053055H24CAGGTGGGCCCGNONE 
J053082B18CAGGTGGGCCCGNONE 
J065001N03CAGGTGGGCCCGNONE 
J065011O16CAGGTGGGCCCGNONE 
J065026K24CAGGTGGGCCCGNONE 
J065056C09CAGGTGGGCCCGNONE 
J065067H11CAGGTGGGCCCGNONE 
J065097E19CAGGTGGGCCCGNONE 
J065118O11CAGGTGGGCCCGNONE 
J065124N09CAGGTGGGCCCGNONE 
J065143A02CAGGTGGGCCCGNONE 
J065213P06CAGGTGGGCCCGNONE 
J065215E24CAGGTGGGCCCGNONE 
J075051B11CAGGTGGGCCCGNONE 
J075065K05CAGGTGGGCCCGNONE 
J080306E10CAGGTGGGCCCGNONE 
J090042I16CAGGTGGGCCCGNONE 
J090066J24CAGGTGGGCCCGNONE 
J090092K17CAGGTGGGCCCGNONE 
J100029A17CAGGTGGGCCCGNONE 
J100052N08CAGGTGGGCCCGNONE 
J100071I23CAGGTGGGCCCGNONE 
Os02g0815200AK067252AGGGCCCACASimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29). 
AK104489AGGGCCCACANONE 
Os02g0817500AK072707GACAGGTGGGCCCCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135GACAGGTGGGCCCCNONE 
U46758GACAGGTGGGCCCCNONE 
Os02g0817600006-085-G03TTGTGGGCCCCACANONE 
AJ748648TTGTGGGCCCCACANONE 
AK069892TTGTGGGCCCCACAAUX/IAA protein family protein. 
AK104501TTGTGGGCCCCACANONE 
AK104802TTGTGGGCCCCACANONE 
J013027H10TTGTGGGCCCCACANONE 
J013106L07TTGTGGGCCCCACANONE 
J013118N15TTGTGGGCCCCACANONE 
J013131H01TTGTGGGCCCCACANONE 
J013170C08TTGTGGGCCCCACANONE 
J023060C13TTGTGGGCCCCACANONE 
J033024K10TTGTGGGCCCCACANONE 
J033052I08TTGTGGGCCCCACANONE 
J090010H15TTGTGGGCCCCACANONE 
J090011J11TTGTGGGCCCCACANONE 
J090038P15TTGTGGGCCCCACANONE 
J090060B02TTGTGGGCCCCACANONE 
J100079J16TTGTGGGCCCCACANONE 
Os02g0823400AK105029ATCTGGGCCCACASimilar to S-adenosyl-L-methionine: beta-alanine N-methyltransferase (Fragment). 
J033140N12ATCTGGGCCCACANONE 
J075104C12ATCTGGGCCCACANONE 
J075120E03ATCTGGGCCCACANONE 
J075126M18ATCTGGGCCCACANONE 
J075189P21ATCTGGGCCCACANONE 
Os02g0824900AK073217AGTGGGCCCATTTNONE 
AK103528AGTGGGCCCATTTConserved hypothetical protein. 
J090069J01AGTGGGCCCATTTNONE 
J090081B04AGTGGGCCCATTTNONE 
Os02g0830100J013032G02CGATGGGCCCACCACNONE 
J013052O21CGATGGGCCCACCACNONE 
J023078A05CGATGGGCCCACCACNONE 
J033114C07CGATGGGCCCACCACNONE 
J033125M07CGATGGGCCCACCACNONE 
J053045C11CGATGGGCCCACCACNONE 
J100055G05CGATGGGCCCACCACNONE 
J100080J22CGATGGGCCCACCACNONE 
Os03g0100200009-022-G08TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-012-C04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-039-F04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
AK104982TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J013039N23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J023131F13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065013G18TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065056M02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065197O22TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075055L17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075076F02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075085M06TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075104E21TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075123P09TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075125G07TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075138M13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075142J17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075152F05TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075191L23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J090074I04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
Os03g0113700AK103835CTGGGGCCCACCCGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CGGGTGGGCCCCAGProtein prenyltransferase domain containing protein. 
J013047E20CGGGTGGGCCCCAGNONE 
J065026F21CGGGTGGGCCCCAGNONE 
J065047B03CGGGTGGGCCCCAGNONE 
J065054J12CGGGTGGGCCCCAGNONE 
J065079M24CGGGTGGGCCCCAGNONE 
J065093M07CGGGTGGGCCCCAGNONE 
J065153F02CGGGTGGGCCCCAGNONE 
J065155E21CGGGTGGGCCCCAGNONE 
J065179H15CGGGTGGGCCCCAGNONE 
J075019N02CGGGTGGGCCCCAGNONE 
J075089E01CGGGTGGGCCCCAGNONE 
J090066I18CGGGTGGGCCCCAGNONE 
J090087K20CGGGTGGGCCCCAGNONE 
J100079F05CGGGTGGGCCCCAGNONE 
Os03g0113900AK107900GTGTGGGCCCCACCProtein of unknown function DUF584 family protein. 
AK119700GTGTGGGCCCCACCNONE 
Os03g0119100AK069519CAAGTGGGCCCTSimilar to Phospholipase D beta 2. 
AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
J023024E17CAAGTGGGCCCTNONE 
J023024E17CCATGGGCCCACGGCCCATTNONE 
J023122B02CAAGTGGGCCCTNONE 
J023122B02CCATGGGCCCACGGCCCATTNONE 
J090094E15CAAGTGGGCCCTNONE 
J090094E15CCATGGGCCCACGGCCCATTNONE 
Os03g0122000AK101458AGAGTGGGCCCATCGTGTCAGTGProtein kinase-like domain containing protein. 
J013035K10AGAGTGGGCCCATCGTGTCAGTGNONE 
J013050E10AGAGTGGGCCCATCGTGTCAGTGNONE 
J033040C13AGAGTGGGCCCATCGTGTCAGTGNONE 
Os03g0124300AK069148ACGCGTGGGCCCCACCConserved hypothetical protein. 
AK106076ACGCGTGGGCCCCACCNONE 
J023003G19ACGCGTGGGCCCCACCNONE 
Os03g0130400AK070255TCGTGGGCCCCAdenylate kinase, subfamily protein. 
Os03g0131300015-095-G06CCGTGGGCCCCCACNONE 
015-095-G06GGTCCACGTGGGGGCCCACCCNONE 
AK100656CCGTGGGCCCCCACUbiquitin domain containing protein. 
AK100656GGTCCACGTGGGGGCCCACCCUbiquitin domain containing protein. 
J033140O12CCGTGGGCCCCCACNONE 
J033140O12GGTCCACGTGGGGGCCCACCCNONE 
J065112C14CCGTGGGCCCCCACNONE 
J065112C14GGTCCACGTGGGGGCCCACCCNONE 
J090070D10CCGTGGGCCCCCACNONE 
J090070D10GGTCCACGTGGGGGCCCACCCNONE 
Os03g0132000AK105769CGGGTGGGCCCACACGSimilar to 4-coumarate-CoA ligase-like protein. 
AK121384CGGGTGGGCCCACACGNONE 
Os03g0133300AK064510GGTGGGCCCACAConserved hypothetical protein. 
Os03g0148000AK110468GCCGGGCCCACAProtein of unknown function DUF677 family protein. 
Os03g0151800AK064955CGGGCCCACACNONE 
AK098874CGGGCCCACACNONE 
AK098980CGGGCCCACACNONE 
AK099712CGGGCCCACACNONE 
AK099889CGGGCCCACACNONE 
AK121641CGGGCCCACACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05CGGGCCCACACNONE 
J013001D04CGGGCCCACACNONE 
J013121O12CGGGCCCACACNONE 
Os03g0151900009-084-F09GTGGGGCCCACTNONE 
AB032761GTGGGGCCCACTNONE 
AK105389GTGGGGCCCACTNONE 
AK121527GTGGGGCCCACTSimilar to Small GTP-binding protein. 
J075028M03GTGGGGCCCACTNONE 
J075031H15GTGGGGCCCACTNONE 
J075045L24GTGGGGCCCACTNONE 
J075055K14GTGGGGCCCACTNONE 
J075100O08GTGGGGCCCACTNONE 
J075112B20GTGGGGCCCACTNONE 
J075188D21GTGGGGCCCACTNONE 
Os03g0154300J065112A07AGGTGGGCCCCACGAAConserved hypothetical protein. 
J065192P15AGGTGGGCCCCACGAANONE 
Os03g0156500011-075-F02CGCGGGGGGGTGGGCCCCACACNONE 
011-075-F02CGGGCCCACGTGNONE 
012-077-G10CGCGGGGGGGTGGGCCCCACACNONE 
012-077-G10CGGGCCCACGTGNONE 
AK103466CGCGGGGGGGTGGGCCCCACACLupus La protein family protein. 
AK103466CGGGCCCACGTGLupus La protein family protein. 
J013088H17CGCGGGGGGGTGGGCCCCACACNONE 
J013088H17CGGGCCCACGTGNONE 
J013135G21CGCGGGGGGGTGGGCCCCACACNONE 
J013135G21CGGGCCCACGTGNONE 
J033050E10CGCGGGGGGGTGGGCCCCACACNONE 
J033050E10CGGGCCCACGTGNONE 
J033050J01CGCGGGGGGGTGGGCCCCACACNONE 
J033050J01CGGGCCCACGTGNONE 
J033129N23CGCGGGGGGGTGGGCCCCACACNONE 
J033129N23CGGGCCCACGTGNONE 
J065085L16CGCGGGGGGGTGGGCCCCACACNONE 
J065085L16CGGGCCCACGTGNONE 
J065101B19CGCGGGGGGGTGGGCCCCACACNONE 
J065101B19CGGGCCCACGTGNONE 
J065167N03CGCGGGGGGGTGGGCCCCACACNONE 
J065167N03CGGGCCCACGTGNONE 
J090009O21CGCGGGGGGGTGGGCCCCACACNONE 
J090009O21CGGGCCCACGTGNONE 
J090049D11CGCGGGGGGGTGGGCCCCACACNONE 
J090049D11CGGGCCCACGTGNONE 
J100017F23CGCGGGGGGGTGGGCCCCACACNONE 
J100017F23CGGGCCCACGTGNONE 
J100040E12CGCGGGGGGGTGGGCCCCACACNONE 
J100040E12CGGGCCCACGTGNONE 
J100055O18CGCGGGGGGGTGGGCCCCACACNONE 
J100055O18CGGGCCCACGTGNONE 
J100061K08CGCGGGGGGGTGGGCCCCACACNONE 
J100061K08CGGGCCCACGTGNONE 
J100072M05CGCGGGGGGGTGGGCCCCACACNONE 
J100072M05CGGGCCCACGTGNONE 
J100077B08CGCGGGGGGGTGGGCCCCACACNONE 
J100077B08CGGGCCCACGTGNONE 
J100086G03CGCGGGGGGGTGGGCCCCACACNONE 
J100086G03CGGGCCCACGTGNONE 
Os03g0161200AK066932GTGGTGGGCCCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0169600004-013-C11CCGTGGGCCCCACCACNONE 
011-035-C04CCGTGGGCCCCACCACNONE 
AK060900CCGTGGGCCCCACCACNONE 
AK099490CCGTGGGCCCCACCACZinc finger, Dof-type family protein. 
AK104523CCGTGGGCCCCACCACNONE 
AY224429CCGTGGGCCCCACCACNONE 
J013026L11CCGTGGGCCCCACCACNONE 
J013026N04CCGTGGGCCCCACCACNONE 
J013030D16CCGTGGGCCCCACCACNONE 
J013049P17CCGTGGGCCCCACCACNONE 
J013099D17CCGTGGGCCCCACCACNONE 
J013114M09CCGTGGGCCCCACCACNONE 
J013124F12CCGTGGGCCCCACCACNONE 
J013131J05CCGTGGGCCCCACCACNONE 
J023025M09CCGTGGGCCCCACCACNONE 
J090042J08CCGTGGGCCCCACCACNONE 
J090094F11CCGTGGGCCCCACCACNONE 
J100051I17CCGTGGGCCCCACCACNONE 
Os03g0169800AK068278GGTGGGCCCCACCTGTHNH nuclease domain containing protein. 
Os03g0171700J065192H12CCCGGGCCCACTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J065192H12GGTGGGCCCATCTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0180100AK108326TCGTGGGCCCCACCCCACCACProtein of unknown function DUF1677, plant family protein. 
Os03g0183300003-107-A07CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-113-H10CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-118-G01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-028-A09CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-047-D01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-052-D04CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-087-H06CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-089-B03CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-092-D08CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-093-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-029-H07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-067-B05CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-091-F04CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-101-C10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-113-A06CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-140-E12CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-145-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-196-F02CCCCCGCGTGGGCCCCACCCACCTGNONE 
011-054-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-074-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-076-E11CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-006-C07CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-085-G11CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-049-C04CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-062-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
016-063-E02CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK058349CCCCCGCGTGGGCCCCACCCACCTGHypothetical protein. 
AK105922CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK106163CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK119553CCCCCGCGTGGGCCCCACCCACCTGNONE 
AY831395CCCCCGCGTGGGCCCCACCCACCTGNONE 
Os03g0188200AK058578GGTGGGGCCCACTZinc finger, RING-type domain containing protein. 
Os03g0191200AK070228TGGTGGGCCCGGTWW/Rsp5/WWP domain containing protein. 
Os03g0192400009-081-A03AGTGGGCCCGGCCCNONE 
009-159-B02AGTGGGCCCGGCCCNONE 
AK070573AGTGGGCCCGGCCCGRIM-19 family protein. 
J023056B01AGTGGGCCCGGCCCNONE 
J023075G06AGTGGGCCCGGCCCNONE 
J033048K16AGTGGGCCCGGCCCNONE 
J033048L16AGTGGGCCCGGCCCNONE 
J053031H23AGTGGGCCCGGCCCNONE 
J065002H14AGTGGGCCCGGCCCNONE 
J065006G22AGTGGGCCCGGCCCNONE 
J065032G13AGTGGGCCCGGCCCNONE 
J065056A09AGTGGGCCCGGCCCNONE 
J065078I01AGTGGGCCCGGCCCNONE 
J065095G01AGTGGGCCCGGCCCNONE 
J065095I18AGTGGGCCCGGCCCNONE 
J065134M18AGTGGGCCCGGCCCNONE 
J065158P07AGTGGGCCCGGCCCNONE 
J065165K17AGTGGGCCCGGCCCNONE 
J065181J12AGTGGGCCCGGCCCNONE 
J065189N09AGTGGGCCCGGCCCNONE 
J065200D13AGTGGGCCCGGCCCNONE 
J065202H20AGTGGGCCCGGCCCNONE 
J065215K20AGTGGGCCCGGCCCNONE 
J075049N19AGTGGGCCCGGCCCNONE 
J075147J16AGTGGGCCCGGCCCNONE 
J090081E19AGTGGGCCCGGCCCNONE 
J100017C16AGTGGGCCCGGCCCNONE 
J100039M16AGTGGGCCCGGCCCNONE 
J100043E23AGTGGGCCCGGCCCNONE 
J100063L12AGTGGGCCCGGCCCNONE 
J100079F22AGTGGGCCCGGCCCNONE 
Os03g0192700012-005-H03GGTGGGCCCGNONE 
012-006-B05GGTGGGCCCGNONE 
012-006-E07GGTGGGCCCGNONE 
012-051-D10GGTGGGCCCGNONE 
014-089-H06GGTGGGCCCGNONE 
015-034-C05GGTGGGCCCGNONE 
015-042-C06GGTGGGCCCGNONE 
015-059-E09GGTGGGCCCGNONE 
015-096-A08GGTGGGCCCGNONE 
016-030-D06GGTGGGCCCGNONE 
016-053-H07GGTGGGCCCGNONE 
016-064-D02GGTGGGCCCGNONE 
AB012107GGTGGGCCCGNONE 
AK058750GGTGGGCCCGSimilar to Myo-inositol-1-phosphate synthase. 
AK103501GGTGGGCCCGNONE 
J023102F09GGTGGGCCCGNONE 
J023103H09GGTGGGCCCGNONE 
J023107F22GGTGGGCCCGNONE 
J033031E17GGTGGGCCCGNONE 
J033090C03GGTGGGCCCGNONE 
J033090C17GGTGGGCCCGNONE 
J033091K19GGTGGGCCCGNONE 
J033131B11GGTGGGCCCGNONE 
J033133D04GGTGGGCCCGNONE 
J053050C09GGTGGGCCCGNONE 
J053078O12GGTGGGCCCGNONE 
J075037B10GGTGGGCCCGNONE 
J090021M23GGTGGGCCCGNONE 
Os03g0201600AK067825GGTGGGGCCCACCTGTCNONE 
Os03g0206400AK066494GGGTGGGCCCGCConserved hypothetical protein. 
AK107011GGGTGGGCCCGCNONE 
J065162G04GGGTGGGCCCGCNONE 
Os03g0206600AK058618GCTGGGCCCACGCProtein of unknown function DUF588 family protein. 
Os03g0213600AK100407TGTGGGGCCCACCConserved hypothetical protein. 
Os03g0222100AK070688CCCGGGCCCACTSimilar to Topoisomerase-like protein. 
J023057E15CCCGGGCCCACTNONE 
J023099M24CCCGGGCCCACTNONE 
J023147F14CCCGGGCCCACTNONE 
Os03g0232600AK068218TATGGGCCCACCTU box domain containing protein. 
J013114N10TATGGGCCCACCTNONE 
J013146E12TATGGGCCCACCTNONE 
J023034C23TATGGGCCCACCTNONE 
J033030J03TATGGGCCCACCTNONE 
J033050L03TATGGGCCCACCTNONE 
J033122E16TATGGGCCCACCTNONE 
J090018C20TATGGGCCCACCTNONE 
J090053P15TATGGGCCCACCTNONE 
J090096C17TATGGGCCCACCTNONE 
Os03g0244700011-100-F11CCCACGGGCCCACCTNONE 
011-100-F11GGGGCCCACTNONE 
015-065-B06CCCACGGGCCCACCTNONE 
015-065-B06GGGGCCCACTNONE 
AK100399CCCACGGGCCCACCTNONE 
AK100399GGGGCCCACTNONE 
AK100620CCCACGGGCCCACCTArmadillo-like helical domain containing protein. 
AK100620GGGGCCCACTArmadillo-like helical domain containing protein. 
J023086N09CCCACGGGCCCACCTNONE 
J023086N09GGGGCCCACTNONE 
J100032P14CCCACGGGCCCACCTNONE 
J100032P14GGGGCCCACTNONE 
Os03g0248600AK073611CGGGTGGGCCCTSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342CGGGTGGGCCCTNONE 
AK104877CGGGTGGGCCCTNONE 
J013026L10CGGGTGGGCCCTNONE 
J013055P12CGGGTGGGCCCTNONE 
J023091A14CGGGTGGGCCCTNONE 
J033034G07CGGGTGGGCCCTNONE 
J033048H19CGGGTGGGCCCTNONE 
J033128D07CGGGTGGGCCCTNONE 
J065060L24CGGGTGGGCCCTNONE 
J065176A19CGGGTGGGCCCTNONE 
J090018K08CGGGTGGGCCCTNONE 
J090023C03CGGGTGGGCCCTNONE 
Os03g0251500AK101151CAGGTGGGGGCCCACANONE 
AK119298CAGGTGGGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0255200AK058212AGGGCCCACCTGNONE 
AK058212CAGGTGGGGCCCACTCCNONE 
AK071625AGGGCCCACCTGHeat shock protein DnaJ, N-terminal domain containing protein. 
AK071625CAGGTGGGGCCCACTCCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0256400AK073854GTTTGGGCCGCAGGGCCCACAASimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0260100AK066143TGATGGGCCCACAConserved hypothetical protein. 
Os03g0266300006-027-H06TGTGGGCCCCANONE 
013-051-G08TGTGGGCCCCANONE 
014-002-C05TGTGGGCCCCANONE 
014-002-H02TGTGGGCCCCANONE 
014-005-A09TGTGGGCCCCANONE 
014-008-D02TGTGGGCCCCANONE 
014-008-G06TGTGGGCCCCANONE 
014-009-C12TGTGGGCCCCANONE 
014-010-A07TGTGGGCCCCANONE 
014-012-H03TGTGGGCCCCANONE 
014-013-E03TGTGGGCCCCANONE 
014-014-D03TGTGGGCCCCANONE 
014-028-C09TGTGGGCCCCANONE 
014-037-G05TGTGGGCCCCANONE 
014-038-E04TGTGGGCCCCANONE 
014-041-F08TGTGGGCCCCANONE 
014-049-E11TGTGGGCCCCANONE 
014-050-A05TGTGGGCCCCANONE 
014-053-F10TGTGGGCCCCANONE 
014-054-C04TGTGGGCCCCANONE 
014-056-A01TGTGGGCCCCANONE 
014-060-A08TGTGGGCCCCANONE 
014-072-C09TGTGGGCCCCANONE 
014-072-D02TGTGGGCCCCANONE 
014-077-G08TGTGGGCCCCANONE 
014-080-C10TGTGGGCCCCANONE 
014-098-E01TGTGGGCCCCANONE 
014-100-C02TGTGGGCCCCANONE 
014-100-E03TGTGGGCCCCANONE 
014-100-E10TGTGGGCCCCANONE 
015-061-D06TGTGGGCCCCANONE 
016-033-H10TGTGGGCCCCANONE 
AB110191TGTGGGCCCCANONE 
AF467729TGTGGGCCCCANONE 
AK073671TGTGGGCCCCANONE 
AK104129TGTGGGCCCCAClass I low-molecular-weight heat shock protein 17.9. 
AK119239TGTGGGCCCCANONE 
AK119616TGTGGGCCCCANONE 
AK119664TGTGGGCCCCANONE 
AK119675TGTGGGCCCCANONE 
D21285TGTGGGCCCCANONE 
J033051H23TGTGGGCCCCANONE 
J065036L24TGTGGGCCCCANONE 
J065045J20TGTGGGCCCCANONE 
J065104C03TGTGGGCCCCANONE 
J065109J20TGTGGGCCCCANONE 
J065116F24TGTGGGCCCCANONE 
J065146F06TGTGGGCCCCANONE 
J065146P18TGTGGGCCCCANONE 
J065167A09TGTGGGCCCCANONE 
J065183K12TGTGGGCCCCANONE 
J075019J15TGTGGGCCCCANONE 
J075112F10TGTGGGCCCCANONE 
J075150H04TGTGGGCCCCANONE 
J075159N20TGTGGGCCCCANONE 
J075164P19TGTGGGCCCCANONE 
J075185O05TGTGGGCCCCANONE 
J100030A19TGTGGGCCCCANONE 
J100044E07TGTGGGCCCCANONE 
Os03g0271500AK068546GCGGGCCCACCCACCGCACGCGNONE 
AK109239GCGGGCCCACCCACCGCACGCGConserved hypothetical protein. 
J013157P04GCGGGCCCACCCACCGCACGCGNONE 
J075041K23GCGGGCCCACCCACCGCACGCGNONE 
Os03g0279200009-097-C06CGGGCCCACCACNONE 
013-007-B07CGGGCCCACCACNONE 
AK121750CGGGCCCACCACSimilar to Histone H2A. 
J033087I02CGGGCCCACCACNONE 
J065002G20CGGGCCCACCACNONE 
J065102M04CGGGCCCACCACNONE 
J065139A02CGGGCCCACCACNONE 
J075109D21CGGGCCCACCACNONE 
J075191L12CGGGCCCACCACNONE 
J090096C03CGGGCCCACCACNONE 
J100036C23CGGGCCCACCACNONE 
Os03g0288400Os03g0288400GCGGGCCCACCAConserved hypothetical protein. 
Os03g0294200AK069285CCCGGGCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
AK069285CCCGTGGGCCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
AK069285GCTGGGCCCACCTSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0295800006-107-F02CACGTGGGCCCAACTNONE 
AK106050CACGTGGGCCCAACTNONE 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
011-005-H01GGGGCCCACCTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
AK069222GGGGCCCACCTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J023014L15GGGGCCCACCTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12GGGGCCCACCTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16GGGGCCCACCTNONE 
Os03g0305400009-198-D04GGTGGGGCCCACCTGTCNONE 
013-012-C06GGTGGGGCCCACCTGTCNONE 
014-034-D01GGTGGGGCCCACCTGTCNONE 
AK071397GGTGGGGCCCACCTGTCUniversal stress protein (Usp) family protein. 
J023012O22GGTGGGGCCCACCTGTCNONE 
J023097A13GGTGGGGCCCACCTGTCNONE 
J023107P16GGTGGGGCCCACCTGTCNONE 
J023113C14GGTGGGGCCCACCTGTCNONE 
Os03g0306900AK073626CACGTGGGGTCGTGGGCCCCAGTENA/THI-4 protein domain containing protein. 
J033050J24CACGTGGGGTCGTGGGCCCCAGNONE 
J075180K24CACGTGGGGTCGTGGGCCCCAGNONE 
Os03g0307000J065032I03CTGGGGCCCACGACCCCACGTGHypothetical protein. 
J065110H17CTGGGGCCCACGACCCCACGTGNONE 
J065156H13CTGGGGCCCACGACCCCACGTGNONE 
J065175P03CTGGGGCCCACGACCCCACGTGNONE 
J075007D24CTGGGGCCCACGACCCCACGTGNONE 
J100040M24CTGGGGCCCACGACCCCACGTGNONE 
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CGACACGTGGGCCCAACANONE 
J023043K04CGACACGTGGGCCCAACANONE 
J023083I20CGACACGTGGGCCCAACANONE 
J033068F22CGACACGTGGGCCCAACANONE 
J033125P21CGACACGTGGGCCCAACANONE 
J065207A22CGACACGTGGGCCCAACANONE 
J100018D20CGACACGTGGGCCCAACANONE 
J100026L17CGACACGTGGGCCCAACANONE 
J100055D14CGACACGTGGGCCCAACANONE 
J100060P03CGACACGTGGGCCCAACANONE 
J100078A20CGACACGTGGGCCCAACANONE 
Os03g0312500AK106657CCCACGTGGGCCCCASimilar to Inhibitor of apoptosis-like protein. 
AK109328CCCACGTGGGCCCCANONE 
Os03g0316200009-196-H10AGGGCCCACAANONE 
013-011-H03AGGGCCCACAANONE 
014-031-F04AGGGCCCACAANONE 
014-083-C08AGGGCCCACAANONE 
AK071812AGGGCCCACAASimilar to Galactinol synthase (Fragment). 
AK103958AGGGCCCACAANONE 
J023054E12AGGGCCCACAANONE 
J023075G21AGGGCCCACAANONE 
J023113D08AGGGCCCACAANONE 
J065067M09AGGGCCCACAANONE 
J065102E07AGGGCCCACAANONE 
J065103M07AGGGCCCACAANONE 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0327800J023133J12GGGGCCCACCCCCGCGNONE 
J065118C24GGGGCCCACCCCCGCGNONE 
J065136O13GGGGCCCACCCCCGCGNo apical meristem (NAM) protein domain containing protein. 
J065184M03GGGGCCCACCCCCGCGNONE 
J075105K14GGGGCCCACCCCCGCGNONE 
J075115E14GGGGCCCACCCCCGCGNONE 
J075166M18GGGGCCCACCCCCGCGNONE 
J075178F01GGGGCCCACCCCCGCGNONE 
J090008O14GGGGCCCACCCCCGCGNONE 
J090075F12GGGGCCCACCCCCGCGNONE 
J100019F12GGGGCCCACCCCCGCGNONE 
J100074P18GGGGCCCACCCCCGCGNONE 
J100075D15GGGGCCCACCCCCGCGNONE 
Os03g0335300AK098846GGTGGGGCCCACCCNONE 
AK098891GGTGGGGCCCACCCNONE 
AK111509GGTGGGGCCCACCCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847GGTGGGGCCCACCCNONE 
AK121413GGTGGGGCCCACCCNONE 
Os03g0337600AF119232CAAGTGGGCCCCACCNONE 
AK070859CAAGTGGGCCCCACCSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18CAAGTGGGCCCCACCNONE 
J013147M17CAAGTGGGCCCCACCNONE 
J065083M01CAAGTGGGCCCCACCNONE 
J065199H24CAAGTGGGCCCCACCNONE 
Os03g0340500012-007-F10TGTGGGGCCCACGGGTCAGTGGNONE 
AK099406TGTGGGGCCCACGGGTCAGTGGNONE 
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13TGTGGGGCCCACGGGTCAGTGGNONE 
J013063E02TGTGGGGCCCACGGGTCAGTGGNONE 
J013063I02TGTGGGGCCCACGGGTCAGTGGNONE 
J013157O07TGTGGGGCCCACGGGTCAGTGGNONE 
J023131N05TGTGGGGCCCACGGGTCAGTGGNONE 
J033033P05TGTGGGGCCCACGGGTCAGTGGNONE 
J033040N16TGTGGGGCCCACGGGTCAGTGGNONE 
J033044M19TGTGGGGCCCACGGGTCAGTGGNONE 
J033086F24TGTGGGGCCCACGGGTCAGTGGNONE 
J033097H01TGTGGGGCCCACGGGTCAGTGGNONE 
J033106C22TGTGGGGCCCACGGGTCAGTGGNONE 
J033128M13TGTGGGGCCCACGGGTCAGTGGNONE 
J033133I15TGTGGGGCCCACGGGTCAGTGGNONE 
J043027A21TGTGGGGCCCACGGGTCAGTGGNONE 
J090028A09TGTGGGGCCCACGGGTCAGTGGNONE 
J090053D06TGTGGGGCCCACGGGTCAGTGGNONE 
J090083O17TGTGGGGCCCACGGGTCAGTGGNONE 
J090099H10TGTGGGGCCCACGGGTCAGTGGNONE 
J100036M05TGTGGGGCCCACGGGTCAGTGGNONE 
Os03g0342900006-032-D01CCCGTGGGCCCCACNONE 
006-033-E10CCCGTGGGCCCCACNONE 
006-051-G06CCCGTGGGCCCCACNONE 
006-053-E05CCCGTGGGCCCCACNONE 
006-056-B05CCCGTGGGCCCCACNONE 
006-058-F04CCCGTGGGCCCCACNONE 
006-059-E05CCCGTGGGCCCCACNONE 
006-060-F10CCCGTGGGCCCCACNONE 
006-104-D12CCCGTGGGCCCCACNONE 
009-129-C12CCCGTGGGCCCCACNONE 
AK060136CCCGTGGGCCCCACNONE 
AK060980CCCGTGGGCCCCACNONE 
AK064815CCCGTGGGCCCCACDormancyauxin associated family protein. 
AK104244CCCGTGGGCCCCACNONE 
AK104391CCCGTGGGCCCCACNONE 
AK104590CCCGTGGGCCCCACNONE 
AK104744CCCGTGGGCCCCACNONE 
AK106100CCCGTGGGCCCCACNONE 
J013000E10CCCGTGGGCCCCACNONE 
J075027O22CCCGTGGGCCCCACNONE 
J075052J03CCCGTGGGCCCCACNONE 
J075066E15CCCGTGGGCCCCACNONE 
J075095C17CCCGTGGGCCCCACNONE 
J075118N05CCCGTGGGCCCCACNONE 
J075187K22CCCGTGGGCCCCACNONE 
J090026L04CCCGTGGGCCCCACNONE 
J090059G16CCCGTGGGCCCCACNONE 
J100055P20CCCGTGGGCCCCACNONE 
J100062A10CCCGTGGGCCCCACNONE 
J100068G20CCCGTGGGCCCCACNONE 
Os03g0345100AK065579CCATGGGCCCACCRad9 family protein. 
J100033H02CCATGGGCCCACCNONE 
Os03g0352800009-030-G08TGTGGGGCCCACANONE 
AK059673TGTGGGGCCCACASimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17TGTGGGGCCCACANONE 
J075050N19TGTGGGGCCCACANONE 
J075104J18TGTGGGGCCCACANONE 
J075142K05TGTGGGGCCCACANONE 
J100050I19TGTGGGGCCCACANONE 
J100057N04TGTGGGGCCCACANONE 
Os03g0370000AK100033GGTGGGGCCCACCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0373300AK107897TCGTGGGCCCCACGTCTCProtein of unknown function DUF1110 family protein. 
Os03g0374400016-027-B12GGTGGGCCCACCTNONE 
AK069719GGTGGGCCCACCTConserved hypothetical protein. 
J023020L05GGTGGGCCCACCTNONE 
J023026H16GGTGGGCCCACCTNONE 
J033025P22GGTGGGCCCACCTNONE 
J075016I21GGTGGGCCCACCTNONE 
J090015G21GGTGGGCCCACCTNONE 
Os03g0374500Os03g0374500GGTGGGCCCACCTHypothetical protein. 
Os03g0376000AK059565TGGATGGGCCCACGAemp24/gp25L/p24 family protein. 
Os03g0379300006-039-F11GACAGGTGGGCCCGTTNONE 
AK061515GACAGGTGGGCCCGTTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704GACAGGTGGGCCCGTTNONE 
J013159M16GACAGGTGGGCCCGTTNONE 
J090067F01GACAGGTGGGCCCGTTNONE 
J090083F21GACAGGTGGGCCCGTTNONE 
J100040M08GACAGGTGGGCCCGTTNONE 
J100048C03GACAGGTGGGCCCGTTNONE 
J100056M07GACAGGTGGGCCCGTTNONE 
J100062N22GACAGGTGGGCCCGTTNONE 
J100086L07GACAGGTGGGCCCGTTNONE 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
J065009K18TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
J065165P09TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
Os03g0397400AB112772CGTGTGGGCCCGGGCCCGGANONE 
AK069928CGTGTGGGCCCGGGCCCGGASimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18CGTGTGGGCCCGGGCCCGGANONE 
J023036P06CGTGTGGGCCCGGGCCCGGANONE 
J023145E24CGTGTGGGCCCGGGCCCGGANONE 
J033142I11CGTGTGGGCCCGGGCCCGGANONE 
J043003A10CGTGTGGGCCCGGGCCCGGANONE 
J075023H21CGTGTGGGCCCGGGCCCGGANONE 
J075145O10CGTGTGGGCCCGGGCCCGGANONE 
J075149A03CGTGTGGGCCCGGGCCCGGANONE 
J090099B09CGTGTGGGCCCGGGCCCGGANONE 
J100017L14CGTGTGGGCCCGGGCCCGGANONE 
J100050K18CGTGTGGGCCCGGGCCCGGANONE 
J100063P16CGTGTGGGCCCGGGCCCGGANONE 
Os03g0405000AK070839AGATGGGCCCACAReticulon family protein. 
Os03g0405100AK108624CCGTGGGCCCAACCRpsU-divergently transcribed family protein. 
Os03g0413000009-180-E02CGGGCCCACCCNONE 
009-188-B06CGGGCCCACCCNONE 
AK060225CGGGCCCACCCNONE 
AY062181CGGGCCCACCCSimilar to Potential histone-like transcription factor. 
Os03g0415500AK108435TGGTGGGCCCTGGCCCATCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12TGGTGGGCCCTGGCCCATCANONE 
Os03g0578200003-117-B07TCGTGGGCCCAAGNONE 
009-175-C06TCGTGGGCCCAAGNONE 
009-179-H05TCGTGGGCCCAAGNONE 
013-078-G11TCGTGGGCCCAAGNONE 
AK062224TCGTGGGCCCAAGNONE 
AK120432TCGTGGGCCCAAGConserved hypothetical protein. 
J013096L16TCGTGGGCCCAAGNONE 
J100042G12TCGTGGGCCCAAGNONE 
J100069F04TCGTGGGCCCAAGNONE 
J100073H14TCGTGGGCCCAAGNONE 
Os03g0581600J065037H09GGTCCACGTGGGCCCCACACNONE 
J065183O12GGTCCACGTGGGCCCCACACNONE 
Os03g0586300AK100442CAAGTGGGCCCCReticulon family protein. 
AK100442CAGGTGGGCCCCReticulon family protein. 
J023031G06CAAGTGGGCCCCNONE 
J023031G06CAGGTGGGCCCCNONE 
J023089N19CAAGTGGGCCCCNONE 
J023089N19CAGGTGGGCCCCNONE 
J023099N13CAAGTGGGCCCCNONE 
J023099N13CAGGTGGGCCCCNONE 
J065026N17CAAGTGGGCCCCNONE 
J065026N17CAGGTGGGCCCCNONE 
J065045N16CAAGTGGGCCCCNONE 
J065045N16CAGGTGGGCCCCNONE 
J065163L12CAAGTGGGCCCCNONE 
J065163L12CAGGTGGGCCCCNONE 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0633900AK059181ACGTGGGCCCCACASingle-strand binding protein family protein. 
AK068169ACGTGGGCCCCACANONE 
Os03g0643300AK099445AGTGGGCCCCACCACSimilar to AER123Wp. 
AK099445CAAGTGGGCCCAGASimilar to AER123Wp. 
AK108010AGTGGGCCCCACCACNONE 
AK108010CAAGTGGGCCCAGANONE 
Os03g0666200AK102364GCGGGCCCACTCTPleckstrin homology-type domain containing protein. 
J033097E16GCGGGCCCACTCTNONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0669200J013037D23CAGGTGGGCCCCACANONE 
J023026K09CAGGTGGGCCCCACANONE 
J075008E21CAGGTGGGCCCCACANONE 
J075061B21CAGGTGGGCCCCACANONE 
J075151B13CAGGTGGGCCCCACANONE 
J075195L02CAGGTGGGCCCCACANONE 
J090061B07CAGGTGGGCCCCACANONE 
Os03g0670200011-069-G05TGTGGGCCCCACCGATCCGNONE 
AK069553TGTGGGCCCCACCGATCCGSimilar to YJR013Wp (Fragment). 
J023020O11TGTGGGCCCCACCGATCCGNONE 
J023114J22TGTGGGCCCCACCGATCCGNONE 
J100084F17TGTGGGCCCCACCGATCCGNONE 
J100087A11TGTGGGCCCCACCGATCCGNONE 
Os03g0701000J075172J23CCCGGGCCCACCCGNONE 
Os03g0712600015-008-G03TGGTGGGCCCAGANONE 
AK103705TGGTGGGCCCAGAHypothetical protein. 
J033136N14TGGTGGGCCCAGANONE 
Os03g0713100J013039M09CCCACTCCCTGGGGCCCACCTGNONE 
J023007K01CCCACTCCCTGGGGCCCACCTGNONE 
J023073H01CCCACTCCCTGGGGCCCACCTGNONE 
J023087M20CCCACTCCCTGGGGCCCACCTGNONE 
J023142E01CCCACTCCCTGGGGCCCACCTGNONE 
J033048E03CCCACTCCCTGGGGCCCACCTGNONE 
J033048F03CCCACTCCCTGGGGCCCACCTGSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11CCCACTCCCTGGGGCCCACCTGNONE 
J033074M20CCCACTCCCTGGGGCCCACCTGNONE 
J033084M11CCCACTCCCTGGGGCCCACCTGNONE 
J033091I23CCCACTCCCTGGGGCCCACCTGNONE 
J033100C08CCCACTCCCTGGGGCCCACCTGNONE 
J033123K19CCCACTCCCTGGGGCCCACCTGNONE 
J090006P21CCCACTCCCTGGGGCCCACCTGNONE 
J090045O16CCCACTCCCTGGGGCCCACCTGNONE 
J100087M13CCCACTCCCTGGGGCCCACCTGNONE 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
Os03g0735200011-051-E04TGTGGGCCCACAANONE 
AK063345TGTGGGCCCACAATetratricopeptide-like helical domain containing protein. 
Os03g0741400AK121838CTGGGGCCCACTSimilar to SUSIBA2. 
J100032E12CTGGGGCCCACTNONE 
Os03g0746800AK101718GGTGGGCCCAACWD-40 repeat containing protein. 
Os03g0756800009-100-H11CCGTGGGCCGGTGGGCCCGNONE 
009-100-H11GGTGGGCCCTNONE 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
AK120423GGTGGGCCCTProtein of unknown function UPF0139 family protein. 
J013095D02CCGTGGGCCGGTGGGCCCGNONE 
J013095D02GGTGGGCCCTNONE 
J023091G12CCGTGGGCCGGTGGGCCCGNONE 
J023091G12GGTGGGCCCTNONE 
J065207J17CCGTGGGCCGGTGGGCCCGNONE 
J065207J17GGTGGGCCCTNONE 
J100067G13CCGTGGGCCGGTGGGCCCGNONE 
J100067G13GGTGGGCCCTNONE 
J100089L11CCGTGGGCCGGTGGGCCCGNONE 
J100089L11GGTGGGCCCTNONE 
Os03g0758500016-015-D02CACGTGGGCCCCNONE 
AK059403CACGTGGGCCCCNONE 
AK102002CACGTGGGCCCCPlastocyanin-like domain containing protein. 
J033079N03CACGTGGGCCCCNONE 
J065012M05CACGTGGGCCCCNONE 
J065045H19CACGTGGGCCCCNONE 
J065050J08CACGTGGGCCCCNONE 
J075189D02CACGTGGGCCCCNONE 
J090018L03CACGTGGGCCCCNONE 
J100043O22CACGTGGGCCCCNONE 
J100088G17CACGTGGGCCCCNONE 
Os03g0758800AJ252135GCCGTTGGGTGGGCCCCACGTNONE 
AJ312906GCCGTTGGGTGGGCCCCACGTNONE 
AK060387GCCGTTGGGTGGGCCCCACGTSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592GCCGTTGGGTGGGCCCCACGTNONE 
J023109G09GCCGTTGGGTGGGCCCCACGTNONE 
J033038B14GCCGTTGGGTGGGCCCCACGTNONE 
J043013C09GCCGTTGGGTGGGCCCCACGTNONE 
J053096E21GCCGTTGGGTGGGCCCCACGTNONE 
J065026B08GCCGTTGGGTGGGCCCCACGTNONE 
J065062B16GCCGTTGGGTGGGCCCCACGTNONE 
J065066E03GCCGTTGGGTGGGCCCCACGTNONE 
J065091J12GCCGTTGGGTGGGCCCCACGTNONE 
J065164A06GCCGTTGGGTGGGCCCCACGTNONE 
J075014I20GCCGTTGGGTGGGCCCCACGTNONE 
J075117N07GCCGTTGGGTGGGCCCCACGTNONE 
J075142M03GCCGTTGGGTGGGCCCCACGTNONE 
J075175D04GCCGTTGGGTGGGCCCCACGTNONE 
J075188M01GCCGTTGGGTGGGCCCCACGTNONE 
J075199I20GCCGTTGGGTGGGCCCCACGTNONE 
J090010J12GCCGTTGGGTGGGCCCCACGTNONE 
J090025O16GCCGTTGGGTGGGCCCCACGTNONE 
J090041H05GCCGTTGGGTGGGCCCCACGTNONE 
J090078P07GCCGTTGGGTGGGCCCCACGTNONE 
J100031K10GCCGTTGGGTGGGCCCCACGTNONE 
J100055F23GCCGTTGGGTGGGCCCCACGTNONE 
J100064G05GCCGTTGGGTGGGCCCCACGTNONE 
J100080C24GCCGTTGGGTGGGCCCCACGTNONE 
J100080O07GCCGTTGGGTGGGCCCCACGTNONE 
J100090F01GCCGTTGGGTGGGCCCCACGTNONE 
Os03g0780400011-100-D09AGGGCCCACANONE 
AK061347AGGGCCCACANONE 
AK073162AGGGCCCACASimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22AGGGCCCACANONE 
J065045I07AGGGCCCACANONE 
J090036F17AGGGCCCACANONE 
J090077M14AGGGCCCACANONE 
J100055G20AGGGCCCACANONE 
Os03g0780600AK120180CAGGTGGGCCCCNONE 
AK120180CCCGTGGGCCCCACGTNONE 
D13224CAGGTGGGCCCCTubulin beta-1 chain (Beta-1 tubulin). 
D13224CCCGTGGGCCCCACGTTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18CAGGTGGGCCCCNONE 
J013033M18CCCGTGGGCCCCACGTNONE 
J033022G05CAGGTGGGCCCCNONE 
J033022G05CCCGTGGGCCCCACGTNONE 
J033028A16CAGGTGGGCCCCNONE 
J033028A16CCCGTGGGCCCCACGTNONE 
J033050M08CAGGTGGGCCCCNONE 
J033050M08CCCGTGGGCCCCACGTNONE 
J090053F04CAGGTGGGCCCCNONE 
J090053F04CCCGTGGGCCCCACGTNONE 
J090064E19CAGGTGGGCCCCNONE 
J090064E19CCCGTGGGCCCCACGTNONE 
J090083J24CAGGTGGGCCCCNONE 
J090083J24CCCGTGGGCCCCACGTNONE 
J100024I23CAGGTGGGCCCCNONE 
J100024I23CCCGTGGGCCCCACGTNONE 
Os03g0780800AK059874GGCCCGGGCCCACCACNONE 
AK103085GGCCCGGGCCCACCACFatty acid hydroxylase domain containing protein. 
J065214L21GGCCCGGGCCCACCACNONE 
J075178I24GGCCCGGGCCCACCACNONE 
J075197K14GGCCCGGGCCCACCACNONE 
Os03g0784500AK109744ACAGGTGGGGCCCACAANONE 
AK109744GGTGGGCCCCACCACNONE 
Os03g0788800AK071670CAGGTGGGCCCCZinc finger, RING-type domain containing protein. 
AK071670GTGGGGCCCACGCZinc finger, RING-type domain containing protein. 
J013090J22CAGGTGGGCCCCNONE 
J013090J22GTGGGGCCCACGCNONE 
J023050M06CAGGTGGGCCCCNONE 
J023050M06GTGGGGCCCACGCNONE 
J023073A12CAGGTGGGCCCCNONE 
J023073A12GTGGGGCCCACGCNONE 
J023075P21CAGGTGGGCCCCNONE 
J023075P21GTGGGGCCCACGCNONE 
J023106F04CAGGTGGGCCCCNONE 
J023106F04GTGGGGCCCACGCNONE 
J075181H19CAGGTGGGCCCCNONE 
J075181H19GTGGGGCCCACGCNONE 
J090009C24CAGGTGGGCCCCNONE 
J090009C24GTGGGGCCCACGCNONE 
J100027L24CAGGTGGGCCCCNONE 
J100027L24GTGGGGCCCACGCNONE 
J100055F06CAGGTGGGCCCCNONE 
J100055F06GTGGGGCCCACGCNONE 
J100081C22CAGGTGGGCCCCNONE 
J100081C22GTGGGGCCCACGCNONE 
J100084I21CAGGTGGGCCCCNONE 
J100084I21GTGGGGCCCACGCNONE 
Os03g0789200015-015-H03CCCGGGCCCACCANONE 
AK071787CCCGGGCCCACCAProtein of unknown function DUF593 family protein. 
AY224542CCCGGGCCCACCANONE 
J023110P10CCCGGGCCCACCANONE 
J075039H19CCCGGGCCCACCANONE 
Os03g0791800013-037-A12GACAGGTGGGCCCATGGNONE 
AB079798GACAGGTGGGCCCATGGNONE 
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein). 
AK120251GACAGGTGGGCCCATGGNONE 
J013045G10GACAGGTGGGCCCATGGNONE 
J023102B18GACAGGTGGGCCCATGGNONE 
J065020J23GACAGGTGGGCCCATGGNONE 
J065127I21GACAGGTGGGCCCATGGNONE 
J065151E11GACAGGTGGGCCCATGGNONE 
J075076B05GACAGGTGGGCCCATGGNONE 
J075116C15GACAGGTGGGCCCATGGNONE 
J075136A07GACAGGTGGGCCCATGGNONE 
J100029G21GACAGGTGGGCCCATGGNONE 
J100030K01GACAGGTGGGCCCATGGNONE 
J100041J02GACAGGTGGGCCCATGGNONE 
J100049C22GACAGGTGGGCCCATGGNONE 
J100057G17GACAGGTGGGCCCATGGNONE 
J100086L12GACAGGTGGGCCCATGGNONE 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
J033125G24GTGGGACCCACGTGGGCCCCACANONE 
J065132N21GTGGGACCCACGTGGGCCCCACANONE 
Os03g0796600003-113-D10TCGTGGGCCCCACCNONE 
011-076-B12TCGTGGGCCCCACCNONE 
AK105257TCGTGGGCCCCACCProtein of unknown function DUF506, plant family protein. 
J075105C03TCGTGGGCCCCACCNONE 
J080036O17TCGTGGGCCCCACCNONE 
J080064E16TCGTGGGCCCCACCNONE 
J080069E03TCGTGGGCCCCACCNONE 
J080079E23TCGTGGGCCCCACCNONE 
J090036H20TCGTGGGCCCCACCNONE 
J100029L10TCGTGGGCCCCACCNONE 
J100055G09TCGTGGGCCCCACCNONE 
Os03g0796800J065024O22CACGTGGGCCCCATCCAConserved hypothetical protein. 
J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein. 
J065024O22TGTGGGCCCGCConserved hypothetical protein. 
Os03g0799100AK058959ACACGTGGGCCCTNONE 
AK102772ACACGTGGGCCCTSimilar to WAVE-DAMPENED2. 
J023093D03ACACGTGGGCCCTNONE 
J033099D22ACACGTGGGCCCTNONE 
J090054G18ACACGTGGGCCCTNONE 
J100031H24ACACGTGGGCCCTNONE 
J100065H09ACACGTGGGCCCTNONE 
J100082G10ACACGTGGGCCCTNONE 
Os03g0800500006-075-C12GGTGGGCCCACACNONE 
AK061104GGTGGGCCCACACNONE 
AK070229GGTGGGCCCACACPutative small multi-drug export family protein. 
J065152L13GGTGGGCCCACACNONE 
Os03g0808100AK069196CAGGTGGGCCCCACCSimilar to Cellulose synthase-5. 
J013059D03CAGGTGGGCCCCACCNONE 
J013099J05CAGGTGGGCCCCACCNONE 
J013106M06CAGGTGGGCCCCACCNONE 
J013151H03CAGGTGGGCCCCACCNONE 
J023003G18CAGGTGGGCCCCACCNONE 
J023038M11CAGGTGGGCCCCACCNONE 
J023056M17CAGGTGGGCCCCACCNONE 
J023105F22CAGGTGGGCCCCACCNONE 
J033023F17CAGGTGGGCCCCACCNONE 
J033028J21CAGGTGGGCCCCACCNONE 
J033131J19CAGGTGGGCCCCACCNONE 
J033132E06CAGGTGGGCCCCACCNONE 
J090007L14CAGGTGGGCCCCACCNONE 
J090011H02CAGGTGGGCCCCACCNONE 
J090026D20CAGGTGGGCCCCACCNONE 
J090029H09CAGGTGGGCCCCACCNONE 
J090033B18CAGGTGGGCCCCACCNONE 
J090039J02CAGGTGGGCCCCACCNONE 
J090050D17CAGGTGGGCCCCACCNONE 
J090050I15CAGGTGGGCCCCACCNONE 
J090063G20CAGGTGGGCCCCACCNONE 
J090064J21CAGGTGGGCCCCACCNONE 
J090071E19CAGGTGGGCCCCACCNONE 
J090075F10CAGGTGGGCCCCACCNONE 
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein. 
Os03g0811600009-134-B07TGTGGGCCCCACATGTCAGTGNONE 
AK071076TGTGGGCCCCACATGTCAGTGSimilar to Peptidyl prolyl isomerase H. 
J023078H22TGTGGGCCCCACATGTCAGTGNONE 
Os03g0819400009-131-F02TGTGGGCCCTNONE 
AK070263TGTGGGCCCTHeavy metal transport/detoxification protein domain containing protein. 
J023043H06TGTGGGCCCTNONE 
J033097J18TGTGGGCCCTNONE 
J033133G11TGTGGGCCCTNONE 
J065037K10TGTGGGCCCTNONE 
J065200J12TGTGGGCCCTNONE 
J075172I11TGTGGGCCCTNONE 
J100082F10TGTGGGCCCTNONE 
Os03g0822700005-010-E01AGGTGGGCCCAATNONE 
005-010-E01TCCGGGCCCACCANONE 
006-088-H12AGGTGGGCCCAATNONE 
006-088-H12TCCGGGCCCACCANONE 
AK061682AGGTGGGCCCAATNONE 
AK061682TCCGGGCCCACCANONE 
AK101448AGGTGGGCCCAATArmadillo-like helical domain containing protein. 
AK101448TCCGGGCCCACCAArmadillo-like helical domain containing protein. 
J023091N05AGGTGGGCCCAATNONE 
J023091N05TCCGGGCCCACCANONE 
Os03g0825900AK109694AGTTGGGCCCACAConserved hypothetical protein. 
Os03g0832600AK120137GGTGGGCCCCACASimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0833700011-060-A10GTGTGGGCCCACAGCCCAGCNONE 
AK121918GTGTGGGCCCACAGCCCAGCRNA 3'-terminal phosphate cyclase family protein. 
Os03g0836200009-165-F07GGGTGGGCCCCACCTGNONE 
015-092-G01GGGTGGGCCCCACCTGNONE 
AK058443GGGTGGGCCCCACCTGNONE 
AK067084GGGTGGGCCCCACCTGSimilar to RNA-binding protein RZ-1. 
AK101225GGGTGGGCCCCACCTGNONE 
J013092A03GGGTGGGCCCCACCTGNONE 
J013095N17GGGTGGGCCCCACCTGNONE 
J013147J18GGGTGGGCCCCACCTGNONE 
J023019O10GGGTGGGCCCCACCTGNONE 
J023065N18GGGTGGGCCCCACCTGNONE 
J033113E18GGGTGGGCCCCACCTGNONE 
J033133E03GGGTGGGCCCCACCTGNONE 
J065059J15GGGTGGGCCCCACCTGNONE 
J065075O11GGGTGGGCCCCACCTGNONE 
J065119I07GGGTGGGCCCCACCTGNONE 
J065171J03GGGTGGGCCCCACCTGNONE 
J090016D21GGGTGGGCCCCACCTGNONE 
J090081O03GGGTGGGCCCCACCTGNONE 
J100040G18GGGTGGGCCCCACCTGNONE 
J100040L10GGGTGGGCCCCACCTGNONE 
J100055H13GGGTGGGCCCCACCTGNONE 
J100059I22GGGTGGGCCCCACCTGNONE 
J100078A08GGGTGGGCCCCACCTGNONE 
Os03g0837900AK068346ACCGGGCCCACACStreptomyces cyclase/dehydrase family protein. 
Os03g0850100AK101126ACGTGGGGCCCACCTGNLI interacting factor domain containing protein. 
Os03g0854000009-186-C03GCGGGCCCACCTNONE 
009-186-C03GGCTGGGCCCACGCGNONE 
AK061374GCGGGCCCACCTProtein of unknown function UPF0131 family protein. 
AK061374GGCTGGGCCCACGCGProtein of unknown function UPF0131 family protein. 
J065138B11GCGGGCCCACCTNONE 
J065138B11GGCTGGGCCCACGCGNONE 
Os03g0859500AK070637AGGTGGGCCCTABC transporter related domain containing protein. 
J023056J01AGGTGGGCCCTNONE 
J043003A05AGGTGGGCCCTNONE 
J065021L12AGGTGGGCCCTNONE 
J065022K11AGGTGGGCCCTNONE 
J065215B13AGGTGGGCCCTNONE 
J075025N20AGGTGGGCCCTNONE 
J075090B03AGGTGGGCCCTNONE 
J075090B04AGGTGGGCCCTNONE 
J075118C07AGGTGGGCCCTNONE 
J090026E21AGGTGGGCCCTNONE 
J090085D18AGGTGGGCCCTNONE 
J100028H06AGGTGGGCCCTNONE 
J100051L23AGGTGGGCCCTNONE 
J100052G02AGGTGGGCCCTNONE 
J100061O13AGGTGGGCCCTNONE 
Os04g0126800AK107895CCCGGGCCCACGGGHypothetical protein. 
Os04g0175000AK101746AGGGCCCACAConserved hypothetical protein. 
Os04g0231800AK068417CCTGGGCCCACANONE 
J013153L19CCTGGGCCCACANONE 
J065020J04CCTGGGCCCACANONE 
J065201K08CCTGGGCCCACANONE 
J065214C10CCTGGGCCCACANONE 
Os04g0244800009-066-G06CGTGTGGGCCCCANONE 
011-024-D02CGTGTGGGCCCCANONE 
AK121488CGTGTGGGCCCCAHeavy metal transport/detoxification protein domain containing protein. 
J023095P14CGTGTGGGCCCCANONE 
J023150J09CGTGTGGGCCCCANONE 
J053097G24CGTGTGGGCCCCANONE 
J065001K24CGTGTGGGCCCCANONE 
J065009O13CGTGTGGGCCCCANONE 
J065076M12CGTGTGGGCCCCANONE 
J065081I15CGTGTGGGCCCCANONE 
J065105E10CGTGTGGGCCCCANONE 
J065106G04CGTGTGGGCCCCANONE 
J065123I12CGTGTGGGCCCCANONE 
J065137H16CGTGTGGGCCCCANONE 
J065151I11CGTGTGGGCCCCANONE 
J065164H06CGTGTGGGCCCCANONE 
J065173J07CGTGTGGGCCCCANONE 
J065196F02CGTGTGGGCCCCANONE 
J065198I17CGTGTGGGCCCCANONE 
J065206I11CGTGTGGGCCCCANONE 
J065216J02CGTGTGGGCCCCANONE 
J075076D10CGTGTGGGCCCCANONE 
J075098F06CGTGTGGGCCCCANONE 
J075115A20CGTGTGGGCCCCANONE 
J075184H05CGTGTGGGCCCCANONE 
J075193E17CGTGTGGGCCCCANONE 
J090014L09CGTGTGGGCCCCANONE 
J090015H16CGTGTGGGCCCCANONE 
J090024M04CGTGTGGGCCCCANONE 
J090062K08CGTGTGGGCCCCANONE 
J090082I08CGTGTGGGCCCCANONE 
Os04g0266400AK065632GTGGTGGGCCCCACCACNONE 
AK068202GTGGTGGGCCCCACCACSimilar to AHM2 (Fragment). 
AK072046GTGGTGGGCCCCACCACNONE 
AK105688GTGGTGGGCCCCACCACNONE 
Os04g0266900011-064-A07CTGGGGCCCACCNONE 
AK069447CTGGGGCCCACCBacterial transketolase family protein. 
J023019B19CTGGGGCCCACCNONE 
Os04g0321700003-103-G02AGTGGGCCCCACCNONE 
AK068732AGTGGGCCCCACCSimilar to Serine carboxypeptidase I precursor (EC 3.4.16.5) (Carboxypeptidase C). 
AK099397AGTGGGCCCCACCNONE 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0367400006-079-G12AGGGCCCACCTGTCAGNONE 
AK061121AGGGCCCACCTGTCAGReticulon family protein. 
AK100139AGGGCCCACCTGTCAGNONE 
J065009F13AGGGCCCACCTGTCAGNONE 
J065032N11AGGGCCCACCTGTCAGNONE 
J065039P10AGGGCCCACCTGTCAGNONE 
J065124I05AGGGCCCACCTGTCAGNONE 
J065197E16AGGGCCCACCTGTCAGNONE 
Os04g0372700009-110-D07GCGTGGGCCCACGCCACACGACGCGTCCNONE 
AK062814GCGTGGGCCCACGCCACACGACGCGTCCSimilar to Quinone-oxidoreductase QR1 (Fragment). 
J065021E21GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065099E23GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065120F10GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065165P14GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065208L18GCGTGGGCCCACGCCACACGACGCGTCCNONE 
Os04g0382300AK071912AGTGGGCCCCACGNONE 
AK101795AGTGGGCCCCACGSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0387600009-148-E01CCCGTGGGGCCCACGCNONE 
009-148-E01GTGGGGGCCCACTCTNONE 
009-155-A11CCCGTGGGGCCCACGCNONE 
009-155-A11GTGGGGGCCCACTCTNONE 
009-175-F04CCCGTGGGGCCCACGCNONE 
009-175-F04GTGGGGGCCCACTCTNONE 
AK063862CCCGTGGGGCCCACGCConserved hypothetical protein. 
AK063862GTGGGGGCCCACTCTConserved hypothetical protein. 
J065035F12CCCGTGGGGCCCACGCNONE 
J065035F12GTGGGGGCCCACTCTNONE 
J065162C13CCCGTGGGGCCCACGCNONE 
J065162C13GTGGGGGCCCACTCTNONE 
J065169L19CCCGTGGGGCCCACGCNONE 
J065169L19GTGGGGGCCCACTCTNONE 
Os04g0390000AK067777TGTGGGCCCCCACNONE 
AK068713TGTGGGCCCCCACNONE 
AK098921TGTGGGCCCCCACSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit. 
AK104832CACTGACAGGTGGGCCCACCANONE 
AK121002CACTGACAGGTGGGCCCACCANONE 
J033092H19CACTGACAGGTGGGCCCACCANONE 
Os04g0408900009-183-E05TGTGGGGCCCACANONE 
AK058627TGTGGGGCCCACASimilar to DNA-binding protein S1FA. 
J023014N01TGTGGGGCCCACANONE 
J023088K23TGTGGGGCCCACANONE 
J065086B17TGTGGGGCCCACANONE 
J065095F08TGTGGGGCCCACANONE 
J065119N11TGTGGGGCCCACANONE 
J100032H17TGTGGGGCCCACANONE 
Os04g0412900AK073418TGTGGGCCCCACCACSec23/Sec24 trunk region domain containing protein. 
J033027C24TGTGGGCCCCACCACNONE 
J033044C16TGTGGGCCCCACCACNONE 
J090023G03TGTGGGCCCCACCACNONE 
J090082C21TGTGGGCCCCACCACNONE 
Os04g0435700AK100857CCCACCCGGGCCCACCCGSimilar to UVB-resistance protein UVR8. 
Os04g0440100AK101324GCTGGGCCCACTCTNONE 
AK105415GCTGGGCCCACTCTNonsense-mediated decay UPF3 domain containing protein. 
Os04g0456700009-080-F10CAGGTGGGCCCCACCCGNONE 
009-143-C10CAGGTGGGCCCCACCCGNONE 
AK065178CAGGTGGGCCCCACCCGSimilar to TMV induced protein 1-2. 
J013002D12CAGGTGGGCCCCACCCGNONE 
J065027N14CAGGTGGGCCCCACCCGNONE 
J065139E16CAGGTGGGCCCCACCCGNONE 
J065165D09CAGGTGGGCCCCACCCGNONE 
J065179D14CAGGTGGGCCCCACCCGNONE 
J065198C03CAGGTGGGCCCCACCCGNONE 
J065198L22CAGGTGGGCCCCACCCGNONE 
J075139M08CAGGTGGGCCCCACCCGNONE 
J075150D14CAGGTGGGCCCCACCCGNONE 
J075172F01CAGGTGGGCCCCACCCGNONE 
J075197F03CAGGTGGGCCCCACCCGNONE 
J090059E16CAGGTGGGCCCCACCCGNONE 
J100063J01CAGGTGGGCCCCACCCGNONE 
J100085F13CAGGTGGGCCCCACCCGNONE 
J100088O10CAGGTGGGCCCCACCCGNONE 
Os04g0462500006-073-E08TGTGGGCCCCACCNONE 
AK062065TGTGGGCCCCACCNONE 
AK071311TGTGGGCCCCACCSimilar to 14-3-3-like protein GF14-6. 
AK071822TGTGGGCCCCACCNONE 
AK099243TGTGGGCCCCACCNONE 
AK101938TGTGGGCCCCACCNONE 
J013056F02TGTGGGCCCCACCNONE 
J023020E08TGTGGGCCCCACCNONE 
J023085B16TGTGGGCCCCACCNONE 
J023117D08TGTGGGCCCCACCNONE 
J023133K12TGTGGGCCCCACCNONE 
J033025G04TGTGGGCCCCACCNONE 
J033052A15TGTGGGCCCCACCNONE 
J033074G16TGTGGGCCCCACCNONE 
J033090A16TGTGGGCCCCACCNONE 
J033122A07TGTGGGCCCCACCNONE 
J033133G09TGTGGGCCCCACCNONE 
J065002F16TGTGGGCCCCACCNONE 
J065030M09TGTGGGCCCCACCNONE 
J065056B11TGTGGGCCCCACCNONE 
J065115I10TGTGGGCCCCACCNONE 
J065120O09TGTGGGCCCCACCNONE 
J065124G21TGTGGGCCCCACCNONE 
J075031C14TGTGGGCCCCACCNONE 
J075040H07TGTGGGCCCCACCNONE 
J075047F04TGTGGGCCCCACCNONE 
J075065F14TGTGGGCCCCACCNONE 
J075066G20TGTGGGCCCCACCNONE 
J075105D01TGTGGGCCCCACCNONE 
J075147B04TGTGGGCCCCACCNONE 
J075149A12TGTGGGCCCCACCNONE 
J075172D07TGTGGGCCCCACCNONE 
J075190J11TGTGGGCCCCACCNONE 
J090038H18TGTGGGCCCCACCNONE 
J090087G05TGTGGGCCCCACCNONE 
J100025A10TGTGGGCCCCACCNONE 
J100025O10TGTGGGCCCCACCNONE 
J100027D02TGTGGGCCCCACCNONE 
J100027P06TGTGGGCCCCACCNONE 
J100032K04TGTGGGCCCCACCNONE 
J100056D21TGTGGGCCCCACCNONE 
J100060J08TGTGGGCCCCACCNONE 
J100063N19TGTGGGCCCCACCNONE 
J100064C14TGTGGGCCCCACCNONE 
J100064K18TGTGGGCCCCACCNONE 
J100070L21TGTGGGCCCCACCNONE 
J100072M17TGTGGGCCCCACCNONE 
J100074F21TGTGGGCCCCACCNONE 
J100087E05TGTGGGCCCCACCNONE 
U65956TGTGGGCCCCACCNONE 
Os04g0463400AK059730AGGGCCCACCAProtein of unknown function DUF125, transmembrane family protein. 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0482300015-088-C07GGTGGGCCCAAACNONE 
AK064143GGTGGGCCCAAACBTB domain containing protein. 
J065053L16GGTGGGCCCAAACNONE 
J065053N15GGTGGGCCCAAACNONE 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
J065141K24CCACTGACAGGTGGGCCCGCNONE 
J065144O22CCACTGACAGGTGGGCCCGCNONE 
J065162F11CCACTGACAGGTGGGCCCGCNONE 
Os04g0503500AK099404CGGGCCCACAALeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CGGGCCCACAANONE 
Os04g0506300AK063591TCGTGGGCCCCACCCGTMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08TCGTGGGCCCCACCCGNONE 
Os04g0509600012-081-D04GGTGGGCCCCNONE 
AF001505GGTGGGCCCCNONE 
AK073718GGTGGGCCCCSimilar to Ammonium transporter Amt1;2 (Fragment). 
AK105667GGTGGGCCCCNONE 
AY569614GGTGGGCCCCNONE 
J033060L01GGTGGGCCCCNONE 
Os04g0512500AK107826TGGTGGGCCCCACCConserved hypothetical protein. 
J100049D17TGGTGGGCCCCACCNONE 
J100080K12TGGTGGGCCCCACCNONE 
Os04g0559400AK106376CCTGGGCCCACGCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
Os04g0577500006-039-C03TCTGGGCCCACGANONE 
006-043-H01TCTGGGCCCACGANONE 
AK061538TCTGGGCCCACGANONE 
AK065648TCTGGGCCCACGATatD-related deoxyribonuclease family protein. 
AK104763TCTGGGCCCACGANONE 
J013035E21TCTGGGCCCACGANONE 
J013066M11TCTGGGCCCACGANONE 
J100026B02TCTGGGCCCACGANONE 
Os04g0585100012-055-B08GTGGGGCCCACCNONE 
AK105286GTGGGGCCCACCZinc finger, DHHC-type domain containing protein. 
Os04g0589600011-100-F04CAAGTGGGCCCACCNONE 
AK061833CAAGTGGGCCCACCGlycosyl transferase, group 1 domain containing protein. 
AK098964CAAGTGGGCCCACCNONE 
AK100053CAAGTGGGCCCACCNONE 
Os04g0602800AK100925TATGGGCCCACASimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0606800009-159-H11AGATGGGCCCACATGTCAGTGNONE 
009-159-H11GTGGGGCCCACAAGTCAGTGGNONE 
AK072824AGATGGGCCCACATGTCAGTGConserved hypothetical protein. 
AK072824GTGGGGCCCACAAGTCAGTGGConserved hypothetical protein. 
J033070J06AGATGGGCCCACATGTCAGTGNONE 
J033070J06GTGGGGCCCACAAGTCAGTGGNONE 
J033119D03AGATGGGCCCACATGTCAGTGNONE 
J033119D03GTGGGGCCCACAAGTCAGTGGNONE 
J100043F05AGATGGGCCCACATGTCAGTGNONE 
J100043F05GTGGGGCCCACAAGTCAGTGGNONE 
J100050A01AGATGGGCCCACATGTCAGTGNONE 
J100050A01GTGGGGCCCACAAGTCAGTGGNONE 
Os04g0608300AK111353AGGTGGGCCCCACACGalactokinase family protein. 
Os04g0612600AB042115AAGGCCCAAACAATGGGCCCACCTNONE 
AB042115TCCGACGGGCCCACCTNONE 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK060707TCCGACGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008AAGGCCCAAACAATGGGCCCACCTNONE 
AK099008TCCGACGGGCCCACCTNONE 
AK104427AAGGCCCAAACAATGGGCCCACCTNONE 
AK104427TCCGACGGGCCCACCTNONE 
J023043H02AAGGCCCAAACAATGGGCCCACCTNONE 
J023043H02TCCGACGGGCCCACCTNONE 
J033033I23AAGGCCCAAACAATGGGCCCACCTNONE 
J033033I23TCCGACGGGCCCACCTNONE 
J033067P21AAGGCCCAAACAATGGGCCCACCTNONE 
J033067P21TCCGACGGGCCCACCTNONE 
J033088M21AAGGCCCAAACAATGGGCCCACCTNONE 
J033088M21TCCGACGGGCCCACCTNONE 
J033133M08AAGGCCCAAACAATGGGCCCACCTNONE 
J033133M08TCCGACGGGCCCACCTNONE 
J043030I16AAGGCCCAAACAATGGGCCCACCTNONE 
J043030I16TCCGACGGGCCCACCTNONE 
J075049H08AAGGCCCAAACAATGGGCCCACCTNONE 
J075049H08TCCGACGGGCCCACCTNONE 
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
AK071125GTGGGGCCCACGGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03AGCCGTTGGGCCCACCTGTCAGNONE 
J023082K03GTGGGGCCCACGGNONE 
J075142E01AGCCGTTGGGCCCACCTGTCAGNONE 
J075142E01GTGGGGCCCACGGNONE 
Os04g0653100014-075-B07GGGGCCCACCCNONE 
016-077-E05GGGGCCCACCCNONE 
AK067094GGGGCCCACCCProtein of unknown function UPF0136, Transmembrane family protein. 
AK111420GGGGCCCACCCNONE 
J013098P05GGGGCCCACCCNONE 
J075001K22GGGGCCCACCCNONE 
J075198O04GGGGCCCACCCNONE 
Os04g0660600009-113-A11ACATGGGCCCACTTGNONE 
009-113-A11TTGTGGGCCCAAACNONE 
AK120899ACATGGGCCCACTTGATPase, V0 complex, subunit H family protein. 
AK120899TTGTGGGCCCAAACATPase, V0 complex, subunit H family protein. 
J023030J05ACATGGGCCCACTTGNONE 
J023030J05TTGTGGGCCCAAACNONE 
J065068M07ACATGGGCCCACTTGNONE 
J065068M07TTGTGGGCCCAAACNONE 
J065120G22ACATGGGCCCACTTGNONE 
J065120G22TTGTGGGCCCAAACNONE 
J065168J18ACATGGGCCCACTTGNONE 
J065168J18TTGTGGGCCCAAACNONE 
J065211M10ACATGGGCCCACTTGNONE 
J065211M10TTGTGGGCCCAAACNONE 
J075175E21ACATGGGCCCACTTGNONE 
J075175E21TTGTGGGCCCAAA