version

Summary of OsREG642 (All List)

OrganismOryza sativa  
IDOsREG642  
SequenceGGGCCGAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1551  

Entry Sequences (1551 entries)

LocusGene modelSequenceDescription
Os01g0132800AK068422TAATGGGCCGAAAPeptidyl-tRNA hydrolase family protein. 
Os01g0179901J075009I05GAGGCCCATTGGGCCGAAANONE 
J075058D09GAGGCCCATTGGGCCGAAANONE 
J075153K16GAGGCCCATTGGGCCGAAAConserved hypothetical protein. 
Os01g0184500AK060699GCTGGGCCGAAADEAD/DEAH box helicase, N-terminal domain containing protein. 
Os01g0203300015-045-F03GGGCCGAANONE 
AK106329GGGCCGAAConserved hypothetical protein. 
Os01g0219100J065130F20TAATGGGCCGAANONE 
J065208O10TAATGGGCCGAASFT2-like family protein. 
Os01g0229100006-113-G08ACGTGGGCCGAAANONE 
011-075-E08ACGTGGGCCGAAANONE 
AK061285ACGTGGGCCGAAANONE 
AK070838ACGTGGGCCGAAATetratricopeptide-like helical domain containing protein. 
J013059F08ACGTGGGCCGAAANONE 
J013059G08ACGTGGGCCGAAANONE 
J013059G09ACGTGGGCCGAAANONE 
J013069M12ACGTGGGCCGAAANONE 
J013105A19ACGTGGGCCGAAANONE 
J013149F07ACGTGGGCCGAAANONE 
J023073J07ACGTGGGCCGAAANONE 
J023130F24ACGTGGGCCGAAANONE 
J023147J08ACGTGGGCCGAAANONE 
J033028F13ACGTGGGCCGAAANONE 
J033115A16ACGTGGGCCGAAANONE 
J033135F02ACGTGGGCCGAAANONE 
J065031G16ACGTGGGCCGAAANONE 
J065058A09ACGTGGGCCGAAANONE 
J065089N15ACGTGGGCCGAAANONE 
J065130I09ACGTGGGCCGAAANONE 
J065191P09ACGTGGGCCGAAANONE 
J065197P14ACGTGGGCCGAAANONE 
J080306D15ACGTGGGCCGAAANONE 
J080308M06ACGTGGGCCGAAANONE 
J080315A03ACGTGGGCCGAAANONE 
J080315N11ACGTGGGCCGAAANONE 
J090046E14ACGTGGGCCGAAANONE 
J090058G09ACGTGGGCCGAAANONE 
J090077H05ACGTGGGCCGAAANONE 
J090087O20ACGTGGGCCGAAANONE 
Os01g0229200AK066024TTTCGGCCCACGTVHS domain containing protein. 
Os01g0271700J065184P16CGGGCCGAANONE 
J065184P16CGGGCCGAAANONE 
J075182E21CGGGCCGAANONE 
J075182E21CGGGCCGAAANONE 
J075191M19CGGGCCGAANONE 
J075191M19CGGGCCGAAANONE 
J090021E22CGGGCCGAANONE 
J090021E22CGGGCCGAAANONE 
Os01g0306100AK111041TTTCGGCCCAATPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0346400J100032G11GTGGTGGGCCGAAAConserved hypothetical protein. 
Os01g0358300AK060388TTCGGCCCAACTNONE 
AK072081TTCGGCCCAACTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AGTTGGGCCGAANONE 
006-083-B11AGTTGGGCCGAANONE 
006-083-C09AGTTGGGCCGAANONE 
006-088-H03AGTTGGGCCGAANONE 
006-102-H05AGTTGGGCCGAANONE 
AK061826AGTTGGGCCGAASimilar to 40S ribosomal protein S4. 
J013105M07AGTTGGGCCGAANONE 
J013155A16AGTTGGGCCGAANONE 
J033025C03AGTTGGGCCGAANONE 
J033072L20AGTTGGGCCGAANONE 
J033095I15AGTTGGGCCGAANONE 
J033105E03AGTTGGGCCGAANONE 
J033112G18AGTTGGGCCGAANONE 
J033125D09AGTTGGGCCGAANONE 
J065100L16AGTTGGGCCGAANONE 
J065176I05AGTTGGGCCGAANONE 
J090001C14AGTTGGGCCGAANONE 
J090058E15AGTTGGGCCGAANONE 
J090068F07AGTTGGGCCGAANONE 
Os01g0513800012-032-E11AGATGGGCCGAANONE 
AK100776AGATGGGCCGAASimilar to Brix domain containing protein 1 homolog. 
J023120C10AGATGGGCCGAANONE 
J033044A22AGATGGGCCGAANONE 
J033048H13AGATGGGCCGAANONE 
J033118F03AGATGGGCCGAANONE 
J065176B05AGATGGGCCGAANONE 
J075026B19AGATGGGCCGAANONE 
J075048I23AGATGGGCCGAANONE 
J075141A19AGATGGGCCGAANONE 
J075148E05AGATGGGCCGAANONE 
J090031M12AGATGGGCCGAANONE 
Os01g0514300AK121086TTTCGGCCCATTTLissencephaly type-1-like homology motif domain containing protein. 
Os01g0596300016-083-D09TTTCGGCCCACACNONE 
AK069151TTTCGGCCCACACCyclin-like F-box domain containing protein. 
J023007D17TTTCGGCCCACACNONE 
J065141M02TTTCGGCCCACACNONE 
Os01g0612800AK071035TGTGGGCCGAAConserved hypothetical protein. 
J090075K01TGTGGGCCGAANONE 
Os01g0696000AK066735TGGATGGGCCGAAATTTCGGCCCATCANONE 
AK110917TGGATGGGCCGAAATTTCGGCCCATCASimilar to Calcium-activated outward-rectifying potassium channel 1 (AtKCO1). 
J013088G11TGGATGGGCCGAAATTTCGGCCCATCANONE 
J013102H08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J033126F08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J065053G13TGGATGGGCCGAAATTTCGGCCCATCANONE 
J075109I06TGGATGGGCCGAAATTTCGGCCCATCANONE 
J100073H07TGGATGGGCCGAAATTTCGGCCCATCANONE 
Os01g0727400AK065692TTTCGGCCCGConserved hypothetical protein. 
Os01g0752300AK121755ATATGGGCTTCGGCCCATGASimilar to 60S ribosomal protein L18a-1. 
J013049F10ATATGGGCTTCGGCCCATGANONE 
J013088L10ATATGGGCTTCGGCCCATGANONE 
J023020B21ATATGGGCTTCGGCCCATGANONE 
J023038M01ATATGGGCTTCGGCCCATGANONE 
J033058H15ATATGGGCTTCGGCCCATGANONE 
J033088C04ATATGGGCTTCGGCCCATGANONE 
J033115N19ATATGGGCTTCGGCCCATGANONE 
J033131H04ATATGGGCTTCGGCCCATGANONE 
J065067E05ATATGGGCTTCGGCCCATGANONE 
J065085C07ATATGGGCTTCGGCCCATGANONE 
J065095D12ATATGGGCTTCGGCCCATGANONE 
J065124B19ATATGGGCTTCGGCCCATGANONE 
J065181H07ATATGGGCTTCGGCCCATGANONE 
J065197B09ATATGGGCTTCGGCCCATGANONE 
J075090K22ATATGGGCTTCGGCCCATGANONE 
J075101P17ATATGGGCTTCGGCCCATGANONE 
J075181F13ATATGGGCTTCGGCCCATGANONE 
J075190H19ATATGGGCTTCGGCCCATGANONE 
J090004P17ATATGGGCTTCGGCCCATGANONE 
J090066I03ATATGGGCTTCGGCCCATGANONE 
Os01g0801700AK073813TTCGGCCCAAGGCCCConserved hypothetical protein. 
J033067K14TTCGGCCCAAGGCCCNONE 
Os01g0833200AK121629TTCGGCCCCCACGConserved hypothetical protein. 
J023093N07TTCGGCCCCCACGNONE 
J033050C20TTCGGCCCCCACGNONE 
J080302F22TTCGGCCCCCACGNONE 
J080303H06TTCGGCCCCCACGNONE 
J080306J04TTCGGCCCCCACGNONE 
J080309K06TTCGGCCCCCACGNONE 
J080311E18TTCGGCCCCCACGNONE 
J080318A20TTCGGCCCCCACGNONE 
J100031F20TTCGGCCCCCACGNONE 
J100034P21TTCGGCCCCCACGNONE 
J100042K08TTCGGCCCCCACGNONE 
J100047H24TTCGGCCCCCACGNONE 
J100065C14TTCGGCCCCCACGNONE 
J100074E23TTCGGCCCCCACGNONE 
Os01g0839300AK064685GAGGCCCACTGGGCCGAAASimilar to 50S ribosomal protein L17. 
J065060I21GAGGCCCACTGGGCCGAAANONE 
Os01g0863300014-030-D08TTCGGCCCNONE 
AK111571TTCGGCCCSimilar to MCB2 protein. 
J013071A13TTCGGCCCNONE 
J075060E09TTCGGCCCNONE 
J075138C14TTCGGCCCNONE 
J075150M17TTCGGCCCNONE 
Os01g0869000AK067351TTTCGGCCCATCCNONE 
AK121602TTTCGGCCCATCCProtein of unknown function DUF639 family protein. 
Os01g0891400J065077E24TTTTGGGCCGAAConserved hypothetical protein. 
J065206I07TTTTGGGCCGAANONE 
Os01g0908100AK072293GCTGGGCCGAAATTTCGGCCCAGTARabGAP/TBC domain containing protein. 
J065010B13GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065010M12GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065047C19GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065069B18GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065071K24GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065142P04GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065170E11GCTGGGCCGAAATTTCGGCCCAGTANONE 
Os01g0952600AK067525GGGCCGAANONE 
AK070047GGGCCGAASimilar to LacZ (Fragment). 
Os01g0960800AK073977TTTGGGCCGAAProtein Transporter, Pam16 family protein. 
AY313247TTTGGGCCGAANONE 
J033075P16TTTGGGCCGAANONE 
J065051H06TTTGGGCCGAANONE 
J065167L02TTTGGGCCGAANONE 
J090083C22TTTGGGCCGAANONE 
Os01g0976800J065105P05GGGCCGAAZinc finger, GATA-type domain containing protein. 
J065189M03GGGCCGAANONE 
Os02g0176400009-099-H11TCATGGGCCGAAANONE 
AK062746TCATGGGCCGAAAProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0192700004-020-H12TTTCGGCCCAACANONE 
006-024-H06TTTCGGCCCAACANONE 
006-042-F06TTTCGGCCCAACANONE 
006-050-D04TTTCGGCCCAACANONE 
006-059-E10TTTCGGCCCAACANONE 
006-070-B02TTTCGGCCCAACANONE 
006-084-A09TTTCGGCCCAACANONE 
006-114-E11TTTCGGCCCAACANONE 
006-117-E05TTTCGGCCCAACANONE 
009-126-D11TTTCGGCCCAACANONE 
AK061629TTTCGGCCCAACASimilar to Thioredoxin peroxidase. 
AK065909TTTCGGCCCAACANONE 
J013043E11TTTCGGCCCAACANONE 
J065038I09TTTCGGCCCAACANONE 
J065078C12TTTCGGCCCAACANONE 
J065122O14TTTCGGCCCAACANONE 
J065198H04TTTCGGCCCAACANONE 
Os02g0226900AK064279TTCGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0241100Os02g0241100TTCGGCCCAAAAProtein kinase-like domain containing protein. 
Os02g0593900Os02g0593900TATTGGGCCGAAAMethyltransferases-related family protein. 
Os02g0621500AK120798TTTCGGCCCAACCZinc finger, RING-type domain containing protein. 
Os02g0656500011-045-C08AAATGGGCCGAANONE 
011-045-E06AAATGGGCCGAANONE 
016-046-A01AAATGGGCCGAANONE 
016-046-B01AAATGGGCCGAANONE 
AK062239AAATGGGCCGAANONE 
AK066420AAATGGGCCGAADnaJ-like protein. 
J013067J21AAATGGGCCGAANONE 
J065047L09AAATGGGCCGAANONE 
J065104M20AAATGGGCCGAANONE 
J065134B04AAATGGGCCGAANONE 
J065152C10AAATGGGCCGAANONE 
J065161O03AAATGGGCCGAANONE 
J065169F18AAATGGGCCGAANONE 
J065210M21AAATGGGCCGAANONE 
J065217B03AAATGGGCCGAANONE 
J065218C10AAATGGGCCGAANONE 
J075041F09AAATGGGCCGAANONE 
J075048A02AAATGGGCCGAANONE 
J075083F21AAATGGGCCGAANONE 
J080005F10AAATGGGCCGAANONE 
J080013P21AAATGGGCCGAANONE 
J080027J09AAATGGGCCGAANONE 
J080037O17AAATGGGCCGAANONE 
J080039F02AAATGGGCCGAANONE 
J080039G01AAATGGGCCGAANONE 
J080041I09AAATGGGCCGAANONE 
J080043M01AAATGGGCCGAANONE 
J080060H17AAATGGGCCGAANONE 
J080062O07AAATGGGCCGAANONE 
J080079F05AAATGGGCCGAANONE 
J080093H04AAATGGGCCGAANONE 
J080096B15AAATGGGCCGAANONE 
J080097H24AAATGGGCCGAANONE 
J090032O11AAATGGGCCGAANONE 
J090044F01AAATGGGCCGAANONE 
J090045E04AAATGGGCCGAANONE 
J090048O03AAATGGGCCGAANONE 
J090049E04AAATGGGCCGAANONE 
J090070E19AAATGGGCCGAANONE 
J090079E13AAATGGGCCGAANONE 
J090089L14AAATGGGCCGAANONE 
J090095K13AAATGGGCCGAANONE 
J090096I19AAATGGGCCGAANONE 
J090098B04AAATGGGCCGAANONE 
J100027P13AAATGGGCCGAANONE 
J100048H06AAATGGGCCGAANONE 
J100060J15AAATGGGCCGAANONE 
J100070K16AAATGGGCCGAANONE 
J100074O22AAATGGGCCGAANONE 
Os02g0679200AK110789TTCGGCCCATACTetratricopeptide-like helical domain containing protein. 
Os02g0736500AK065166TAATGGGCCGAANicastrin family protein. 
J013099D16TAATGGGCCGAANONE 
Os02g0740300AK067833TTCGGCCCATATAAA ATPase domain containing protein. 
Os02g0778600AK100098TCTGGGCCGAANONE 
AK100190TCTGGGCCGAANONE 
AK106971TCTGGGCCGAASimilar to CEL5=CELLULASE 5 (Fragment). 
J065021O09TCTGGGCCGAANONE 
Os02g0780800J090080O19TTTCGGCCCATTTNONE 
J090091I06TTTCGGCCCATTTNONE 
Os02g0782500013-043-A07TTCGGCCCAATNONE 
013-068-B10TTCGGCCCAATNONE 
013-093-A08TTCGGCCCAATNONE 
014-083-C12TTCGGCCCAATNONE 
AK063602TTCGGCCCAATNONE 
AK119261TTCGGCCCAATSimilar to Small heat stress protein class CIII. 
J065013N12TTCGGCCCAATNONE 
J075136E01TTCGGCCCAATNONE 
J075149G04TTCGGCCCAATNONE 
Os02g0814300AK111376CGGGCCGAAACytochrome c, monohaem domain containing protein. 
J065063I24CGGGCCGAAANONE 
Os02g0819100AK100156TTCGGCCCATTAZinc finger, DHHC-type domain containing protein. 
J013088C21TTCGGCCCATTANONE 
Os02g0819700AK067374GTTTGGGCCGAAZinc finger, Zim17-type family protein. 
AK099160GTTTGGGCCGAANONE 
J100086K17GTTTGGGCCGAANONE 
Os02g0829900009-044-G07AACTGGGCCGAANONE 
AK120917AACTGGGCCGAASimilar to BRICK1. 
AY224582AACTGGGCCGAANONE 
J023034L01AACTGGGCCGAANONE 
J023034M01AACTGGGCCGAANONE 
J090010G06AACTGGGCCGAANONE 
J090020D07AACTGGGCCGAANONE 
J100041L04AACTGGGCCGAANONE 
J100061D05AACTGGGCCGAANONE 
J100070L18AACTGGGCCGAANONE 
Os02g0830000011-075-D11TTCGGCCCAGTTNONE 
AK101841TTCGGCCCAGTTProtein prenyltransferase domain containing protein. 
J033069G13TTCGGCCCAGTTNONE 
Os02g0834700AK061331GGGCCGAANONE 
AK067965GGGCCGAASimilar to Cell division inhibitor. 
Os03g0115200009-112-E09TTTCGGCCCAATANONE 
AK071287TTTCGGCCCAATASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06TTTCGGCCCAATANONE 
J065075D17TTTCGGCCCAATANONE 
J065108G15TTTCGGCCCAATANONE 
J065165A16TTTCGGCCCAATANONE 
J075015O12TTTCGGCCCAATANONE 
J075022O06TTTCGGCCCAATANONE 
J075031H14TTTCGGCCCAATANONE 
J075033D10TTTCGGCCCAATANONE 
J075070A04TTTCGGCCCAATANONE 
J075127A05TTTCGGCCCAATANONE 
J100070B16TTTCGGCCCAATANONE 
Os03g0120300AK066854TTTCGGCCCATATProtein of unknown function DUF1084 family protein. 
AK104882TTTCGGCCCATATNONE 
J013075C10TTTCGGCCCATATNONE 
J090012B18TTTCGGCCCATATNONE 
J090087J08TTTCGGCCCATATNONE 
Os03g0125000006-032-D09CGATGGGCCGAANONE 
006-033-B05CGATGGGCCGAANONE 
006-048-G06CGATGGGCCGAANONE 
006-048-G09CGATGGGCCGAANONE 
006-052-D09CGATGGGCCGAANONE 
006-072-A04CGATGGGCCGAANONE 
006-076-F12CGATGGGCCGAANONE 
006-080-B03CGATGGGCCGAANONE 
006-092-H03CGATGGGCCGAANONE 
006-103-G04CGATGGGCCGAANONE 
009-079-E01CGATGGGCCGAANONE 
009-150-F03CGATGGGCCGAANONE 
AF095708CGATGGGCCGAANONE 
AK059557CGATGGGCCGAANONE 
AK070779CGATGGGCCGAASimilar to 50S ribosomal protein L5, chloroplast. 
AK098999CGATGGGCCGAANONE 
AK104137CGATGGGCCGAANONE 
J065002D07CGATGGGCCGAANONE 
J065167E24CGATGGGCCGAANONE 
J075199O14CGATGGGCCGAANONE 
J100083L01CGATGGGCCGAANONE 
Os03g0125700009-132-G03TAATGGGCCGAAANONE 
AK062913TAATGGGCCGAAAConserved hypothetical protein. 
J075046C16TAATGGGCCGAAANONE 
J075115L05TAATGGGCCGAAANONE 
J075143I05TAATGGGCCGAAANONE 
J075197O07TAATGGGCCGAAANONE 
Os03g0138600Os03g0138600AGTTGGGCCGAAGAAGCCCATAProtein of unknown function DUF810 family protein. 
Os03g0168200AK099530TGTGGGGCCGAAConserved hypothetical protein. 
Os03g0243300013-024-B05GGACGGACGTGGGCCGAANONE 
AB010740GGACGGACGTGGGCCGAANONE 
AB037151GGACGGACGTGGGCCGAASimilar to 26S proteasome non-ATPase regulatory subunit 4 (26S proteasome regulatory subunit S5A) (Multiubiquitin chain binding protein). 
AK073601GGACGGACGTGGGCCGAANONE 
J023010M13GGACGGACGTGGGCCGAANONE 
J023030M11GGACGGACGTGGGCCGAANONE 
J023066I02GGACGGACGTGGGCCGAANONE 
J023080H21GGACGGACGTGGGCCGAANONE 
J023123O15GGACGGACGTGGGCCGAANONE 
J033029N24GGACGGACGTGGGCCGAANONE 
J033031G18GGACGGACGTGGGCCGAANONE 
J033046D23GGACGGACGTGGGCCGAANONE 
J033046P11GGACGGACGTGGGCCGAANONE 
J033079C14GGACGGACGTGGGCCGAANONE 
J033125G12GGACGGACGTGGGCCGAANONE 
J033133I21GGACGGACGTGGGCCGAANONE 
J033141F22GGACGGACGTGGGCCGAANONE 
J065035O21GGACGGACGTGGGCCGAANONE 
J090008P15GGACGGACGTGGGCCGAANONE 
J090033F15GGACGGACGTGGGCCGAANONE 
J090059A16GGACGGACGTGGGCCGAANONE 
J090080N01GGACGGACGTGGGCCGAANONE 
J100022C16GGACGGACGTGGGCCGAANONE 
J100023K05GGACGGACGTGGGCCGAANONE 
J100043B19GGACGGACGTGGGCCGAANONE 
J100046G11GGACGGACGTGGGCCGAANONE 
J100049L11GGACGGACGTGGGCCGAANONE 
J100054M01GGACGGACGTGGGCCGAANONE 
J100068G15GGACGGACGTGGGCCGAANONE 
J100085A18GGACGGACGTGGGCCGAANONE 
Os03g0243350J065025D24TTCGGCCCACGTCCGTCCNONE 
J065046A15TTCGGCCCACGTCCGTCCHypothetical protein. 
J065064E08TTCGGCCCACGTCCGTCCNONE 
Os03g0253100AK119618TTCGGCCCATTTPhosphomevalonate kinase Erg8 family protein. 
J033052A14TTCGGCCCATTTNONE 
Os03g0266900013-080-C12ATTTGGGCCGAAANONE 
014-010-A09ATTTGGGCCGAAANONE 
014-013-G10ATTTGGGCCGAAANONE 
014-019-D06ATTTGGGCCGAAANONE 
014-030-F08ATTTGGGCCGAAANONE 
014-039-C05ATTTGGGCCGAAANONE 
014-053-H08ATTTGGGCCGAAANONE 
014-089-F06ATTTGGGCCGAAANONE 
014-094-A05ATTTGGGCCGAAANONE 
014-098-C12ATTTGGGCCGAAANONE 
AK119243ATTTGGGCCGAAALow molecular mass heat shock protein Oshsp17.3. 
AK119717ATTTGGGCCGAAANONE 
D12635ATTTGGGCCGAAANONE 
M80186ATTTGGGCCGAAANONE 
Os03g0298800009-079-B10GGGCCGAANONE 
AK103337GGGCCGAASimilar to Spliceosomal protein. 
Os03g0302700006-099-F12ATTTGGGCCGAAANONE 
AK112010ATTTGGGCCGAAAZinc finger, RING-type domain containing protein. 
AK121656ATTTGGGCCGAAANONE 
J075090A19ATTTGGGCCGAAANONE 
J075148M06ATTTGGGCCGAAANONE 
Os03g0372700AK064323GGTTGGGCCGAAANONE 
AK073312GGTTGGGCCGAAALow temperature viability protein family protein. 
Os03g0383100AK107106CCCGGGCCGAAAConserved hypothetical protein. 
Os03g0390400009-175-E06TTCGGCCCAACTNONE 
013-040-G01TTCGGCCCAACTNONE 
014-050-G05TTCGGCCCAACTNONE 
AB025187TTCGGCCCAACTSimilar to Cytochrome c oxidase subunit 6b. 
AK120174TTCGGCCCAACTNONE 
J013033A17TTCGGCCCAACTNONE 
J023028J08TTCGGCCCAACTNONE 
J023061N05TTCGGCCCAACTNONE 
J023077A03TTCGGCCCAACTNONE 
J023086E01TTCGGCCCAACTNONE 
J033022A08TTCGGCCCAACTNONE 
J033040F24TTCGGCCCAACTNONE 
J075073I24TTCGGCCCAACTNONE 
J075081H01TTCGGCCCAACTNONE 
J075175N19TTCGGCCCAACTNONE 
J100025M03TTCGGCCCAACTNONE 
J100036J06TTCGGCCCAACTNONE 
J100045O18TTCGGCCCAACTNONE 
J100062G15TTCGGCCCAACTNONE 
J100090N19TTCGGCCCAACTNONE 
Os03g0656900AK066416TTTCGGCCCATGANusB/RsmB/TIM44 domain containing protein. 
J065157L23TTTCGGCCCATGANONE 
J065166P22TTTCGGCCCATGANONE 
Os03g0668900AK108369AATGGGCCGAAConserved hypothetical protein. 
Os03g0681900006-042-F08GGGCCGAANONE 
009-043-F12GGGCCGAANONE 
AK061750GGGCCGAANONE 
AK062094GGGCCGAASimilar to RGP-3 (Fragment). 
J033034F01GGGCCGAANONE 
J033131F11GGGCCGAANONE 
J033143N03GGGCCGAANONE 
Os03g0701900AK068404TTCGGCCCConserved hypothetical protein. 
AK068404TTTCGGCCCGConserved hypothetical protein. 
Os03g0734700AK072060TTCGGCCCATCCMitochondrial substrate carrier family protein. 
AK120533TTCGGCCCATCCNONE 
J043026E20TTCGGCCCATCCNONE 
Os03g0746000AK073682TTTCGGCCCAGGConserved hypothetical protein. 
AK111472TTTCGGCCCAGGNONE 
J090083F05TTTCGGCCCAGGNONE 
Os03g0748500AK110695TCCGGGCCGAANONE 
AK110695TTTCGGCCCAAGNONE 
AK110695TTTCGGCCCAAGNONE 
Os03g0763000AK120812CCTGGGCCGAASimilar to Casein kinase II alpha subunit. 
AK120812GTTGGGCCGAACAGCCCASimilar to Casein kinase II alpha subunit. 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0837300AK111243TTCGGCCCATTTNONE 
AK121140TTCGGCCCATTTNicotinate phosphoribosyltransferase and related family protein. 
AY214337TTCGGCCCATTTNONE 
J023077G12TTCGGCCCATTTNONE 
J023078M10TTCGGCCCATTTNONE 
J033031B10TTCGGCCCATTTNONE 
J033067L18TTCGGCCCATTTNONE 
J043005P09TTCGGCCCATTTNONE 
J090013J15TTCGGCCCATTTNONE 
J090042E10TTCGGCCCATTTNONE 
J090045A20TTCGGCCCATTTNONE 
J100022H02TTCGGCCCATTTNONE 
Os03g0851900AK102145ACATGGGCCGAAAFG1-like ATPase family protein. 
J033086B08ACATGGGCCGAANONE 
Os03g0852400006-021-C11AGATGGGCCGAAANONE 
006-048-D09AGATGGGCCGAAANONE 
006-059-C05AGATGGGCCGAAANONE 
006-078-E01AGATGGGCCGAAANONE 
006-082-H09AGATGGGCCGAAANONE 
AK060985AGATGGGCCGAAANONE 
AK109338AGATGGGCCGAAAConserved hypothetical protein. 
Os04g0103200003-106-F06AATTGGGCCGAANONE 
015-058-G03AATTGGGCCGAANONE 
AK060850AATTGGGCCGAANONE 
AK066032AATTGGGCCGAAProteasome component region PCI domain containing protein. 
J013046D12AATTGGGCCGAANONE 
J013088L18AATTGGGCCGAANONE 
J013093J06AATTGGGCCGAANONE 
J013111I01AATTGGGCCGAANONE 
J013120B15AATTGGGCCGAANONE 
J013149K17AATTGGGCCGAANONE 
J023010J08AATTGGGCCGAANONE 
J023034J10AATTGGGCCGAANONE 
J023055D05AATTGGGCCGAANONE 
J033023L03AATTGGGCCGAANONE 
J033025N21AATTGGGCCGAANONE 
J033026A19AATTGGGCCGAANONE 
J033026M14AATTGGGCCGAANONE 
J033046J22AATTGGGCCGAANONE 
J033052H11AATTGGGCCGAANONE 
J033058P05AATTGGGCCGAANONE 
J033064A11AATTGGGCCGAANONE 
J033067K11AATTGGGCCGAANONE 
J033076H02AATTGGGCCGAANONE 
J033094E04AATTGGGCCGAANONE 
J033106A02AATTGGGCCGAANONE 
J033108N14AATTGGGCCGAANONE 
J033114I06AATTGGGCCGAANONE 
J033118H18AATTGGGCCGAANONE 
J033148C05AATTGGGCCGAANONE 
J043010I24AATTGGGCCGAANONE 
J043037C07AATTGGGCCGAANONE 
J053025M02AATTGGGCCGAANONE 
J053026N08AATTGGGCCGAANONE 
J053027O14AATTGGGCCGAANONE 
J065038N11AATTGGGCCGAANONE 
J065219C03AATTGGGCCGAANONE 
J090011F14AATTGGGCCGAANONE 
J090027C03AATTGGGCCGAANONE 
J090067M19AATTGGGCCGAANONE 
J090069C17AATTGGGCCGAANONE 
J090070P21AATTGGGCCGAANONE 
J090075N11AATTGGGCCGAANONE 
J090095C22AATTGGGCCGAANONE 
J100027O14AATTGGGCCGAANONE 
J100055E01AATTGGGCCGAANONE 
Os04g0103601J100031J08GGGCCGAAHypothetical protein. 
Os04g0115400015-048-B05ACGTGGGCCGAANONE 
AK070523ACGTGGGCCGAAD111/G-patch domain containing protein. 
Os04g0303950J065204E07GGGTGGGCCGAANONE 
J075044A07GGGTGGGCCGAANONE 
Os04g0418000006-025-C05CGGGCCGAAANONE 
006-025-D11CGGGCCGAAANONE 
006-045-F02CGGGCCGAAANONE 
006-060-B04CGGGCCGAAANONE 
006-063-E03CGGGCCGAAANONE 
006-070-G08CGGGCCGAAANONE 
006-072-H05CGGGCCGAAANONE 
AK061030CGGGCCGAAANONE 
AK099124CGGGCCGAAANONE 
AK106155CGGGCCGAAAConserved hypothetical protein. 
AK119714CGGGCCGAAANONE 
J023039I07CGGGCCGAAANONE 
J065025N03CGGGCCGAAANONE 
Os04g0449000016-008-B09CGGGCCGAANONE 
AK106468CGGGCCGAAMitochondrial substrate carrier family protein. 
Os04g0476400J033082D17TTTCGGCCCGNONE 
Os04g0477900006-046-B01ATTGGGCCGAAANONE 
006-103-C03ATTGGGCCGAAANONE 
006-106-F09ATTGGGCCGAAANONE 
009-093-B07ATTGGGCCGAAANONE 
AK059948ATTGGGCCGAAASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK104268ATTGGGCCGAAANONE 
J013158A11ATTGGGCCGAAANONE 
J023050E17ATTGGGCCGAAANONE 
J023078J03ATTGGGCCGAAANONE 
J033027G18ATTGGGCCGAAANONE 
J033086G10ATTGGGCCGAAANONE 
J090060G14ATTGGGCCGAAANONE 
Os04g0486400AJ535489GGGCCGGGCCGGGCCGAANONE 
AK103296GGGCCGGGCCGGGCCGAARML1 protein. 
J013045L03GGGCCGGGCCGGGCCGAANONE 
J013045M03GGGCCGGGCCGGGCCGAANONE 
J033034L24GGGCCGGGCCGGGCCGAANONE 
J033125B02GGGCCGGGCCGGGCCGAANONE 
J075001G08GGGCCGGGCCGGGCCGAANONE 
J075011I16GGGCCGGGCCGGGCCGAANONE 
J075033M08GGGCCGGGCCGGGCCGAANONE 
J075044G01GGGCCGGGCCGGGCCGAANONE 
J075047D04GGGCCGGGCCGGGCCGAANONE 
J075061J09GGGCCGGGCCGGGCCGAANONE 
J075085L07GGGCCGGGCCGGGCCGAANONE 
J075087D20GGGCCGGGCCGGGCCGAANONE 
J075117A04GGGCCGGGCCGGGCCGAANONE 
J075134H06GGGCCGGGCCGGGCCGAANONE 
J075184J12GGGCCGGGCCGGGCCGAANONE 
Os04g0491500AK068089TTTCGGCCCGGCCCAACCNONE 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0528100009-090-G06TTTCGGCCCAGCCNONE 
009-168-C11TTTCGGCCCAGCCNONE 
AK065957TTTCGGCCCAGCCConserved hypothetical protein. 
J013039G20TTTCGGCCCAGCCNONE 
J013044D08TTTCGGCCCAGCCNONE 
J065013L14TTTCGGCCCAGCCNONE 
J065143H08TTTCGGCCCAGCCNONE 
J065146C14TTTCGGCCCAGCCNONE 
J065149K22TTTCGGCCCAGCCNONE 
J065156B18TTTCGGCCCAGCCNONE 
J065201A04TTTCGGCCCAGCCNONE 
J065209A04TTTCGGCCCAGCCNONE 
Os04g0530000009-106-E11TTCGGCCCACCANONE 
011-012-E12TTCGGCCCACCANONE 
AK066169TTCGGCCCACCAConserved hypothetical protein. 
J013052P20TTCGGCCCACCANONE 
J090060G12TTCGGCCCACCANONE 
J100073H10TTCGGCCCACCANONE 
Os04g0542900AK068610TTCGGCCCGGTConserved hypothetical protein. 
Os04g0586500015-095-E09CCTGGGCCGAANONE 
015-095-E09GGGCCGAANONE 
AK106447CCTGGGCCGAAConserved hypothetical protein. 
AK106447GGGCCGAAConserved hypothetical protein. 
J075065I17CCTGGGCCGAANONE 
J075065I17GGGCCGAANONE 
J100078J08CCTGGGCCGAANONE 
J100078J08GGGCCGAANONE 
Os04g0591000006-090-E02AACGGGCCGAANONE 
AK072902AACGGGCCGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065061E23AACGGGCCGAANONE 
Os04g0636400006-064-G07TTCGGCCCAGGCCCAGCNONE 
006-097-D05TTCGGCCCAGGCCCAGCNONE 
AK061848TTCGGCCCAGGCCCAGCSimilar to Senescence-associated protein 6. 
AK099573TTCGGCCCAGGCCCAGCNONE 
J013035J20TTCGGCCCAGGCCCAGCNONE 
Os04g0640800AK065522TTTCGGCCCACGTTCCGTProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0650200AK072573TTCGGCCCACANONE 
AK109786TTCGGCCCACALipolytic enzyme, G-D-S-L family protein. 
Os04g0650500AK066690TTCGGCCCAGAConserved hypothetical protein. 
AK104273TTCGGCCCAGANONE 
Os04g0683500AK071538TGGTGGGCCGAANONE 
AK105871TGGTGGGCCGAANONE 
AK106642TGGTGGGCCGAASimilar to Adenosine deaminase acting on tRNA 1. 
J023095A13TGGTGGGCCGAANONE 
J023099G11TGGTGGGCCGAANONE 
J075125A03TGGTGGGCCGAANONE 
Os04g0684500AK066014GGATGGGCCGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os05g0121500006-117-B10TTTCGGCCCACTNONE 
009-059-D04TTTCGGCCCACTNONE 
J065066C12TTTCGGCCCACTConserved hypothetical protein. 
J075013I12TTTCGGCCCACTNONE 
J090046D18TTTCGGCCCACTNONE 
Os05g0158200AK060561TTCGGCCCACCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK101218TTCGGCCCACCACNONE 
J065061E13TTCGGCCCACCACNONE 
J090089F18TTCGGCCCACCACNONE 
Os05g0169400AK073439AAATGGGCCGAAProtein of unknown function DUF1421 family protein. 
AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein. 
J013110E15AAATGGGCCGAANONE 
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
J033044H02AAATGGGCCGAANONE 
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
Os05g0176600009-151-A09TTATGGGCCGAANONE 
AK071760TTATGGGCCGAAConserved hypothetical protein. 
J023110C14TTATGGGCCGAANONE 
J065116G18TTATGGGCCGAANONE 
J065131I04TTATGGGCCGAANONE 
J065163H12TTATGGGCCGAANONE 
J075088L08TTATGGGCCGAANONE 
J075165F17TTATGGGCCGAANONE 
Os05g0194600AK102487TTTCGGCCCGPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01TTTCGGCCCGNONE 
J100041A08TTTCGGCCCGNONE 
Os05g0223200015-037-E09TTCGGCCCNONE 
AK106308TTCGGCCCSimilar to Glycine-rich RNA-binding protein GRP2A. 
J065013L17TTCGGCCCNONE 
J065056N06TTCGGCCCNONE 
J065080I11TTCGGCCCNONE 
J065104F11TTCGGCCCNONE 
J065183L10TTCGGCCCNONE 
J065185H12TTCGGCCCNONE 
J065186N17TTCGGCCCNONE 
Os05g0328000AK107977TCTGGCCCGTTCGGCCCGConserved hypothetical protein. 
AK107977TTTCGGCCCGGAConserved hypothetical protein. 
J065005I02TCTGGCCCGTTCGGCCCGNONE 
J065005I02TTTCGGCCCGGANONE 
J065049M05TCTGGCCCGTTCGGCCCGNONE 
J065049M05TTTCGGCCCGGANONE 
J080005F01TCTGGCCCGTTCGGCCCGNONE 
J080005F01TTTCGGCCCGGANONE 
J080005H15TCTGGCCCGTTCGGCCCGNONE 
J080005H15TTTCGGCCCGGANONE 
J080005K23TCTGGCCCGTTCGGCCCGNONE 
J080005K23TTTCGGCCCGGANONE 
J080007O03TCTGGCCCGTTCGGCCCGNONE 
J080007O03TTTCGGCCCGGANONE 
J080013H09TCTGGCCCGTTCGGCCCGNONE 
J080013H09TTTCGGCCCGGANONE 
J080024C02TCTGGCCCGTTCGGCCCGNONE 
J080024C02TTTCGGCCCGGANONE 
J080026M22TCTGGCCCGTTCGGCCCGNONE 
J080026M22TTTCGGCCCGGANONE 
J080029K21TCTGGCCCGTTCGGCCCGNONE 
J080029K21TTTCGGCCCGGANONE 
J080032K04TCTGGCCCGTTCGGCCCGNONE 
J080032K04TTTCGGCCCGGANONE 
J080034M16TCTGGCCCGTTCGGCCCGNONE 
J080034M16TTTCGGCCCGGANONE 
J080037G11TCTGGCCCGTTCGGCCCGNONE 
J080037G11TTTCGGCCCGGANONE 
J080040L01TCTGGCCCGTTCGGCCCGNONE 
J080040L01TTTCGGCCCGGANONE 
J080041D13TCTGGCCCGTTCGGCCCGNONE 
J080041D13TTTCGGCCCGGANONE 
J080043G20TCTGGCCCGTTCGGCCCGNONE 
J080043G20TTTCGGCCCGGANONE 
J080046H17TCTGGCCCGTTCGGCCCGNONE 
J080046H17TTTCGGCCCGGANONE 
J080048A05TCTGGCCCGTTCGGCCCGNONE 
J080048A05TTTCGGCCCGGANONE 
J080064C21TCTGGCCCGTTCGGCCCGNONE 
J080064C21TTTCGGCCCGGANONE 
J080067E15TCTGGCCCGTTCGGCCCGNONE 
J080067E15TTTCGGCCCGGANONE 
J080071P05TCTGGCCCGTTCGGCCCGNONE 
J080071P05TTTCGGCCCGGANONE 
J080074H16TCTGGCCCGTTCGGCCCGNONE 
J080074H16TTTCGGCCCGGANONE 
J080076A18TCTGGCCCGTTCGGCCCGNONE 
J080076A18TTTCGGCCCGGANONE 
J080076D20TCTGGCCCGTTCGGCCCGNONE 
J080076D20TTTCGGCCCGGANONE 
J080077J15TCTGGCCCGTTCGGCCCGNONE 
J080077J15TTTCGGCCCGGANONE 
J080085J11TCTGGCCCGTTCGGCCCGNONE 
J080085J11TTTCGGCCCGGANONE 
J080086E08TCTGGCCCGTTCGGCCCGNONE 
J080086E08TTTCGGCCCGGANONE 
J080088I23TCTGGCCCGTTCGGCCCGNONE 
J080088I23TTTCGGCCCGGANONE 
J080088I24TCTGGCCCGTTCGGCCCGNONE 
J080088I24TTTCGGCCCGGANONE 
J080089D05TCTGGCCCGTTCGGCCCGNONE 
J080089D05TTTCGGCCCGGANONE 
J080093B04TCTGGCCCGTTCGGCCCGNONE 
J080093B04TTTCGGCCCGGANONE 
J080093D07TCTGGCCCGTTCGGCCCGNONE 
J080093D07TTTCGGCCCGGANONE 
J080094A09TCTGGCCCGTTCGGCCCGNONE 
J080094A09TTTCGGCCCGGANONE 
J080096I12TCTGGCCCGTTCGGCCCGNONE 
J080096I12TTTCGGCCCGGANONE 
J080097L23TCTGGCCCGTTCGGCCCGNONE 
J080097L23TTTCGGCCCGGANONE 
Os05g0379300AK109293TTTCGGCCCATCAConserved hypothetical protein. 
Os05g0384300AK107183TTCGGCCCCACPeptidase A1, pepsin family protein. 
Os05g0400800AK065701TGCGGGCCGAASimilar to 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase, chloroplast precursor (EC 5.3.1.16) (Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase) (5-proFAR isomerase) (BBM II). 
Os05g0424700AK107848GGGCCGAAASimilar to Copper transporter 1. 
Os05g0490900AK111382TTCGGCCCAGCCCAAAConserved hypothetical protein. 
Os05g0503000AK068335TCATGGGCCGAAASimilar to Secretory carrier membrane protein. 
AK104049TCATGGGCCGAAANONE 
J013149D04TCATGGGCCGAAANONE 
J075085A06TCATGGGCCGAAANONE 
Os05g0531700AK110982GGGCCGAAConserved hypothetical protein. 
Os05g0540100AB021666AATTGGGCCGAAANONE 
AK060623AATTGGGCCGAAANONE 
AK103819AATTGGGCCGAAAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0547850009-102-F03AGATGGGCCTTGGGCCGAAANONE 
013-076-H08AGATGGGCCTTGGGCCGAAANONE 
AK058330AGATGGGCCTTGGGCCGAAANONE 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
AY626826AGATGGGCCTTGGGCCGAAANONE 
J043012O19AGATGGGCCTTGGGCCGAAANONE 
J043038O15AGATGGGCCTTGGGCCGAAANONE 
J053094L06AGATGGGCCTTGGGCCGAAANONE 
Os05g0548100AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
AK100682TTTCGGCCCAAGGCCCATATNONE 
J013151E01TTTCGGCCCAAGGCCCATATNONE 
J023113L22TTTCGGCCCAAGGCCCATATNONE 
J043027A19TTTCGGCCCAAGGCCCATATNONE 
J075093E06TTTCGGCCCAAGGCCCATATNONE 
J090060D15TTTCGGCCCAAGGCCCATATNONE 
J090082J03TTTCGGCCCAAGGCCCATATNONE 
J100050E01TTTCGGCCCAAGGCCCATATNONE 
Os05g0558900AK101679TTTCGGCCCATTSimilar to Frsb-prov protein. 
J013028M08TTTCGGCCCATTNONE 
J013074E16TTTCGGCCCATTNONE 
J013096L01TTTCGGCCCATTNONE 
J023085M19TTTCGGCCCATTNONE 
J033058I10TTTCGGCCCATTNONE 
J033091D18TTTCGGCCCATTNONE 
J033111H13TTTCGGCCCATTNONE 
J033114C18TTTCGGCCCATTNONE 
Os05g0571600Os05g0571600TTTCGGCCCAACCConserved hypothetical protein. 
Os05g0592300AK068520TTCGGCCCACAProtein of unknown function DUF1637 family protein. 
Os05g0593100AK061855TTCGGCCCATTANONE 
AK100119TTCGGCCCATTASimilar to Vacuolar ATP synthase subunit C (EC 3.6.3.14) (V-ATPase C subunit) (Vacuolar proton pump C subunit). 
AY224442TTCGGCCCATTANONE 
Os06g0113600016-067-E03TGTGGGCCGAAANONE 
AK062095TGTGGGCCGAAANONE 
AK101235TGTGGGCCGAAACyclin-like F-box domain containing protein. 
AK122025TGTGGGCCGAAANONE 
J013022O19TGTGGGCCGAAANONE 
J023045P05TGTGGGCCGAAANONE 
J033031K01TGTGGGCCGAAANONE 
J033034I09TGTGGGCCGAAANONE 
J033041O04TGTGGGCCGAAANONE 
J033071K03TGTGGGCCGAAANONE 
J033075K16TGTGGGCCGAAANONE 
J033097M01TGTGGGCCGAAANONE 
J033099M22TGTGGGCCGAAANONE 
J033108N15TGTGGGCCGAAANONE 
J033121D18TGTGGGCCGAAANONE 
J033125O06TGTGGGCCGAAANONE 
J033139M16TGTGGGCCGAAANONE 
J033145P18TGTGGGCCGAAANONE 
J033149D05TGTGGGCCGAAANONE 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0136700AK065081TTTCGGCCCAATSteroid nuclear receptor, ligand-binding domain containing protein. 
J013001L08TTTCGGCCCAATNONE 
J013039I03TTTCGGCCCAATNONE 
Os06g0138500015-050-C10CGGGCCGAANONE 
AK066485CGGGCCGAAConserved hypothetical protein. 
AK069536CGGGCCGAANONE 
J023022B22CGGGCCGAANONE 
J075190L15CGGGCCGAANONE 
J100024C08CGGGCCGAANONE 
J100025K15CGGGCCGAANONE 
J100037C14CGGGCCGAANONE 
J100078F18CGGGCCGAANONE 
J100079N15CGGGCCGAANONE 
Os06g0192500AK067746TTTCGGCCCATACAGCCCATCAATP-dependent helicase, DEAH-box family protein. 
J065023K06TTTCGGCCCATACAGCCCATCANONE 
J100063P08TTTCGGCCCATACAGCCCATCANONE 
J100065N03TTTCGGCCCATACAGCCCATCANONE 
Os06g0246500AK105105TTCGGCCCACTSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
AK105105TTTCGGCCCATASimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0320000009-030-C04CATGGGCCGAANONE 
009-135-F08CATGGGCCGAANONE 
J075103B05CATGGGCCGAAProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24CATGGGCCGAANONE 
Os06g0547900AK100950TTTCGGCCCATCTSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665TTTCGGCCCATCTNONE 
J023139I22TTTCGGCCCATCTNONE 
J090066J10TTTCGGCCCATCTNONE 
Y13437TTTCGGCCCATCTNONE 
Os06g0590301J033139K16TTCGGCCCAACNONE 
J065011M13TTCGGCCCAACNONE 
J065027D20TTCGGCCCAACNONE 
J065039O05TTCGGCCCAACGlucose/ribitol dehydrogenase family protein. 
J065051O10TTCGGCCCAACNONE 
J065128I21TTCGGCCCAACNONE 
J065163P10TTCGGCCCAACNONE 
J065169H02TTCGGCCCAACNONE 
Os06g0592400009-106-G11TTCGGCCCNONE 
AK062788TTCGGCCCSimilar to Cytosolic aldehyde dehydrogenase RF2C. 
Os06g0634600011-029-F10TTTCGGCCCAAATNONE 
011-057-B11TTTCGGCCCAAATNONE 
AK122074TTTCGGCCCAAATProtein of unknown function FAF1 domain containing protein. 
J033118C24TTTCGGCCCAAATNONE 
J033132A01TTTCGGCCCAAATNONE 
J065059I05TTTCGGCCCAAATNONE 
J100069I04TTTCGGCCCAAATNONE 
Os06g0693000AK064280TTCGGCCCProtein kinase-like domain containing protein. 
Os06g0704300AK107008TCGTGGGCCGAAZinc finger, CCCH-type domain containing protein. 
J065038I12TCGTGGGCCGAANONE 
J065079E03TCGTGGGCCGAANONE 
J075035B15TCGTGGGCCGAANONE 
J090072D21TCGTGGGCCGAANONE 
Os06g0709100006-057-D06TTCGGCCCATGANONE 
011-040-A08TTCGGCCCATGANONE 
016-044-A01TTCGGCCCATGANONE 
AK059732TTCGGCCCATGANONE 
AK070881TTCGGCCCATGACyclin-like F-box domain containing protein. 
AK103683TTCGGCCCATGANONE 
J065026P10TTCGGCCCATGANONE 
J090017L13TTCGGCCCATGANONE 
Os06g0710300AK121344CTTGGGCCGAAUncharacterized protein UPF0114 family protein. 
J043016B12CTTGGGCCGAANONE 
J065104H21CTTGGGCCGAANONE 
Os06g0711600016-047-G09TTCGGCCCGGTNONE 
AK064384TTCGGCCCGGTmRNA splicing factor SYF2 family protein. 
AK102831TTCGGCCCGGTNONE 
J013072P18TTCGGCCCGGTNONE 
J023049G01TTCGGCCCGGTNONE 
J023088I01TTCGGCCCGGTNONE 
J033023I22TTCGGCCCGGTNONE 
J033106I12TTCGGCCCGGTNONE 
J033109G07TTCGGCCCGGTNONE 
J065030F22TTCGGCCCGGTNONE 
J065132H19TTCGGCCCGGTNONE 
J080301D07TTCGGCCCGGTNONE 
J080305C09TTCGGCCCGGTNONE 
J080312C03TTCGGCCCGGTNONE 
J080313I15TTCGGCCCGGTNONE 
J080315B09TTCGGCCCGGTNONE 
J090056N21TTCGGCCCGGTNONE 
J100027B07TTCGGCCCGGTNONE 
Os06g0712900AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
J075055M19TCATGGGCCGAAAAGGCCCATATNONE 
J075122I03TCATGGGCCGAAAAGGCCCATATNONE 
Os06g0714800006-033-C09TTCGGCCCNONE 
006-042-G10TTCGGCCCNONE 
006-081-G10TTCGGCCCNONE 
006-120-F12TTCGGCCCNONE 
009-149-F08TTCGGCCCNONE 
AK059793TTCGGCCCProtein of unknown function DUF581 family protein. 
AK071528TTCGGCCCNONE 
J023102E22TTCGGCCCNONE 
J065099H06TTCGGCCCNONE 
J065127G22TTCGGCCCNONE 
J075089J03TTCGGCCCNONE 
J075109B02TTCGGCCCNONE 
J075179K22TTCGGCCCNONE 
Os06g0715000AK107114TTCGGCCCAATTConserved hypothetical protein. 
Os06g0731800012-049-D10AAATGGGCCGAANONE 
AK069288AAATGGGCCGAAClathrin light chain family protein. 
J023014P04AAATGGGCCGAANONE 
J023058N12AAATGGGCCGAANONE 
J053035L13AAATGGGCCGAANONE 
J065097L21AAATGGGCCGAANONE 
J065099F07AAATGGGCCGAANONE 
J065144L02AAATGGGCCGAANONE 
J065161J11AAATGGGCCGAANONE 
J065181N05AAATGGGCCGAANONE 
J075087D09AAATGGGCCGAANONE 
J075088H19AAATGGGCCGAANONE 
J075116E21AAATGGGCCGAANONE 
J075147K03AAATGGGCCGAANONE 
J090083H22AAATGGGCCGAANONE 
J100079M09AAATGGGCCGAANONE 
Os07g0121000AK072975GGGCCGAAGAGGCCCACTTGProtein of unknown function DUF1719, Oryza sativa family protein. 
J023148M03GGGCCGAAGAGGCCCACTTGNONE 
Os07g0136300AK064609GCTGGGCCGAAConserved hypothetical protein. 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0190900012-063-F11TCTGGGCCGTTTGGGCCGAANONE 
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein. 
J013110O09TCTGGGCCGTTTGGGCCGAANONE 
J033041I12TCTGGGCCGTTTGGGCCGAANONE 
J033046D05TCTGGGCCGTTTGGGCCGAANONE 
J033101K24TCTGGGCCGTTTGGGCCGAANONE 
J090009F10TCTGGGCCGTTTGGGCCGAANONE 
J090095B17TCTGGGCCGTTTGGGCCGAANONE 
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein. 
AK103440TTCGGCCCAAACGGCCCAGANONE 
Os07g0423000AK109714GGTGGGCCGAAMitochodrial transcription termination factor-related family protein. 
J065007I23GGTGGGCCGAANONE 
Os07g0435400AK111603TTTCGGCCCATCTSimilar to WD40. 
Os07g0450000009-033-A08TTCGGCCCATANONE 
AK063789TTCGGCCCATANONE 
AK121702TTCGGCCCATASimilar to 60S ribosomal protein L44. 
J033073H17TTCGGCCCATANONE 
J065006A02TTCGGCCCATANONE 
J065009C05TTCGGCCCATANONE 
J065028M04TTCGGCCCATANONE 
J065070D07TTCGGCCCATANONE 
J065072H17TTCGGCCCATANONE 
J065114J23TTCGGCCCATANONE 
J065127A02TTCGGCCCATANONE 
J065146L07TTCGGCCCATANONE 
J065213H17TTCGGCCCATANONE 
J065214B07TTCGGCCCATANONE 
J100045B16TTCGGCCCATANONE 
Os07g0479200005-017-H08TTCGGCCCAACACGTCACNONE 
AK058326TTCGGCCCAACACGTCACSimilar to SL15-like (Fragment). 
J013092A08TTCGGCCCAACACGTCACNONE 
J033139E04TTCGGCCCAACACGTCACNONE 
J043016M16TTCGGCCCAACACGTCACNONE 
J053050O18TTCGGCCCAACACGTCACNONE 
J053098B03TTCGGCCCAACACGTCACNONE 
J065068G10TTCGGCCCAACACGTCACNONE 
J065091I17TTCGGCCCAACACGTCACNONE 
J065109A03TTCGGCCCAACACGTCACNONE 
J065168B17TTCGGCCCAACACGTCACNONE 
J065177A05TTCGGCCCAACACGTCACNONE 
J065180J01TTCGGCCCAACACGTCACNONE 
J075006F13TTCGGCCCAACACGTCACNONE 
J075022J03TTCGGCCCAACACGTCACNONE 
J075024N09TTCGGCCCAACACGTCACNONE 
J075114B12TTCGGCCCAACACGTCACNONE 
J080023M06TTCGGCCCAACACGTCACNONE 
J080081N24TTCGGCCCAACACGTCACNONE 
J090060N07TTCGGCCCAACACGTCACNONE 
Os07g0498300009-045-C02TTTCGGCCCATGGGCTTTTNONE 
009-060-A09TTTCGGCCCATGGGCTTTTNONE 
009-121-C04TTTCGGCCCATGGGCTTTTNONE 
009-157-G09TTTCGGCCCATGGGCTTTTNONE 
009-197-B02TTTCGGCCCATGGGCTTTTNONE 
AK059124TTTCGGCCCATGGGCTTTTConserved hypothetical protein. 
AK119800TTTCGGCCCATGGGCTTTTNONE 
J065184M18TTTCGGCCCATGGGCTTTTNONE 
J075009G21TTTCGGCCCATGGGCTTTTNONE 
J075013O03TTTCGGCCCATGGGCTTTTNONE 
J075061C22TTTCGGCCCATGGGCTTTTNONE 
J075094E12TTTCGGCCCATGGGCTTTTNONE 
J075148C01TTTCGGCCCATGGGCTTTTNONE 
Os07g0504601J065068H15GGGCTTTTTTTCGGCCCGCAConserved hypothetical protein. 
J065095H08GGGCTTTTTTTCGGCCCGCANONE 
Os07g0562700003-111-G08GCTGGGCCGAAANONE 
004-013-E07GCTGGGCCGAAANONE 
006-021-D03GCTGGGCCGAAANONE 
006-021-D07GCTGGGCCGAAANONE 
006-021-F09GCTGGGCCGAAANONE 
006-023-D01GCTGGGCCGAAANONE 
006-024-F04GCTGGGCCGAAANONE 
006-024-G09GCTGGGCCGAAANONE 
006-024-G11GCTGGGCCGAAANONE 
006-025-A10GCTGGGCCGAAANONE 
006-025-B08GCTGGGCCGAAANONE 
006-025-E10GCTGGGCCGAAANONE 
006-025-F10GCTGGGCCGAAANONE 
006-026-B04GCTGGGCCGAAANONE 
006-026-C08GCTGGGCCGAAANONE 
006-026-D03GCTGGGCCGAAANONE 
006-026-F03GCTGGGCCGAAANONE 
006-026-F08GCTGGGCCGAAANONE 
006-026-F12GCTGGGCCGAAANONE 
006-027-A10GCTGGGCCGAAANONE 
006-027-C03GCTGGGCCGAAANONE 
006-028-C03GCTGGGCCGAAANONE 
006-029-E02GCTGGGCCGAAANONE 
006-029-G05GCTGGGCCGAAANONE 
006-030-A10GCTGGGCCGAAANONE 
006-030-C06GCTGGGCCGAAANONE 
006-030-D03GCTGGGCCGAAANONE 
006-030-D06GCTGGGCCGAAANONE 
006-030-G05GCTGGGCCGAAANONE 
006-031-B10GCTGGGCCGAAANONE 
006-031-D04GCTGGGCCGAAANONE 
006-031-D11GCTGGGCCGAAANONE 
006-031-H09GCTGGGCCGAAANONE 
006-032-C09GCTGGGCCGAAANONE 
006-032-H09GCTGGGCCGAAANONE 
006-033-B02GCTGGGCCGAAANONE 
006-033-B09GCTGGGCCGAAANONE 
006-033-E01GCTGGGCCGAAANONE 
006-033-F06GCTGGGCCGAAANONE 
006-033-G03GCTGGGCCGAAANONE 
006-034-A08GCTGGGCCGAAANONE 
006-034-C09GCTGGGCCGAAANONE 
006-034-F06GCTGGGCCGAAANONE 
006-035-B12GCTGGGCCGAAANONE 
006-035-C12GCTGGGCCGAAANONE 
006-035-H04GCTGGGCCGAAANONE 
006-035-H12GCTGGGCCGAAANONE 
006-036-A05GCTGGGCCGAAANONE 
006-036-A09GCTGGGCCGAAANONE 
006-036-B10GCTGGGCCGAAANONE 
006-036-C03GCTGGGCCGAAANONE 
006-036-E06GCTGGGCCGAAANONE 
006-037-H11GCTGGGCCGAAANONE 
006-038-G01GCTGGGCCGAAANONE 
006-039-B01GCTGGGCCGAAANONE 
006-039-B12GCTGGGCCGAAANONE 
006-039-C02GCTGGGCCGAAANONE 
006-039-E06GCTGGGCCGAAANONE 
006-039-G12GCTGGGCCGAAANONE 
006-040-G07GCTGGGCCGAAANONE 
006-041-H04GCTGGGCCGAAANONE 
006-042-A11GCTGGGCCGAAANONE 
006-042-E07GCTGGGCCGAAANONE 
006-042-F12GCTGGGCCGAAANONE 
006-043-C01GCTGGGCCGAAANONE 
006-045-H12GCTGGGCCGAAANONE 
006-046-A12GCTGGGCCGAAANONE 
006-046-F03GCTGGGCCGAAANONE 
006-047-A07GCTGGGCCGAAANONE 
006-047-A09GCTGGGCCGAAANONE 
006-047-E10GCTGGGCCGAAANONE 
006-047-G12GCTGGGCCGAAANONE 
006-048-B04GCTGGGCCGAAANONE 
006-049-D01GCTGGGCCGAAANONE 
006-049-G02GCTGGGCCGAAANONE 
006-049-G10GCTGGGCCGAAANONE 
006-049-H04GCTGGGCCGAAANONE 
006-050-D05GCTGGGCCGAAANONE 
006-050-F05GCTGGGCCGAAANONE 
006-051-B05GCTGGGCCGAAANONE 
006-051-G12GCTGGGCCGAAANONE 
006-052-D12GCTGGGCCGAAANONE 
006-053-D06GCTGGGCCGAAANONE 
006-054-H02GCTGGGCCGAAANONE 
006-055-A03GCTGGGCCGAAANONE 
006-055-C01GCTGGGCCGAAANONE 
006-055-E07GCTGGGCCGAAANONE 
006-055-H06GCTGGGCCGAAANONE 
006-056-F06GCTGGGCCGAAANONE 
006-057-D03GCTGGGCCGAAANONE 
006-057-D05GCTGGGCCGAAANONE 
006-057-G01GCTGGGCCGAAANONE 
006-058-A03GCTGGGCCGAAANONE 
006-058-B06GCTGGGCCGAAANONE 
006-059-A09GCTGGGCCGAAANONE 
006-059-H11GCTGGGCCGAAANONE 
006-060-A04GCTGGGCCGAAANONE 
006-060-A09GCTGGGCCGAAANONE 
006-060-C11GCTGGGCCGAAANONE 
006-060-D08GCTGGGCCGAAANONE 
006-061-A04GCTGGGCCGAAANONE 
006-061-E01GCTGGGCCGAAANONE 
006-061-G10GCTGGGCCGAAANONE 
006-061-H12GCTGGGCCGAAANONE 
006-062-B07GCTGGGCCGAAANONE 
006-062-G03GCTGGGCCGAAANONE 
006-062-H12GCTGGGCCGAAANONE 
006-063-D05GCTGGGCCGAAANONE 
006-063-E04GCTGGGCCGAAANONE 
006-063-F05GCTGGGCCGAAANONE 
006-063-G05GCTGGGCCGAAANONE 
006-064-B07GCTGGGCCGAAANONE 
006-065-C11GCTGGGCCGAAANONE 
006-065-H02GCTGGGCCGAAANONE 
006-067-C12GCTGGGCCGAAANONE 
006-067-F10GCTGGGCCGAAANONE 
006-068-E02GCTGGGCCGAAANONE 
006-068-G04GCTGGGCCGAAANONE 
006-069-A02GCTGGGCCGAAANONE 
006-071-A07GCTGGGCCGAAANONE 
006-072-F11GCTGGGCCGAAANONE 
006-072-F12GCTGGGCCGAAANONE 
006-073-E12GCTGGGCCGAAANONE 
006-073-F08GCTGGGCCGAAANONE 
006-073-H07GCTGGGCCGAAANONE 
006-074-A07GCTGGGCCGAAANONE 
006-075-A12GCTGGGCCGAAANONE 
006-075-B01GCTGGGCCGAAANONE 
006-075-H10GCTGGGCCGAAANONE 
006-075-H12GCTGGGCCGAAANONE 
006-076-B06GCTGGGCCGAAANONE 
006-077-A09GCTGGGCCGAAANONE 
006-077-D05GCTGGGCCGAAANONE 
006-078-C11GCTGGGCCGAAANONE 
006-078-D12GCTGGGCCGAAANONE 
006-078-E02GCTGGGCCGAAANONE 
006-079-A01GCTGGGCCGAAANONE 
006-079-E02GCTGGGCCGAAANONE 
006-079-F03GCTGGGCCGAAANONE 
006-080-G11GCTGGGCCGAAANONE 
006-081-C02GCTGGGCCGAAANONE 
006-081-C08GCTGGGCCGAAANONE 
006-082-B06GCTGGGCCGAAANONE 
006-082-C11GCTGGGCCGAAANONE 
006-082-H04GCTGGGCCGAAANONE 
006-083-E04GCTGGGCCGAAANONE 
006-083-H12GCTGGGCCGAAANONE 
006-084-C08GCTGGGCCGAAANONE 
006-084-E07GCTGGGCCGAAANONE 
006-084-E10GCTGGGCCGAAANONE 
006-085-E06GCTGGGCCGAAANONE 
006-085-E10GCTGGGCCGAAANONE 
006-086-F06GCTGGGCCGAAANONE 
006-087-D08GCTGGGCCGAAANONE 
006-087-F03GCTGGGCCGAAANONE 
006-087-F10GCTGGGCCGAAANONE 
006-087-G07GCTGGGCCGAAANONE 
006-088-A02GCTGGGCCGAAANONE 
006-089-A04GCTGGGCCGAAANONE 
006-089-B12GCTGGGCCGAAANONE 
006-089-D06GCTGGGCCGAAANONE 
006-089-D10GCTGGGCCGAAANONE 
006-089-H05GCTGGGCCGAAANONE 
006-090-C06GCTGGGCCGAAANONE 
006-091-A03GCTGGGCCGAAANONE 
006-091-E04GCTGGGCCGAAANONE 
006-091-H12GCTGGGCCGAAANONE 
006-092-A08GCTGGGCCGAAANONE 
006-092-F01GCTGGGCCGAAANONE 
006-092-G08GCTGGGCCGAAANONE 
006-093-B12GCTGGGCCGAAANONE 
006-093-D04GCTGGGCCGAAANONE 
006-093-F01GCTGGGCCGAAANONE 
006-094-A08GCTGGGCCGAAANONE 
006-094-F01GCTGGGCCGAAANONE 
006-094-F03GCTGGGCCGAAANONE 
006-095-C12GCTGGGCCGAAANONE 
006-095-E10GCTGGGCCGAAANONE 
006-095-E12GCTGGGCCGAAANONE 
006-095-G06GCTGGGCCGAAANONE 
006-096-B12GCTGGGCCGAAANONE 
006-096-C12GCTGGGCCGAAANONE 
006-096-G02GCTGGGCCGAAANONE 
006-097-D01GCTGGGCCGAAANONE 
006-097-D07GCTGGGCCGAAANONE 
006-097-F04GCTGGGCCGAAANONE 
006-098-C07GCTGGGCCGAAANONE 
006-098-D04GCTGGGCCGAAANONE 
006-099-E06GCTGGGCCGAAANONE 
006-099-F02GCTGGGCCGAAANONE 
006-099-F10GCTGGGCCGAAANONE 
006-100-A07GCTGGGCCGAAANONE 
006-100-B10GCTGGGCCGAAANONE 
006-100-G01GCTGGGCCGAAANONE 
006-100-H06GCTGGGCCGAAANONE 
006-101-D01GCTGGGCCGAAANONE 
006-101-F03GCTGGGCCGAAANONE 
006-102-A12GCTGGGCCGAAANONE 
006-102-B11GCTGGGCCGAAANONE 
006-102-C03GCTGGGCCGAAANONE 
006-102-F11GCTGGGCCGAAANONE 
006-103-A08GCTGGGCCGAAANONE 
006-103-B06GCTGGGCCGAAANONE 
006-103-D01GCTGGGCCGAAANONE 
006-103-F02GCTGGGCCGAAANONE 
006-104-B02GCTGGGCCGAAANONE 
006-104-C01GCTGGGCCGAAANONE 
006-104-F09GCTGGGCCGAAANONE 
006-104-H11GCTGGGCCGAAANONE 
006-105-A03GCTGGGCCGAAANONE 
006-105-D09GCTGGGCCGAAANONE 
006-106-B10GCTGGGCCGAAANONE 
006-107-A06GCTGGGCCGAAANONE 
006-107-C04GCTGGGCCGAAANONE 
006-107-E03GCTGGGCCGAAANONE 
006-107-F05GCTGGGCCGAAANONE 
006-108-C09GCTGGGCCGAAANONE 
006-109-C09GCTGGGCCGAAANONE 
006-109-D10GCTGGGCCGAAANONE 
006-109-E06GCTGGGCCGAAANONE 
006-109-E10GCTGGGCCGAAANONE 
006-110-A06GCTGGGCCGAAANONE 
006-110-C11GCTGGGCCGAAANONE 
006-111-A02GCTGGGCCGAAANONE 
006-111-F02GCTGGGCCGAAANONE 
006-112-A08GCTGGGCCGAAANONE 
006-112-H06GCTGGGCCGAAANONE 
006-113-A08GCTGGGCCGAAANONE 
006-113-B01GCTGGGCCGAAANONE 
006-113-C05GCTGGGCCGAAANONE 
006-113-D01GCTGGGCCGAAANONE 
006-113-D04GCTGGGCCGAAANONE 
006-113-D06GCTGGGCCGAAANONE 
006-113-E09GCTGGGCCGAAANONE 
006-114-F06GCTGGGCCGAAANONE 
006-116-B02GCTGGGCCGAAANONE 
006-117-B07GCTGGGCCGAAANONE 
006-117-G04GCTGGGCCGAAANONE 
006-118-D01GCTGGGCCGAAANONE 
006-118-D12GCTGGGCCGAAANONE 
006-118-F12GCTGGGCCGAAANONE 
006-118-G12GCTGGGCCGAAANONE 
006-119-B08GCTGGGCCGAAANONE 
006-120-E09GCTGGGCCGAAANONE 
006-120-G05GCTGGGCCGAAANONE 
006-120-G10GCTGGGCCGAAANONE 
009-022-D12GCTGGGCCGAAANONE 
009-051-H08GCTGGGCCGAAANONE 
009-065-F05GCTGGGCCGAAANONE 
009-070-A06GCTGGGCCGAAANONE 
009-073-B07GCTGGGCCGAAANONE 
009-092-C10GCTGGGCCGAAANONE 
009-093-D03GCTGGGCCGAAANONE 
009-103-B04GCTGGGCCGAAANONE 
009-106-H08GCTGGGCCGAAANONE 
009-120-B05GCTGGGCCGAAANONE 
009-121-F05GCTGGGCCGAAANONE 
009-122-B04GCTGGGCCGAAANONE 
009-122-D08GCTGGGCCGAAANONE 
009-123-F07GCTGGGCCGAAANONE 
009-125-G02GCTGGGCCGAAANONE 
009-128-F02GCTGGGCCGAAANONE 
009-128-H07GCTGGGCCGAAANONE 
009-131-C06GCTGGGCCGAAANONE 
009-132-F08GCTGGGCCGAAANONE 
009-133-G08GCTGGGCCGAAANONE 
009-134-D09GCTGGGCCGAAANONE 
009-135-F01GCTGGGCCGAAANONE 
009-149-E11GCTGGGCCGAAANONE 
009-153-H04GCTGGGCCGAAANONE 
009-161-E04GCTGGGCCGAAANONE 
009-163-A09GCTGGGCCGAAANONE 
009-163-C05GCTGGGCCGAAANONE 
009-163-E10GCTGGGCCGAAANONE 
009-165-F04GCTGGGCCGAAANONE 
009-166-A07GCTGGGCCGAAANONE 
009-169-G12GCTGGGCCGAAANONE 
009-172-G08GCTGGGCCGAAANONE 
009-179-E06GCTGGGCCGAAANONE 
009-181-F09GCTGGGCCGAAANONE 
009-190-G07GCTGGGCCGAAANONE 
009-191-D01GCTGGGCCGAAANONE 
009-195-G02GCTGGGCCGAAANONE 
AF022738GCTGGGCCGAAANONE 
AK061512GCTGGGCCGAAANONE 
AK068972GCTGGGCCGAAANONE 
AK103926GCTGGGCCGAAANONE 
AK103999GCTGGGCCGAAANONE 
AK104224GCTGGGCCGAAANONE 
AK104465GCTGGGCCGAAANONE 
AK104495GCTGGGCCGAAANONE 
AK109399GCTGGGCCGAAASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GCTGGGCCGAAANONE 
AK119545GCTGGGCCGAAANONE 
J013043L10GCTGGGCCGAAANONE 
J013050A09GCTGGGCCGAAANONE 
J023001G03GCTGGGCCGAAANONE 
J023024D14GCTGGGCCGAAANONE 
J023072E11GCTGGGCCGAAANONE 
J023149E18GCTGGGCCGAAANONE 
J033029B16GCTGGGCCGAAANONE 
J065001O21GCTGGGCCGAAANONE 
J065035B04GCTGGGCCGAAANONE 
J065044D18GCTGGGCCGAAANONE 
J065057F12GCTGGGCCGAAANONE 
J065060A11GCTGGGCCGAAANONE 
J065062G15GCTGGGCCGAAANONE 
J065080F13GCTGGGCCGAAANONE 
J065084N12GCTGGGCCGAAANONE 
J065101D02GCTGGGCCGAAANONE 
J065107C07GCTGGGCCGAAANONE 
J065112N24GCTGGGCCGAAANONE 
J065141I16GCTGGGCCGAAANONE 
J065147D05GCTGGGCCGAAANONE 
J065167H02GCTGGGCCGAAANONE 
J065207K23GCTGGGCCGAAANONE 
J075008E16GCTGGGCCGAAANONE 
J075014F03GCTGGGCCGAAANONE 
J075015O17GCTGGGCCGAAANONE 
J075020H20GCTGGGCCGAAANONE 
J075021E22GCTGGGCCGAAANONE 
J075023N13GCTGGGCCGAAANONE 
J075028H10GCTGGGCCGAAANONE 
J075040F20GCTGGGCCGAAANONE 
J075051L23GCTGGGCCGAAANONE 
J075069G16GCTGGGCCGAAANONE 
J075084F24GCTGGGCCGAAANONE 
J075090H09GCTGGGCCGAAANONE 
J075092M21GCTGGGCCGAAANONE 
J075110C10GCTGGGCCGAAANONE 
J075111J12GCTGGGCCGAAANONE 
J075114L04GCTGGGCCGAAANONE 
J075139E02GCTGGGCCGAAANONE 
J075160M10GCTGGGCCGAAANONE 
J075176J03GCTGGGCCGAAANONE 
J075183I17GCTGGGCCGAAANONE 
J075191N10GCTGGGCCGAAANONE 
J075193D07GCTGGGCCGAAANONE 
J075194M16GCTGGGCCGAAANONE 
J075197K04GCTGGGCCGAAANONE 
J080032I11GCTGGGCCGAAANONE 
J080076M11GCTGGGCCGAAANONE 
J080311J08GCTGGGCCGAAANONE 
J080317E05GCTGGGCCGAAANONE 
J090034L08GCTGGGCCGAAANONE 
J100040D19GCTGGGCCGAAANONE 
J100074C11GCTGGGCCGAAANONE 
Os07g0570700AK065242TTCGGCCCAACTRibosome recycling factor family protein. 
J013002I12TTCGGCCCAACTNONE 
Os07g0573600AK073925GTTTGGGCCGGGCCGAAAREX1 DNA Repair family protein. 
J033072E11GTTTGGGCCGGGCCGAAANONE 
Os07g0578600AK067155TTCGGCCCGGCCCACTCCSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065TTCGGCCCGGCCCACTCCNONE 
Os07g0607200AK065746TTCGGCCCAACAProtein of unknown function DUF751 family protein. 
J065037B15TTCGGCCCAACANONE 
J065042E20TTCGGCCCAACANONE 
J065161I08TTCGGCCCAACANONE 
Os07g0634300AK109879TTTCGGCCCAGCCCATConserved hypothetical protein. 
J100035O13TTTCGGCCCAGCCCATNONE 
J100039D07TTTCGGCCCAGCCCATNONE 
J100039F13TTTCGGCCCAGCCCATNONE 
Os07g0639800AK074012TTCGGCCCATTSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592TTCGGCCCATTNONE 
AK104739TTCGGCCCATTNONE 
Os07g0639900J080305F09TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080305J22TCGTGGGCCGGGCCGGGCCGGGCCGAAThymidylate kinase domain containing protein. 
J080311G07TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080315B14TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080317C02TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
Os07g0681700AK103213TTTCGGCCCAGCGlycosyl transferase, family 8 protein. 
Os07g0687300AK073043TTTCGGCCCAACASimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os07g0691100AK071728TTATGGGCCGAASimilar to Pectin methylesterase 6 (Fragment). 
J023108P03TTATGGGCCGAANONE 
J023112F11TTATGGGCCGAANONE 
J023143A10TTATGGGCCGAANONE 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
Os08g0233300AK067421AACTGGGCCGAANONE 
AK067421TACTGGGCCGAANONE 
AK120342AACTGGGCCGAAConserved hypothetical protein. 
AK120342TACTGGGCCGAAConserved hypothetical protein. 
J013061K19AACTGGGCCGAANONE 
J013061K19TACTGGGCCGAANONE 
J013106J20AACTGGGCCGAANONE 
J013106J20TACTGGGCCGAANONE 
J023022P16AACTGGGCCGAANONE 
J023022P16TACTGGGCCGAANONE 
J090015I03AACTGGGCCGAANONE 
J090015I03TACTGGGCCGAANONE 
Os08g0270200AK101221TTATGGGCCGAAAExosome-associated family protein. 
J090067H03TTATGGGCCGAAANONE 
Os08g0327400AK070992GGGCCGAASimilar to Enoyl-ACP reductase (Fragment). 
J023077K10GGGCCGAANONE 
J065075F06GGGCCGAANONE 
J065112N14GGGCCGAANONE 
J090028K07GGGCCGAANONE 
J090039C15GGGCCGAANONE 
J090048I11GGGCCGAANONE 
J090083M10GGGCCGAANONE 
Os08g0389700009-141-B12GGGCCGAANONE 
J013001N20GGGCCGAANONE 
J043040L02GGGCCGAANONE 
Os08g0411200AK120890AGGTGGGCCGAASAM (and some other nucleotide) binding motif domain containing protein. 
AK120890TTCGGCCCGCASAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0433200013-023-E07TATGGGCCGAAANONE 
AK099471TATGGGCCGAAAConserved hypothetical protein. 
J013024A05TATGGGCCGAAANONE 
J013065N03TATGGGCCGAAANONE 
J023111A21TATGGGCCGAAANONE 
J065035F10TATGGGCCGAAANONE 
J065083H01TATGGGCCGAAANONE 
J065159E03TATGGGCCGAAANONE 
J065186A03TATGGGCCGAAANONE 
J075032B02TATGGGCCGAAANONE 
J075038L14TATGGGCCGAAANONE 
J075047N21TATGGGCCGAAANONE 
J075076H05TATGGGCCGAAANONE 
J075110C08TATGGGCCGAAANONE 
J090096K17TATGGGCCGAAANONE 
Os08g0441400011-033-F01TTCGGCCCAGTANONE 
015-084-B04TTCGGCCCAGTANONE 
AK063317TTCGGCCCAGTANONE 
AK064141TTCGGCCCAGTAConserved hypothetical protein. 
J065060F06TTCGGCCCAGTANONE 
J075110A22TTCGGCCCAGTANONE 
J080307P11TTCGGCCCAGTANONE 
J090041E06TTCGGCCCAGTANONE 
Os08g0461300AK065651TTCGGCCCACGGGCyclin-like F-box domain containing protein. 
Os08g0496000011-009-D02AGCCCATTCGGCCCAAACNONE 
AK103187AGCCCATTCGGCCCAAACCytochrome oxidase assembly family protein. 
J033121L24AGCCCATTCGGCCCAAACNONE 
J033149A07AGCCCATTCGGCCCAAACNONE 
J065198L20AGCCCATTCGGCCCAAACNONE 
J090096F24AGCCCATTCGGCCCAAACNONE 
Os08g0504400014-015-C10TCATGGGCCGAANONE 
AK069190TCATGGGCCGAASimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089TCATGGGCCGAANONE 
J023006O19TCATGGGCCGAANONE 
J033041C11TCATGGGCCGAANONE 
Os08g0510900AK069250TTCGGCCCConserved hypothetical protein. 
Os09g0109600013-044-D05TTCGGCCCNONE 
AK063582TTCGGCCCConserved hypothetical protein. 
Os09g0128400016-092-E05GGGCCGAANONE 
AK059696GGGCCGAANONE 
AK103118GGGCCGAAConserved hypothetical protein. 
Os09g0243200AK107718TCCGGGCCGAAZinc finger, RING-type domain containing protein. 
Os09g0261300AK059648TTTCGGCCCGCASimilar to 4-nitrophenylphosphatase-like protein. 
AK121797TTTCGGCCCGCANONE 
J033095P18TTTCGGCCCGCANONE 
J043039L01TTTCGGCCCGCANONE 
J065153N19TTTCGGCCCGCANONE 
Os09g0325300011-005-H08TTTCGGCCCAATTNONE 
AK068435TTTCGGCCCAATTConserved hypothetical protein. 
AK073998TTTCGGCCCAATTNONE 
J033071H21TTTCGGCCCAATTNONE 
J065214H05TTTCGGCCCAATTNONE 
Os09g0338400AK059171AACGGGCCGAANONE 
AK068798AACGGGCCGAANONE 
AK072043AACGGGCCGAANONE 
AK098947AACGGGCCGAASimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0409000AK107676TTTCGGCCCConserved hypothetical protein. 
Os09g0411700005-017-C05TTCGGCCCAAGNONE 
009-163-B01TTCGGCCCAAGNONE 
AK058290TTCGGCCCAAGPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919TTCGGCCCAAGNONE 
AK121091TTCGGCCCAAGNONE 
J013039D20TTCGGCCCAAGNONE 
J023066F16TTCGGCCCAAGNONE 
J023082H09TTCGGCCCAAGNONE 
J023088H05TTCGGCCCAAGNONE 
J065013G09TTCGGCCCAAGNONE 
J065065C12TTCGGCCCAAGNONE 
J065111I04TTCGGCCCAAGNONE 
J065179H22TTCGGCCCAAGNONE 
J075023N14TTCGGCCCAAGNONE 
J090041J17TTCGGCCCAAGNONE 
J100031J21TTCGGCCCAAGNONE 
J100057A18TTCGGCCCAAGNONE 
J100068P22TTCGGCCCAAGNONE 
Os09g0450901J065009G09GTTTGGGCCGAANONE 
J065015O13GTTTGGGCCGAANONE 
J065082C06GTTTGGGCCGAAConserved hypothetical protein. 
Os09g0459800AK060764ACATGGGCCGAANONE 
AK100324ACATGGGCCGAASimilar to ARP protein. 
AK102736ACATGGGCCGAANONE 
Os09g0467100012-085-D01TTCGGCCCAAACNONE 
AK063444TTCGGCCCAAACSAICAR synthetase family protein. 
J065083E16TTCGGCCCAAACNONE 
Os09g0512900006-066-A10TTCGGCCCATCTNONE 
AK061814TTCGGCCCATCTConserved hypothetical protein. 
AK066925TTCGGCCCATCTNONE 
AK104595TTCGGCCCATCTNONE 
J013092F14TTCGGCCCATCTNONE 
J023148N20TTCGGCCCATCTNONE 
J033131F06TTCGGCCCATCTNONE 
J053025L20TTCGGCCCATCTNONE 
J075003B20TTCGGCCCATCTNONE 
J075019N18TTCGGCCCATCTNONE 
J075032D10TTCGGCCCATCTNONE 
J075037G14TTCGGCCCATCTNONE 
J075098D24TTCGGCCCATCTNONE 
J075106M13TTCGGCCCATCTNONE 
J075122N14TTCGGCCCATCTNONE 
J075146E22TTCGGCCCATCTNONE 
J075187E06TTCGGCCCATCTNONE 
J075198I17TTCGGCCCATCTNONE 
J090023O05TTCGGCCCATCTNONE 
J100040E10TTCGGCCCATCTNONE 
J100080P12TTCGGCCCATCTNONE 
J100088B06TTCGGCCCATCTNONE 
Os09g0521700014-005-C08TTCGGCCCNONE 
AK063628TTCGGCCCSimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507TTCGGCCCNONE 
Os09g0531900AK073015CCTCGCCCACAAATGGGCCGAAASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0549700J053039F06TAATGGGCTTTCGGCCCATGTNONE 
J065089F23TAATGGGCTTTCGGCCCATGTRibosomal protein L18P/L5E family protein. 
J065090G14TAATGGGCTTTCGGCCCATGTNONE 
J065093M17TAATGGGCTTTCGGCCCATGTNONE 
J065096L23TAATGGGCTTTCGGCCCATGTNONE 
J065152A18TAATGGGCTTTCGGCCCATGTNONE 
J065155H12TAATGGGCTTTCGGCCCATGTNONE 
Os11g0130300AK059597TTCGGCCCGCANse1 non-SMC component of SMC5-6 complex family protein. 
AK101224TTCGGCCCGCANONE 
J033031D09TTCGGCCCGCANONE 
J033135B02TTCGGCCCGCANONE 
J100021A17TTCGGCCCGCANONE 
J100066G09TTCGGCCCGCANONE 
Os11g0139500AK121845AAATGGGCCGAAANONE 
Os11g0146700AK065900CGGGCCGAANONE 
AK072412CGGGCCGAARED-like, C-terminal family protein. 
Os11g0497000AK111924GGGCCGAAASimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GGGCCGAAANONE 
J065097A08GGGCCGAAANONE 
J065123J10GGGCCGAAANONE 
J075096F04GGGCCGAAANONE 
J080065C15GGGCCGAAANONE 
J090033J04GGGCCGAAANONE 
J090072N23GGGCCGAAANONE 
J100021E08GGGCCGAAANONE 
J100063H21GGGCCGAAANONE 
Os11g0539000AK071015TTTCGGCCCATCAConserved hypothetical protein. 
J023081E02TTTCGGCCCATCANONE 
Os11g0616200AK069189ATATGGGCTTTCGGCCCAAATConserved hypothetical protein. 
AK069189ATTTGGGCCGAAAGCCCAAAAConserved hypothetical protein. 
J023004N19ATATGGGCTTTCGGCCCAAATNONE 
J023004N19ATTTGGGCCGAAAGCCCAAAANONE 
Os11g0620300AJ704770CGGGCCGAAANONE 
AK107901CGGGCCGAAASimilar to Nonspecific lipid-transfer protein 2 (LTP 2). 
J075006M12CGGGCCGAAANONE 
J075046J22CGGGCCGAAANONE 
Os12g0120000011-024-E09ACATGGGCCGAAANONE 
AK105399ACATGGGCCGAAAProtein of unknown function DUF936, plant family protein. 
Os12g0124400AK071024ATATGGGCCGAAExostosin-like family protein. 
Os12g0125200J065062L18AGATGGGCCGAAConserved hypothetical protein. 
Os12g0150100009-047-B11ACCGGGCCGAAANONE 
AK105075ACCGGGCCGAAASimilar to 60S ribosomal protein L26A. 
J013067G22ACCGGGCCGAAANONE 
J033103F08ACCGGGCCGAAANONE 
J065029P11ACCGGGCCGAAANONE 
J065043B18ACCGGGCCGAAANONE 
J065123E16ACCGGGCCGAAANONE 
J065141O20ACCGGGCCGAAANONE 
J065161O04ACCGGGCCGAAANONE 
J065201M07ACCGGGCCGAAANONE 
J075058I23ACCGGGCCGAAANONE 
J075172J08ACCGGGCCGAAANONE 
J100040L13ACCGGGCCGAAANONE 
Os12g0238100AK064983GGGCCGAAExocyst complex component Sec10 family protein. 
Os12g0256300AK073908TTCGGCCCGGTSimilar to Schizosaccharomyces pombe (Fragment). 
AK099579TTCGGCCCGGTNONE 
Os12g0554400AK072345TTCGGCCCGTetratricopeptide-like helical domain containing protein. 
Os12g0556100J065083C21TTTCGGCCCATCADrought induced 19 family protein. 
J065124M18TTTCGGCCCATCANONE 
J100032P22TTTCGGCCCATCANONE 
J100048N01TTTCGGCCCATCANONE 
Os12g0611000AK111837TTCGGCCCAACCSimilar to Zinc-finger protein Lsd1. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.