version

Summary of OsREG643 (All List)

OrganismOryza sativa  
IDOsREG643  
SequenceGGGCCGCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1160  

Entry Sequences (1160 entries)

LocusGene modelSequenceDescription
Os01g0132800AK068422TGCGGCCCACGTPeptidyl-tRNA hydrolase family protein. 
Os01g0139200J023061K13TGCGGCCCNONE 
J053024M09TGCGGCCCNONE 
J053047C19TGCGGCCCNONE 
Os01g0166800AK073783GGGCCGCAConserved hypothetical protein. 
AK099378GGGCCGCANONE 
J033026H10GGGCCGCANONE 
J033067O18GGGCCGCANONE 
J033108A17GGGCCGCANONE 
J065015J11GGGCCGCANONE 
J065204P09GGGCCGCANONE 
Os01g0179901J075009I05TGCGGCCCAATTAGGGCCCAACTNONE 
J075058D09TGCGGCCCAATTAGGGCCCAACTNONE 
J075153K16TGCGGCCCAATTAGGGCCCAACTConserved hypothetical protein. 
Os01g0193400AK069948TGCGGCCCAGANONE 
AK099271TGCGGCCCAGANONE 
AK107005TGCGGCCCAGAConserved hypothetical protein. 
Os01g0220300009-063-C12GGGCCGCANONE 
AK105167GGGCCGCAConserved hypothetical protein. 
J065124E17GGGCCGCANONE 
J090096L11GGGCCGCANONE 
Os01g0226700014-020-B10TGCGGCCCAGCCNONE 
AK063653TGCGGCCCAGCCProtein of unknown function DUF623, plant domain containing protein. 
Os01g0270100006-096-H09TGTGGGCCGCANONE 
009-009-C10TGTGGGCCGCANONE 
009-054-E06TGTGGGCCGCANONE 
014-085-F09TGTGGGCCGCANONE 
AK073275TGTGGGCCGCANONE 
AK104155TGTGGGCCGCANONE 
AK119511TGTGGGCCGCASimilar to Cysteine protease inhibitor. 
J033025K21TGTGGGCCGCANONE 
J075065H10TGTGGGCCGCANONE 
J075143G10TGTGGGCCGCANONE 
J100059J02TGTGGGCCGCANONE 
Os01g0270300006-026-A05GGGCCGCANONE 
AK060365GGGCCGCANONE 
AK101508GGGCCGCASimilar to Cationic peroxidase isozyme 40K precursor. 
AK103467GGGCCGCANONE 
J033084K19GGGCCGCANONE 
J033105B06GGGCCGCANONE 
J100043C10GGGCCGCANONE 
Os01g0283000AK073165CTGGCCCATTTGCGGCCCAGTConserved hypothetical protein. 
J033023G08CTGGCCCATTTGCGGCCCAGTNONE 
Os01g0283100004-018-B01ACTGGGCCGCAAATGGGCCAGNONE 
AK060908ACTGGGCCGCAAATGGGCCAGNONE 
AK071713ACTGGGCCGCAAATGGGCCAGSimilar to Ferripyochelin-binding protein-like. 
AK104205ACTGGGCCGCAAATGGGCCAGNONE 
AK122051ACTGGGCCGCAAATGGGCCAGNONE 
J023109L19ACTGGGCCGCAAATGGGCCAGNONE 
Os01g0299400AK107814TGCGGCCCAAAASterile alpha motif homology domain containing protein. 
J065112H10TGCGGCCCAAAANONE 
Os01g0303800006-024-G06TGCGGCCCAAANONE 
006-025-F12TGCGGCCCAAANONE 
006-085-E12TGCGGCCCAAANONE 
006-092-F12TGCGGCCCAAANONE 
AK060078TGCGGCCCAAAUniversal stress protein (Usp) family protein. 
AK121626TGCGGCCCAAANONE 
J023044K21TGCGGCCCAAANONE 
J023069K09TGCGGCCCAAANONE 
J023091A17TGCGGCCCAAANONE 
J033048C05TGCGGCCCAAANONE 
J033126M13TGCGGCCCAAANONE 
J065040E06TGCGGCCCAAANONE 
J065060D14TGCGGCCCAAANONE 
Os01g0525000015-038-B04TGCGGCCCNONE 
AK064104TGCGGCCCConserved hypothetical protein. 
Os01g0606900AK065697CCCGGGCCGCAHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0616600009-171-H09ATTTGGGCCGCANONE 
011-005-G09ATTTGGGCCGCANONE 
012-089-C03ATTTGGGCCGCANONE 
AK063911ATTTGGGCCGCAProtein prenyltransferase domain containing protein. 
AK101490ATTTGGGCCGCANONE 
Os01g0639900004-009-H08GCCCAGCCGGGCCGCANONE 
006-050-F07GCCCAGCCGGGCCGCANONE 
006-120-D04GCCCAGCCGGGCCGCANONE 
AF182806GCCCAGCCGGGCCGCANONE 
AK060890GCCCAGCCGGGCCGCASimilar to Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase). 
AK099825GCCCAGCCGGGCCGCANONE 
J075022I06GCCCAGCCGGGCCGCANONE 
U08404GCCCAGCCGGGCCGCANONE 
Os01g0640800AK065688CTTGGGCCGCAConserved hypothetical protein 48 family protein. 
J013042L10CTTGGGCCGCANONE 
J013121H08CTTGGGCCGCANONE 
Os01g0666500AK102689CTTGGGCCGCAConserved hypothetical protein. 
Os01g0743400AK059177TCCGGGCCGCASimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114TCCGGGCCGCANONE 
J065070E07TCCGGGCCGCANONE 
J065152G11TCCGGGCCGCANONE 
Os01g0782200AK072068TCTGGGCCGCANONE 
AK107062TCTGGGCCGCADiacylglycerol kinase, catalytic region domain containing protein. 
Os01g0801600AY224556TGCGGCCCNONE 
Os01g0911700012-079-H01CGCCACGTGTGGGCCGCANONE 
012-088-G05CGCCACGTGTGGGCCGCANONE 
012-099-A01CGCCACGTGTGGGCCGCANONE 
015-009-H07CGCCACGTGTGGGCCGCANONE 
015-035-H12CGCCACGTGTGGGCCGCANONE 
016-054-G03CGCCACGTGTGGGCCGCANONE 
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1. 
AK105441CGCCACGTGTGGGCCGCANONE 
J033069I02CGCCACGTGTGGGCCGCANONE 
J033086K01CGCCACGTGTGGGCCGCANONE 
Os01g0958100AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
Os01g0960300AK100099TGCGGCCCAAGSimilar to Glucose inhibited division protein A. 
Os02g0135600AK069843TGCGGCCCAATTCAGCCCATGTConserved hypothetical protein. 
J023034H09TGCGGCCCAATTCAGCCCATGTNONE 
J033090D08TGCGGCCCAATTCAGCCCATGTNONE 
J100025N07TGCGGCCCAATTCAGCCCATGTNONE 
J100075G18TGCGGCCCAATTCAGCCCATGTNONE 
Os02g0135700AK100570ACATGGGCTGAATTGGGCCGCADNA polymerase V family protein. 
Os02g0187600AK069783CGATGGGCCGCANONE 
AK109387CGATGGGCCGCAConserved hypothetical protein. 
J090029C18CGATGGGCCGCANONE 
Os02g0192300Os02g0192300TGCGGCCCZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0192300TGCGGCCCGCAZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0193500009-092-G09TGCGGCCCACGCGNONE 
AK101237TGCGGCCCACGCGHypothetical protein. 
J033031K13TGCGGCCCACGCGNONE 
J033034P12TGCGGCCCACGCGNONE 
J080304L19TGCGGCCCACGCGNONE 
J100059N21TGCGGCCCACGCGNONE 
Os02g0219200016-016-C03AATTGGGCCGCANONE 
AK059059AATTGGGCCGCASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase) (Exo-(1-->4)-beta-D-galactanase). 
Os02g0301100006-029-F04GGGCCGCANONE 
012-005-F07GGGCCGCANONE 
013-093-H10GGGCCGCANONE 
015-042-B01GGGCCGCANONE 
016-017-F09GGGCCGCANONE 
016-079-B07GGGCCGCANONE 
016-079-G03GGGCCGCANONE 
016-087-F11GGGCCGCANONE 
AK071676GGGCCGCANONE 
AK100174GGGCCGCAMtN3 and saliva related transmembrane protein family protein. 
AK104411GGGCCGCANONE 
AK104467GGGCCGCANONE 
J023069G02GGGCCGCANONE 
J023108F17GGGCCGCANONE 
J033042B04GGGCCGCANONE 
J033128D06GGGCCGCANONE 
J033138I12GGGCCGCANONE 
J053064K16GGGCCGCANONE 
J065088A12GGGCCGCANONE 
J065102L08GGGCCGCANONE 
J065104L14GGGCCGCANONE 
J065117M20GGGCCGCANONE 
J065117N14GGGCCGCANONE 
J065120H23GGGCCGCANONE 
J065135F06GGGCCGCANONE 
J065138J17GGGCCGCANONE 
J065138P06GGGCCGCANONE 
J065156G16GGGCCGCANONE 
J065163M20GGGCCGCANONE 
J065176A14GGGCCGCANONE 
J065182C02GGGCCGCANONE 
J065200C05GGGCCGCANONE 
J065213J22GGGCCGCANONE 
J065217D24GGGCCGCANONE 
J075009H03GGGCCGCANONE 
J075020D10GGGCCGCANONE 
J075026L24GGGCCGCANONE 
J075028L01GGGCCGCANONE 
J075057O09GGGCCGCANONE 
J075089A20GGGCCGCANONE 
J075094J15GGGCCGCANONE 
J075103B11GGGCCGCANONE 
J075143L13GGGCCGCANONE 
J075153K15GGGCCGCANONE 
J075161P22GGGCCGCANONE 
J075166J06GGGCCGCANONE 
J075177G06GGGCCGCANONE 
J075198N06GGGCCGCANONE 
Os02g0456500Os02g0456500GGGCCGCANONE 
Os02g0465900006-021-E11TGCGGCCCNONE 
006-033-A08TGCGGCCCNONE 
006-040-B12TGCGGCCCNONE 
006-051-D06TGCGGCCCNONE 
006-059-G11TGCGGCCCNONE 
006-066-B01TGCGGCCCNONE 
006-067-H07TGCGGCCCNONE 
006-073-G04TGCGGCCCNONE 
006-074-C07TGCGGCCCNONE 
006-084-C11TGCGGCCCNONE 
006-095-B07TGCGGCCCNONE 
006-100-A04TGCGGCCCNONE 
012-034-E07TGCGGCCCNONE 
012-036-E03TGCGGCCCNONE 
012-040-C12TGCGGCCCNONE 
013-080-E03TGCGGCCCNONE 
015-053-G09TGCGGCCCNONE 
AK071205TGCGGCCCChaC-like protein family protein. 
AK104187TGCGGCCCNONE 
AK104223TGCGGCCCNONE 
AK104241TGCGGCCCNONE 
AK104351TGCGGCCCNONE 
AK104503TGCGGCCCNONE 
AK104516TGCGGCCCNONE 
AK119187TGCGGCCCNONE 
J013045B01TGCGGCCCNONE 
J013152E13TGCGGCCCNONE 
J023045P04TGCGGCCCNONE 
J023085D08TGCGGCCCNONE 
J033072J17TGCGGCCCNONE 
J033091M15TGCGGCCCNONE 
J033112K18TGCGGCCCNONE 
J033117D13TGCGGCCCNONE 
J033132D10TGCGGCCCNONE 
J065001A16TGCGGCCCNONE 
J065001O09TGCGGCCCNONE 
J065014D08TGCGGCCCNONE 
J065014D10TGCGGCCCNONE 
J065029N20TGCGGCCCNONE 
J065033H15TGCGGCCCNONE 
J065035F22TGCGGCCCNONE 
J065055L07TGCGGCCCNONE 
J065059C06TGCGGCCCNONE 
J065071K08TGCGGCCCNONE 
J065095C11TGCGGCCCNONE 
J065104D05TGCGGCCCNONE 
J065106O08TGCGGCCCNONE 
J065109K19TGCGGCCCNONE 
J065116M19TGCGGCCCNONE 
J065120I08TGCGGCCCNONE 
J065121E02TGCGGCCCNONE 
J065130B04TGCGGCCCNONE 
J065130J19TGCGGCCCNONE 
J065152C11TGCGGCCCNONE 
J065156A05TGCGGCCCNONE 
J065158B09TGCGGCCCNONE 
J065177K09TGCGGCCCNONE 
J065189D08TGCGGCCCNONE 
J065190F07TGCGGCCCNONE 
J065192B08TGCGGCCCNONE 
J065205K21TGCGGCCCNONE 
J065212B04TGCGGCCCNONE 
J065215N20TGCGGCCCNONE 
J065219C13TGCGGCCCNONE 
J075010F13TGCGGCCCNONE 
J075019K23TGCGGCCCNONE 
J075023D01TGCGGCCCNONE 
J075027B08TGCGGCCCNONE 
J075028M09TGCGGCCCNONE 
J075033E06TGCGGCCCNONE 
J075059M13TGCGGCCCNONE 
J075060E22TGCGGCCCNONE 
J075067M14TGCGGCCCNONE 
J075068N13TGCGGCCCNONE 
J075071N03TGCGGCCCNONE 
J075077I07TGCGGCCCNONE 
J075079B05TGCGGCCCNONE 
J075089H20TGCGGCCCNONE 
J075102N17TGCGGCCCNONE 
J075111M15TGCGGCCCNONE 
J075116A22TGCGGCCCNONE 
J075118D14TGCGGCCCNONE 
J075118I21TGCGGCCCNONE 
J075120N07TGCGGCCCNONE 
J075120P05TGCGGCCCNONE 
J075136D24TGCGGCCCNONE 
J075140E20TGCGGCCCNONE 
J075140O14TGCGGCCCNONE 
J075141L11TGCGGCCCNONE 
J075149C24TGCGGCCCNONE 
J075150G13TGCGGCCCNONE 
J075153F09TGCGGCCCNONE 
J075158M04TGCGGCCCNONE 
J075168O20TGCGGCCCNONE 
J075172A15TGCGGCCCNONE 
J075183D08TGCGGCCCNONE 
J075191B13TGCGGCCCNONE 
J075195C07TGCGGCCCNONE 
J080010N22TGCGGCCCNONE 
J080016C04TGCGGCCCNONE 
J080079O19TGCGGCCCNONE 
J080086D17TGCGGCCCNONE 
J080303I21TGCGGCCCNONE 
J080306L05TGCGGCCCNONE 
J080307D10TGCGGCCCNONE 
J080307G04TGCGGCCCNONE 
J080308K23TGCGGCCCNONE 
J080312C13TGCGGCCCNONE 
J080313O09TGCGGCCCNONE 
J080315D04TGCGGCCCNONE 
J080315E01TGCGGCCCNONE 
J080316C06TGCGGCCCNONE 
J080316N06TGCGGCCCNONE 
J080317O06TGCGGCCCNONE 
J080318C06TGCGGCCCNONE 
J080318C18TGCGGCCCNONE 
J080318J03TGCGGCCCNONE 
J080319E07TGCGGCCCNONE 
J090023P03TGCGGCCCNONE 
J090084G14TGCGGCCCNONE 
J090093J19TGCGGCCCNONE 
J100030G01TGCGGCCCNONE 
J100044I24TGCGGCCCNONE 
J100048M18TGCGGCCCNONE 
J100068K19TGCGGCCCNONE 
Os02g0556100006-100-D03GGGCCGCACCCGGCCCNONE 
AK059938GGGCCGCACCCGGCCCNONE 
AK103125GGGCCGCACCCGGCCCNAD-dependent epimerase/dehydratase family protein. 
J033107B22GGGCCGCACCCGGCCCNONE 
J033119M03GGGCCGCACCCGGCCCNONE 
J033120L06GGGCCGCACCCGGCCCNONE 
J043007B02GGGCCGCACCCGGCCCNONE 
J043012G03GGGCCGCACCCGGCCCNONE 
J043024A02GGGCCGCACCCGGCCCNONE 
J043027J18GGGCCGCACCCGGCCCNONE 
J100019E06GGGCCGCACCCGGCCCNONE 
J100069C22GGGCCGCACCCGGCCCNONE 
Os02g0574900AK073087TGCGGGCCGCACyclin-like F-box domain containing protein. 
J033023M04TGCGGGCCGCANONE 
J033117N08TGCGGGCCGCANONE 
J075008F16TGCGGGCCGCANONE 
J075075I19TGCGGGCCGCANONE 
J075079A06TGCGGGCCGCANONE 
J075086I07TGCGGGCCGCANONE 
J075088F13TGCGGGCCGCANONE 
J075093D04TGCGGGCCGCANONE 
J075163C10TGCGGGCCGCANONE 
Os02g0591800AK060611TGTGGGCCGCABrix domain containing protein. 
AK102534TGTGGGCCGCANONE 
J075057H08TGTGGGCCGCANONE 
J075179P18TGTGGGCCGCANONE 
J080011H01TGTGGGCCGCANONE 
J080018E14TGTGGGCCGCANONE 
J080026N17TGTGGGCCGCANONE 
J080047A13TGTGGGCCGCANONE 
J080049C17TGTGGGCCGCANONE 
J080050G07TGTGGGCCGCANONE 
J080064D10TGTGGGCCGCANONE 
J080080A03TGTGGGCCGCANONE 
J080080G20TGTGGGCCGCANONE 
J080080I03TGTGGGCCGCANONE 
J080081H12TGTGGGCCGCANONE 
J080090K07TGTGGGCCGCANONE 
J080092O06TGTGGGCCGCANONE 
J080096B07TGTGGGCCGCANONE 
J080097M08TGTGGGCCGCANONE 
Os02g0600100AK071215GGGCCGCASimilar to 26S proteasome subunit RPN7. 
Os02g0643200AK106784TGCGGCCCACGCYABBY protein family protein. 
J075048L13TGCGGCCCACGCNONE 
Os02g0649700AK058221TGCGGCCCNONE 
Os02g0697600011-021-B01CTTGGGCCGCANONE 
AK121757CTTGGGCCGCAAAA ATPase domain containing protein. 
Os02g0712500003-128-B04GGGCCGCANONE 
AK100094GGGCCGCAProtein of unknown function DUF23 family protein. 
J023003P08GGGCCGCANONE 
J033070I23GGGCCGCANONE 
J065019B12GGGCCGCANONE 
J065021D22GGGCCGCANONE 
J065063H05GGGCCGCANONE 
J065103B14GGGCCGCANONE 
J065136I12GGGCCGCANONE 
J065195F24GGGCCGCANONE 
J090045N11GGGCCGCANONE 
Os02g0767900009-154-G01TGCGGCCCAGCCCNONE 
009-172-H09TGCGGCCCAGCCCNONE 
AK099885TGCGGCCCAGCCCGlutaredoxin 2 family protein. 
Os02g0795900012-075-B04TGCGGCCCACGANONE 
AK105305TGCGGCCCACGASimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21TGCGGCCCACGANONE 
Os02g0828200AK071199TGCGGCCCACAGCCCAATANONE 
Os03g0122200009-052-H10GCCGGGCCGCATGGGCCATNONE 
AB042934GCCGGGCCGCATGGGCCATNONE 
AK065033GCCGGGCCGCATGGGCCATSimilar to 50S ribosomal protein L11. 
J013001H03GCCGGGCCGCATGGGCCATNONE 
J023149C23GCCGGGCCGCATGGGCCATNONE 
J065025J15GCCGGGCCGCATGGGCCATNONE 
J065093D22GCCGGGCCGCATGGGCCATNONE 
Os03g0131200AB020502TGCGGCCCATGTNONE 
AK062174TGCGGCCCATGTNONE 
AK066378TGCGGCCCATGTSimilar to Catalase isozyme 2 (EC 1.11.1.6). 
AY339372TGCGGCCCATGTNONE 
J013060B21TGCGGCCCATGTNONE 
J013149P20TGCGGCCCATGTNONE 
J023060E16TGCGGCCCATGTNONE 
J043004A19TGCGGCCCATGTNONE 
J053029N09TGCGGCCCATGTNONE 
J053072I10TGCGGCCCATGTNONE 
J065016G02TGCGGCCCATGTNONE 
J065022E22TGCGGCCCATGTNONE 
J065024K17TGCGGCCCATGTNONE 
J065035E10TGCGGCCCATGTNONE 
J065036D13TGCGGCCCATGTNONE 
J065041E06TGCGGCCCATGTNONE 
J065064H14TGCGGCCCATGTNONE 
J065067I06TGCGGCCCATGTNONE 
J065080C01TGCGGCCCATGTNONE 
J065086K23TGCGGCCCATGTNONE 
J065087L12TGCGGCCCATGTNONE 
J065090I05TGCGGCCCATGTNONE 
J065117E23TGCGGCCCATGTNONE 
J065120A10TGCGGCCCATGTNONE 
J065120L22TGCGGCCCATGTNONE 
J065123F02TGCGGCCCATGTNONE 
J065128G02TGCGGCCCATGTNONE 
J065142B04TGCGGCCCATGTNONE 
J065143K12TGCGGCCCATGTNONE 
J065148B18TGCGGCCCATGTNONE 
J065153C16TGCGGCCCATGTNONE 
J065163J11TGCGGCCCATGTNONE 
J065168L24TGCGGCCCATGTNONE 
J065181J11TGCGGCCCATGTNONE 
J065190F19TGCGGCCCATGTNONE 
J065209E24TGCGGCCCATGTNONE 
J065210G04TGCGGCCCATGTNONE 
J065217H17TGCGGCCCATGTNONE 
J065219I20TGCGGCCCATGTNONE 
J075001M13TGCGGCCCATGTNONE 
J075007B08TGCGGCCCATGTNONE 
J075009I01TGCGGCCCATGTNONE 
J075014C11TGCGGCCCATGTNONE 
J075014L02TGCGGCCCATGTNONE 
J075016E07TGCGGCCCATGTNONE 
J075017J02TGCGGCCCATGTNONE 
J075018F07TGCGGCCCATGTNONE 
J075018N07TGCGGCCCATGTNONE 
J075019B06TGCGGCCCATGTNONE 
J075024F21TGCGGCCCATGTNONE 
J075026B18TGCGGCCCATGTNONE 
J075026M12TGCGGCCCATGTNONE 
J075032B13TGCGGCCCATGTNONE 
J075033O09TGCGGCCCATGTNONE 
J075041A09TGCGGCCCATGTNONE 
J075045L13TGCGGCCCATGTNONE 
J075048N11TGCGGCCCATGTNONE 
J075052A14TGCGGCCCATGTNONE 
J075061B17TGCGGCCCATGTNONE 
J075061I05TGCGGCCCATGTNONE 
J075066I11TGCGGCCCATGTNONE 
J075066P09TGCGGCCCATGTNONE 
J075068F03TGCGGCCCATGTNONE 
J075068P22TGCGGCCCATGTNONE 
J075080I15TGCGGCCCATGTNONE 
J075081I07TGCGGCCCATGTNONE 
J075082K01TGCGGCCCATGTNONE 
J075083A18TGCGGCCCATGTNONE 
J075086O11TGCGGCCCATGTNONE 
J075087E02TGCGGCCCATGTNONE 
J075087M19TGCGGCCCATGTNONE 
J075088G23TGCGGCCCATGTNONE 
J075092K18TGCGGCCCATGTNONE 
J075095H15TGCGGCCCATGTNONE 
J075095K12TGCGGCCCATGTNONE 
J075096L06TGCGGCCCATGTNONE 
J075100H23TGCGGCCCATGTNONE 
J075100K01TGCGGCCCATGTNONE 
J075102K21TGCGGCCCATGTNONE 
J075104F24TGCGGCCCATGTNONE 
J075106C17TGCGGCCCATGTNONE 
J075106E06TGCGGCCCATGTNONE 
J075106M19TGCGGCCCATGTNONE 
J075106O12TGCGGCCCATGTNONE 
J075108I09TGCGGCCCATGTNONE 
J075111M06TGCGGCCCATGTNONE 
J075112E12TGCGGCCCATGTNONE 
J075114C04TGCGGCCCATGTNONE 
J075120A06TGCGGCCCATGTNONE 
J075120D14TGCGGCCCATGTNONE 
J075122P15TGCGGCCCATGTNONE 
J075123A11TGCGGCCCATGTNONE 
J075123L12TGCGGCCCATGTNONE 
J075127G14TGCGGCCCATGTNONE 
J075127H09TGCGGCCCATGTNONE 
J075128M04TGCGGCCCATGTNONE 
J075129J04TGCGGCCCATGTNONE 
J075130J01TGCGGCCCATGTNONE 
J075137N02TGCGGCCCATGTNONE 
J075137O14TGCGGCCCATGTNONE 
J075138H22TGCGGCCCATGTNONE 
J075139P16TGCGGCCCATGTNONE 
J075141G08TGCGGCCCATGTNONE 
J075142C17TGCGGCCCATGTNONE 
J075143B09TGCGGCCCATGTNONE 
J075156I11TGCGGCCCATGTNONE 
J075158M03TGCGGCCCATGTNONE 
J075166I21TGCGGCCCATGTNONE 
J075167C08TGCGGCCCATGTNONE 
J075170C12TGCGGCCCATGTNONE 
J075170F08TGCGGCCCATGTNONE 
J075170G04TGCGGCCCATGTNONE 
J075172N16TGCGGCCCATGTNONE 
J075172P13TGCGGCCCATGTNONE 
J075173G24TGCGGCCCATGTNONE 
J075175D01TGCGGCCCATGTNONE 
J075175K01TGCGGCCCATGTNONE 
J075181O04TGCGGCCCATGTNONE 
J075186A04TGCGGCCCATGTNONE 
J075190B08TGCGGCCCATGTNONE 
J075190M24TGCGGCCCATGTNONE 
J075193D18TGCGGCCCATGTNONE 
J075193H03TGCGGCCCATGTNONE 
J075195N18TGCGGCCCATGTNONE 
J080001N20TGCGGCCCATGTNONE 
J080006K17TGCGGCCCATGTNONE 
J080012I16TGCGGCCCATGTNONE 
J080013K20TGCGGCCCATGTNONE 
J080018N01TGCGGCCCATGTNONE 
J080041G15TGCGGCCCATGTNONE 
J080048L15TGCGGCCCATGTNONE 
J080049A21TGCGGCCCATGTNONE 
J080075G12TGCGGCCCATGTNONE 
J080076O09TGCGGCCCATGTNONE 
J080078P10TGCGGCCCATGTNONE 
J080084D10TGCGGCCCATGTNONE 
J090005N07TGCGGCCCATGTNONE 
Os03g0143400AK073999ACATGGGCCGCASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21ACATGGGCCGCANONE 
J033073C08ACATGGGCCGCANONE 
J033094C19ACATGGGCCGCANONE 
J065017L10ACATGGGCCGCANONE 
J065070H22ACATGGGCCGCANONE 
J065079M09ACATGGGCCGCANONE 
J065091N18ACATGGGCCGCANONE 
J065109N03ACATGGGCCGCANONE 
J065113F05ACATGGGCCGCANONE 
J065135D23ACATGGGCCGCANONE 
J065156L16ACATGGGCCGCANONE 
J065207O04ACATGGGCCGCANONE 
J065208F03ACATGGGCCGCANONE 
J090010M15ACATGGGCCGCANONE 
J090056J18ACATGGGCCGCANONE 
Os03g0148700AK065978ACGTGGGGGCCGCASimilar to Calcium/calmodulin-regulated receptor-like kinase. 
Os03g0156500011-075-F02ATCGGACGGGCCGCANONE 
012-077-G10ATCGGACGGGCCGCANONE 
AK103466ATCGGACGGGCCGCALupus La protein family protein. 
J013088H17ATCGGACGGGCCGCANONE 
J013135G21ATCGGACGGGCCGCANONE 
J033050E10ATCGGACGGGCCGCANONE 
J033050J01ATCGGACGGGCCGCANONE 
J033129N23ATCGGACGGGCCGCANONE 
J065085L16ATCGGACGGGCCGCANONE 
J065101B19ATCGGACGGGCCGCANONE 
J065167N03ATCGGACGGGCCGCANONE 
J090009O21ATCGGACGGGCCGCANONE 
J090049D11ATCGGACGGGCCGCANONE 
J100017F23ATCGGACGGGCCGCANONE 
J100040E12ATCGGACGGGCCGCANONE 
J100055O18ATCGGACGGGCCGCANONE 
J100061K08ATCGGACGGGCCGCANONE 
J100072M05ATCGGACGGGCCGCANONE 
J100077B08ATCGGACGGGCCGCANONE 
J100086G03ATCGGACGGGCCGCANONE 
Os03g0218300015-078-G09TGCGGCCCConserved hypothetical protein. 
J090095I10TGCGGCCCNONE 
Os03g0238700AK073387TCGTGGGCCGCAGGCCCGCASimilar to Acid phosphatase type 5. 
J033043K11TCGTGGGCCGCAGGCCCGCANONE 
Os03g0256400AK073854GTTTGGGCCGCAGGGCCCACAASimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0287900009-074-B07GGGCCGCANONE 
014-027-E07GGGCCGCANONE 
AK063663GGGCCGCASimilar to Protein disulfide isomerase. 
J065009N21GGGCCGCANONE 
Os03g0309800004-019-H07GGATGGGCCGCANONE 
AK060922GGATGGGCCGCANONE 
AK098942GGATGGGCCGCANONE 
AK106141GGATGGGCCGCANONE 
AK111530GGATGGGCCGCANONE 
AK111624GGATGGGCCGCASimilar to PPR2. 
J013024C10GGATGGGCCGCANONE 
J013043D15GGATGGGCCGCANONE 
J013108I11GGATGGGCCGCANONE 
J100058L07GGATGGGCCGCANONE 
J100071I19GGATGGGCCGCANONE 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
J065009K18TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
J065165P09TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
Os03g0725300011-085-E09TGCGGCCCATANONE 
AK063969TGCGGCCCATASimilar to Dbr1-prov protein. 
AK073636TGCGGCCCATANONE 
J033050L15TGCGGCCCATANONE 
J053082G03TGCGGCCCATANONE 
Os03g0758700AK106620TGCGGCCCACGGWD40-like domain containing protein. 
Os03g0765000AK073918TGCGGCCCAACTSimilar to Serine/threonine-protein kinase 12 (EC 2.7.1.37) (Aurora-B) (Fragment). 
Os03g0824400AK070153TACGGCCCACGCTGCGGCCCNONE 
AK104298TACGGCCCACGCTGCGGCCCSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0850600AK067191TGCGGCCCAATConserved hypothetical protein. 
J013095N12TGCGGCCCAATNONE 
J065214L06TGCGGCCCAATNONE 
J075093J10TGCGGCCCAATNONE 
Os03g0854000009-186-C03TGTTGGGCCGCANONE 
AK061374TGTTGGGCCGCAProtein of unknown function UPF0131 family protein. 
J065138B11TGTTGGGCCGCANONE 
Os04g0115400015-048-B05AGTGGGCCGCANONE 
AK070523AGTGGGCCGCAD111/G-patch domain containing protein. 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE 
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE 
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE 
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE 
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE 
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE 
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE 
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE 
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE 
Os04g0413500AK072276TGCGGCCCSimilar to Cell wall invertase 2. 
AY340072TGCGGCCCNONE 
AY578159TGCGGCCCNONE 
Os04g0413600009-142-B05TGCGGCCCGCANONE 
AK121192TGCGGCCCGCASimilar to 40S ribosomal protein S14 (Clone MCH2). 
J023086F11TGCGGCCCGCANONE 
J065085D06TGCGGCCCGCANONE 
J075062H12TGCGGCCCGCANONE 
J075072I22TGCGGCCCGCANONE 
J075074H21TGCGGCCCGCANONE 
J075087L16TGCGGCCCGCANONE 
J075088D11TGCGGCCCGCANONE 
J075115N15TGCGGCCCGCANONE 
J100064G10TGCGGCCCGCANONE 
J100080E09TGCGGCCCGCANONE 
Os04g0418000006-025-C05ATTGGGCCGCANONE 
006-025-D11ATTGGGCCGCANONE 
006-045-F02ATTGGGCCGCANONE 
006-060-B04ATTGGGCCGCANONE 
006-063-E03ATTGGGCCGCANONE 
006-070-G08ATTGGGCCGCANONE 
006-072-H05ATTGGGCCGCANONE 
AK061030ATTGGGCCGCANONE 
AK099124ATTGGGCCGCANONE 
AK106155ATTGGGCCGCAConserved hypothetical protein. 
AK119714ATTGGGCCGCANONE 
J023039I07ATTGGGCCGCANONE 
J065025N03ATTGGGCCGCANONE 
Os04g0463700015-076-E11TGCGGCCCNONE 
AK064338TGCGGCCCNONE 
AK068918TGCGGCCCSimilar to ADL064Wp. 
AK102269TGCGGCCCNONE 
J013043H02TGCGGCCCNONE 
J013102E08TGCGGCCCNONE 
J013169C17TGCGGCCCNONE 
J033088P15TGCGGCCCNONE 
J065146O17TGCGGCCCNONE 
J075065M01TGCGGCCCNONE 
J075075C15TGCGGCCCNONE 
J075161L06TGCGGCCCNONE 
J075186B19TGCGGCCCNONE 
Os04g0477900006-046-B01ATTTGGGCCGCANONE 
006-103-C03ATTTGGGCCGCANONE 
006-106-F09ATTTGGGCCGCANONE 
009-093-B07ATTTGGGCCGCANONE 
AK059948ATTTGGGCCGCASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK104268ATTTGGGCCGCANONE 
J013158A11ATTTGGGCCGCANONE 
J023050E17ATTTGGGCCGCANONE 
J023078J03ATTTGGGCCGCANONE 
J033027G18ATTTGGGCCGCANONE 
J033086G10ATTTGGGCCGCANONE 
J090060G14ATTTGGGCCGCANONE 
Os04g0496600AK065058TGCGGCCCConserved hypothetical protein. 
J013001J09TGCGGCCCNONE 
J013037C18TGCGGCCCNONE 
J013126H05TGCGGCCCNONE 
J090062G17TGCGGCCCNONE 
Os04g0502300009-116-F02TGCGGCCCATGTNONE 
009-130-H06TGCGGCCCATGTNONE 
AK120520TGCGGCCCATGTSimilar to 40S ribosomal protein S11. 
J013124K01TGCGGCCCATGTNONE 
J023102F03TGCGGCCCATGTNONE 
J033094F17TGCGGCCCATGTNONE 
J053054C22TGCGGCCCATGTNONE 
J065024N13TGCGGCCCATGTNONE 
J065083J18TGCGGCCCATGTNONE 
J065132O14TGCGGCCCATGTNONE 
J065156M09TGCGGCCCATGTNONE 
J065176N15TGCGGCCCATGTNONE 
J065208H08TGCGGCCCATGTNONE 
J075054B03TGCGGCCCATGTNONE 
J090053E20TGCGGCCCATGTNONE 
J100075B09TGCGGCCCATGTNONE 
J100089H12TGCGGCCCATGTNONE 
Os04g0508100009-180-A02AACTGGGCCGAGTCATGGGCCGCANONE 
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein. 
J023007G10AACTGGGCCGAGTCATGGGCCGCANONE 
J033089A17AACTGGGCCGAGTCATGGGCCGCANONE 
J065193E13AACTGGGCCGAGTCATGGGCCGCANONE 
J075025M02AACTGGGCCGAGTCATGGGCCGCANONE 
J075027J10AACTGGGCCGAGTCATGGGCCGCANONE 
J075030N03AACTGGGCCGAGTCATGGGCCGCANONE 
J075045I20AACTGGGCCGAGTCATGGGCCGCANONE 
J075065E04AACTGGGCCGAGTCATGGGCCGCANONE 
J075134M16AACTGGGCCGAGTCATGGGCCGCANONE 
J075140B10AACTGGGCCGAGTCATGGGCCGCANONE 
Os04g0528100009-090-G06GGGCCGCANONE 
009-168-C11GGGCCGCANONE 
AK065957GGGCCGCAConserved hypothetical protein. 
J013039G20GGGCCGCANONE 
J013044D08GGGCCGCANONE 
J065013L14GGGCCGCANONE 
J065143H08GGGCCGCANONE 
J065146C14GGGCCGCANONE 
J065149K22GGGCCGCANONE 
J065156B18GGGCCGCANONE 
J065201A04GGGCCGCANONE 
J065209A04GGGCCGCANONE 
Os04g0658200J075021C22GGGCCGCAConserved hypothetical protein. 
Os04g0674100J080097J12TCATGGGCCGCAThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965TGCGGCCCATGANONE 
AK103795TGCGGCCCATGACoenzyme Q biosynthesis Coq4 family protein. 
J033076F14TGCGGCCCATGANONE 
J065020P20TGCGGCCCATGANONE 
J065057I21TGCGGCCCATGANONE 
J065059P11TGCGGCCCATGANONE 
J065083A22TGCGGCCCATGANONE 
J065093K10TGCGGCCCATGANONE 
J065097D03TGCGGCCCATGANONE 
J065103P05TGCGGCCCATGANONE 
J065113K09TGCGGCCCATGANONE 
J065118F23TGCGGCCCATGANONE 
J065119M06TGCGGCCCATGANONE 
J065146K17TGCGGCCCATGANONE 
J065161N12TGCGGCCCATGANONE 
J065169L02TGCGGCCCATGANONE 
J065189H12TGCGGCCCATGANONE 
J065192E24TGCGGCCCATGANONE 
J065193K17TGCGGCCCATGANONE 
J065197O21TGCGGCCCATGANONE 
J065214D09TGCGGCCCATGANONE 
J065217B11TGCGGCCCATGANONE 
J075132K07TGCGGCCCATGANONE 
J100059D14TGCGGCCCATGANONE 
Os04g0687300AK060617TGCGGCCCATAAHeat shock protein DnaJ, N-terminal domain containing protein. 
J065072M04TGCGGCCCATAANONE 
Os05g0103100AK103317GGGCCGCATranslocon-associated beta family protein. 
J033125H15GGGCCGCANONE 
J065021L01GGGCCGCANONE 
J065029M01GGGCCGCANONE 
J065089F17GGGCCGCANONE 
J065112N04GGGCCGCANONE 
J065163L03GGGCCGCANONE 
J065175B04GGGCCGCANONE 
J065192E02GGGCCGCANONE 
J075046C20GGGCCGCANONE 
J075192A01GGGCCGCANONE 
J100018H13GGGCCGCANONE 
J100067K20GGGCCGCANONE 
J100080N03GGGCCGCANONE 
Os05g0110100009-015-D08TGCGGCCCATATNONE 
009-023-C09TGCGGCCCATATNONE 
009-031-B11TGCGGCCCATATNONE 
009-034-C02TGCGGCCCATATNONE 
009-050-B08TGCGGCCCATATNONE 
009-065-D12TGCGGCCCATATNONE 
009-090-G08TGCGGCCCATATNONE 
009-111-H07TGCGGCCCATATNONE 
009-136-F12TGCGGCCCATATNONE 
009-138-E06TGCGGCCCATATNONE 
009-138-G12TGCGGCCCATATNONE 
009-141-D08TGCGGCCCATATNONE 
009-143-D01TGCGGCCCATATNONE 
009-179-D09TGCGGCCCATATNONE 
009-179-E03TGCGGCCCATATNONE 
009-196-A09TGCGGCCCATATNONE 
009-199-F04TGCGGCCCATATNONE 
013-021-E05TGCGGCCCATATNONE 
013-076-C04TGCGGCCCATATNONE 
013-096-F06TGCGGCCCATATNONE 
014-071-A05TGCGGCCCATATNONE 
014-077-F09TGCGGCCCATATNONE 
AK099779TGCGGCCCATATNONE 
AK121142TGCGGCCCATATConserved hypothetical protein. 
J013095A16TGCGGCCCATATNONE 
J013111A17TGCGGCCCATATNONE 
J013132G04TGCGGCCCATATNONE 
J023077M04TGCGGCCCATATNONE 
J065001B11TGCGGCCCATATNONE 
J065001E11TGCGGCCCATATNONE 
J065057G10TGCGGCCCATATNONE 
J065057L08TGCGGCCCATATNONE 
J065080E07TGCGGCCCATATNONE 
J065087K10TGCGGCCCATATNONE 
J065091M15TGCGGCCCATATNONE 
J065167A15TGCGGCCCATATNONE 
J075018F02TGCGGCCCATATNONE 
J075063F20TGCGGCCCATATNONE 
J075064F18TGCGGCCCATATNONE 
J075066N19TGCGGCCCATATNONE 
J075073I02TGCGGCCCATATNONE 
J075080P17TGCGGCCCATATNONE 
J075081F11TGCGGCCCATATNONE 
J075085E03TGCGGCCCATATNONE 
J075101G18TGCGGCCCATATNONE 
J075149N08TGCGGCCCATATNONE 
J075158I21TGCGGCCCATATNONE 
J075161M20TGCGGCCCATATNONE 
J075190F12TGCGGCCCATATNONE 
J075194K16TGCGGCCCATATNONE 
J080001E08TGCGGCCCATATNONE 
J080001F21TGCGGCCCATATNONE 
J080001H19TGCGGCCCATATNONE 
J080001O15TGCGGCCCATATNONE 
J080005I22TGCGGCCCATATNONE 
J080006K23TGCGGCCCATATNONE 
J080014D20TGCGGCCCATATNONE 
J080014I05TGCGGCCCATATNONE 
J080014K21TGCGGCCCATATNONE 
J080017I24TGCGGCCCATATNONE 
J080017K11TGCGGCCCATATNONE 
J080018F11TGCGGCCCATATNONE 
J080022L18TGCGGCCCATATNONE 
J080024N23TGCGGCCCATATNONE 
J080027J23TGCGGCCCATATNONE 
J080029B14TGCGGCCCATATNONE 
J080032F14TGCGGCCCATATNONE 
J080032K19TGCGGCCCATATNONE 
J080032O21TGCGGCCCATATNONE 
J080033P17TGCGGCCCATATNONE 
J080034I06TGCGGCCCATATNONE 
J080039F24TGCGGCCCATATNONE 
J080040O13TGCGGCCCATATNONE 
J080042B02TGCGGCCCATATNONE 
J080043E12TGCGGCCCATATNONE 
J080043J15TGCGGCCCATATNONE 
J080043N09TGCGGCCCATATNONE 
J080052J08TGCGGCCCATATNONE 
J080053K01TGCGGCCCATATNONE 
J080053K19TGCGGCCCATATNONE 
J080055J09TGCGGCCCATATNONE 
J080058D07TGCGGCCCATATNONE 
J080062F11TGCGGCCCATATNONE 
J080063J24TGCGGCCCATATNONE 
J080066H04TGCGGCCCATATNONE 
J080066I09TGCGGCCCATATNONE 
J080067B02TGCGGCCCATATNONE 
J080067N09TGCGGCCCATATNONE 
J080068D22TGCGGCCCATATNONE 
J080068K13TGCGGCCCATATNONE 
J080069N19TGCGGCCCATATNONE 
J080070D07TGCGGCCCATATNONE 
J080070E05TGCGGCCCATATNONE 
J080071G04TGCGGCCCATATNONE 
J080077G05TGCGGCCCATATNONE 
J080077O06TGCGGCCCATATNONE 
J080085F05TGCGGCCCATATNONE 
J080086E07TGCGGCCCATATNONE 
J080089G16TGCGGCCCATATNONE 
J080092K15TGCGGCCCATATNONE 
J080094A08TGCGGCCCATATNONE 
J080097A09TGCGGCCCATATNONE 
J080097J07TGCGGCCCATATNONE 
J090027N01TGCGGCCCATATNONE 
J090081J05TGCGGCCCATATNONE 
Os05g0110300AK067116TGCGGCCCAGTANONE 
AK071038TGCGGCCCAGTANAD-dependent epimerase/dehydratase family protein. 
J065060E20TGCGGCCCAGTANONE 
J065093K05TGCGGCCCAGTANONE 
Os05g0116600AK109828AGGTGGGCCGCATGGGCTTTF-box associated type 1 domain containing protein. 
Os05g0120800AK066865ATATGGGCCGCAConserved hypothetical protein. 
AK066865ATATGGGCCGCAConserved hypothetical protein. 
Os05g0139200AK108058TGCGGCCCACATGGGTCCCACCyclin-like F-box domain containing protein. 
Os05g0140800AK110652TGCGGCCCATAAAGGCCCAGATSimilar to Dormancy related protein (Fragment). 
J075019K14TGCGGCCCATAAAGGCCCAGATNONE 
J075020O11TGCGGCCCATAAAGGCCCAGATNONE 
J075028P06TGCGGCCCATAAAGGCCCAGATNONE 
J075050A16TGCGGCCCATAAAGGCCCAGATNONE 
J075051F18TGCGGCCCATAAAGGCCCAGATNONE 
J075085K03TGCGGCCCATAAAGGCCCAGATNONE 
J075112P22TGCGGCCCATAAAGGCCCAGATNONE 
J075118I09TGCGGCCCATAAAGGCCCAGATNONE 
J075144H09TGCGGCCCATAAAGGCCCAGATNONE 
J075166I07TGCGGCCCATAAAGGCCCAGATNONE 
J075191J02TGCGGCCCATAAAGGCCCAGATNONE 
J075195I23TGCGGCCCATAAAGGCCCAGATNONE 
Os05g0215600AK066642TGCGGCCCAGTConserved hypothetical protein. 
AK099688TGCGGCCCAGTNONE 
Os05g0378800AK058210TGCGGCCCAATNONE 
Os05g0399300AK108949TGCGGCCCNONE 
Os05g0415600AK065818TGCGGCCCAGGNONE 
J013042K21TGCGGCCCAGGNONE 
J013114E15TGCGGCCCAGGNONE 
J013131H02TGCGGCCCAGGNONE 
J023041G06TGCGGCCCAGGNONE 
J100037M21TGCGGCCCAGGNONE 
Os05g0480000AK061052GGGCCGCAProtein kinase domain containing protein. 
Os05g0488900AK071883TGCGGCCCACACSimilar to Cytochrome b5 reductase. 
AK073699TGCGGCCCACACNONE 
AK105459TGCGGCCCACACNONE 
J080009C06TGCGGCCCACACNONE 
J080021N09TGCGGCCCACACNONE 
J080041K24TGCGGCCCACACNONE 
J080058H15TGCGGCCCACACNONE 
J080064P06TGCGGCCCACACNONE 
J080077B16TGCGGCCCACACNONE 
Os05g0494200006-042-H12GGGCCGCAGGCCCATANONE 
009-020-F06GGGCCGCAGGCCCATANONE 
009-069-C06GGGCCGCAGGCCCATANONE 
009-118-B01GGGCCGCAGGCCCATANONE 
AK059563GGGCCGCAGGCCCATANONE 
AK061025GGGCCGCAGGCCCATANONE 
J043031L14GGGCCGCAGGCCCATANONE 
J05595GGGCCGCAGGCCCATASimilar to Cysteine proteinase inhibitor-II (Oryzacystatin-II). 
J075068F23GGGCCGCAGGCCCATANONE 
Os05g0497625Os05g0497625GGGCCGCAConserved hypothetical protein. 
Os05g0539300Os05g0539300AATTGGGCCGCAProtein of unknown function DUF295 family protein. 
Os05g0540100AB021666CACGTGGGCCGCANONE 
AK060623CACGTGGGCCGCANONE 
AK103819CACGTGGGCCGCAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0553700006-100-D08TGCGGCCCACANONE 
AK099747TGCGGCCCACANONE 
AK101606TGCGGCCCACANONE 
AK103396TGCGGCCCACASimilar to Syntaxin 71 (AtSYP71). 
J033022M23TGCGGCCCACANONE 
J090086G01TGCGGCCCACANONE 
Os05g0555300009-032-C03TGCGGCCCNONE 
009-125-E08TGCGGCCCNONE 
009-149-C12TGCGGCCCNONE 
009-172-C01TGCGGCCCNONE 
AK062890TGCGGCCCFerredoxin domain containing protein. 
AK062997TGCGGCCCNONE 
Os05g0565200004-015-E06TATTGGGCCGCANONE 
AK067090TATTGGGCCGCASimilar to Urease accessory protein G. 
AK104200TATTGGGCCGCANONE 
AK104368TATTGGGCCGCANONE 
Os05g0568800006-084-D04CAGGTGGGCTTGGGCCGCANONE 
009-009-B11CAGGTGGGCTTGGGCCGCANONE 
009-014-E10CAGGTGGGCTTGGGCCGCANONE 
009-107-C04CAGGTGGGCTTGGGCCGCANONE 
009-133-H08CAGGTGGGCTTGGGCCGCANONE 
AK059883CAGGTGGGCTTGGGCCGCAProtein of unknown function DUF1645 family protein. 
Os05g0571400009-019-B04AGCCCATGCGGCCCAAAANONE 
009-043-H02AGCCCATGCGGCCCAAAANONE 
AK062369AGCCCATGCGGCCCAAAAConserved hypothetical protein. 
Os06g0122200AK109712TGCGGCCCConserved hypothetical protein. 
Os06g0140100011-063-A02TGCGGCCCATCTNONE 
AK063371TGCGGCCCATCTLeucine carboxyl methyltransferase family protein. 
Os06g0161800AK064664TGCGGCCCCACCTGProtein of unknown function DUF569 family protein. 
Os06g0194200AK111269TGTGGGCCGCAConserved hypothetical protein. 
J090084F15TGTGGGCCGCANONE 
Os06g0360500AK109778TGCGGCCCConserved hypothetical protein. 
Os06g0482200AK119703TGTTGGGCCGCAThioredoxin fold domain containing protein. 
J065014B11TGTTGGGCCGCANONE 
J065055E22TGTTGGGCCGCANONE 
J065092L13TGTTGGGCCGCANONE 
J065113E21TGTTGGGCCGCANONE 
J065191D11TGTTGGGCCGCANONE 
J065214F18TGTTGGGCCGCANONE 
J075104E18TGTTGGGCCGCANONE 
J075149O19TGTTGGGCCGCANONE 
J075170I11TGTTGGGCCGCANONE 
Os06g0585200016-065-C02AACGGCCCGTGGGCCGCANONE 
AK068592AACGGCCCGTGGGCCGCANONE 
AK073844AACGGCCCGTGGGCCGCANONE 
AK106549AACGGCCCGTGGGCCGCAConserved hypothetical protein. 
J013154A14AACGGCCCGTGGGCCGCANONE 
J100049K24AACGGCCCGTGGGCCGCANONE 
J100059C18AACGGCCCGTGGGCCGCANONE 
J100082N13AACGGCCCGTGGGCCGCANONE 
Os06g0616900AK107912TGCGGCCCATTAConserved hypothetical protein. 
Os06g0622300AK064549GGTGGGGCCGCANONE 
AK071559GGTGGGGCCGCANONE 
Os06g0663600AK100787TCCGGGCCGCAEndonuclease V family protein. 
Os06g0687200AK058749TGCGGCCCACCAZinc finger, RING-type domain containing protein. 
Os07g0122300015-004-G08ATATGGGCCGCANONE 
AK103212ATATGGGCCGCANONE 
AK119295ATATGGGCCGCAProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09ATATGGGCCGCANONE 
J090007P13ATATGGGCCGCANONE 
Os07g0419200006-089-B01TGCGGCCCNONE 
AK061170TGCGGCCCConserved hypothetical protein. 
Os07g0564000AK069806TGCGGCCCATATConserved hypothetical protein. 
Os07g0565600AK071983GGGCCGCASimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481GGGCCGCANONE 
Os07g0583700AK070537GGGCCGCAWRKY transcription factor 78. 
AY341850GGGCCGCANONE 
J013089A12GGGCCGCANONE 
J013118N13GGGCCGCANONE 
J023039L18GGGCCGCANONE 
J023062H03GGGCCGCANONE 
J100029J20GGGCCGCANONE 
Os07g0585800006-106-A05TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK066419TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK105064TCTGGGCCGCAAGGCCCGGCCCATAASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065085B08TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065099I23TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065169A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065187N13TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065191L18TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065194D04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065211M09TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065212I02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090003C10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090025O11TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090092F10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100055A04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100064A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100080L02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
Os07g0589400AK072501AACTGGGCCGCAQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617AACTGGGCCGCANONE 
AK104756AACTGGGCCGCANONE 
Os07g0614100AB032062TTTTGGGCCGCANONE 
AK058885TTTTGGGCCGCANONE 
AK069145TTTTGGGCCGCANONE 
AK102448TTTTGGGCCGCAAlpha 1-2 subunit of 20S proteasome. 
J023007E07TTTTGGGCCGCANONE 
J033093O06TTTTGGGCCGCANONE 
Os07g0639800AK074012AAATGGGCCGCASimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592AAATGGGCCGCANONE 
AK104739AAATGGGCCGCANONE 
Os07g0673500005-016-H01TGCGGCCCAACCNONE 
AK072839TGCGGCCCAACCNONE 
AK106176TGCGGCCCAACCSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TGCGGCCCAACCNONE 
J013153M24TGCGGCCCAACCNONE 
J023129E21TGCGGCCCAACCNONE 
J023141I23TGCGGCCCAACCNONE 
J033069A22TGCGGCCCAACCNONE 
J075021G17TGCGGCCCAACCNONE 
J075022B06TGCGGCCCAACCNONE 
J075049O15TGCGGCCCAACCNONE 
J075060O14TGCGGCCCAACCNONE 
J075073G03TGCGGCCCAACCNONE 
J075095D13TGCGGCCCAACCNONE 
J075120M18TGCGGCCCAACCNONE 
J075130D09TGCGGCCCAACCNONE 
J075152C20TGCGGCCCAACCNONE 
J075158L19TGCGGCCCAACCNONE 
J075199P18TGCGGCCCAACCNONE 
J090011K21TGCGGCCCAACCNONE 
J090078O10TGCGGCCCAACCNONE 
Os08g0107900014-055-C03TGTTGGGCCGCANONE 
J065062G20TGTTGGGCCGCANONE 
Os08g0167500006-063-D04AATTGGGCCGCANONE 
006-066-G09AATTGGGCCGCANONE 
AK061061AATTGGGCCGCAConserved hypothetical protein. 
AK071197AATTGGGCCGCANONE 
J023082N10AATTGGGCCGCANONE 
Os08g0178300AK068383GGGCCGCAConserved hypothetical protein. 
AK100262GGGCCGCANONE 
Os08g0414200AK102789TGCGGCCCACCAGCCCACCACBRCT domain containing protein. 
J033048B10TGCGGCCCACCAGCCCACCACNONE 
J033071G24TGCGGCCCACCAGCCCACCACNONE 
J033107O17TGCGGCCCACCAGCCCACCACNONE 
Os08g0441400011-033-F01ATTTGGGCCGCANONE 
015-084-B04ATTTGGGCCGCANONE 
AK063317ATTTGGGCCGCANONE 
AK064141ATTTGGGCCGCAConserved hypothetical protein. 
J065060F06ATTTGGGCCGCANONE 
J075110A22ATTTGGGCCGCANONE 
J080307P11ATTTGGGCCGCANONE 
J090041E06ATTTGGGCCGCANONE 
Os08g0554000AK111661CATGGGCCGCAWD-40 repeat containing protein. 
AK111661TGCGGCCCATATWD-40 repeat containing protein. 
AK112044CATGGGCCGCANONE 
AK112044TGCGGCCCATATNONE 
J013039N12CATGGGCCGCANONE 
J013039N12TGCGGCCCATATNONE 
J013134D02CATGGGCCGCANONE 
J013134D02TGCGGCCCATATNONE 
J013153B06CATGGGCCGCANONE 
J013153B06TGCGGCCCATATNONE 
J033044L16CATGGGCCGCANONE 
J033044L16TGCGGCCCATATNONE 
J033073P14CATGGGCCGCANONE 
J033073P14TGCGGCCCATATNONE 
Os08g0558400AK071334GGTTGGGCCGCAGCCCACAASimilar to Kinesin heavy chain (Fragment). 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os09g0347900AK071224TGCGGCCCATTAConserved hypothetical protein. 
J023087B12TGCGGCCCATTANONE 
Os09g0424600AK073882TATGGGCCGCAHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
AK073882TTATGGGCCGCAHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0464000AK060777TGCGGCCCATGNONE 
AK069530TGCGGCCCATGSimilar to Carbonate dehydratase-like protein. 
Os09g0467700AK061600TGCGGCCCATTAConserved hypothetical protein. 
Os09g0499000AK060116TGCGGCCCConserved hypothetical protein. 
Os09g0535300AK071211GGGCCGCAXAP5 protein family protein. 
Os09g0557400AK099503GGGCCGCAMitochondrial glycoprotein family protein. 
J065138P07GGGCCGCANONE 
J075092A17GGGCCGCANONE 
Os11g0104400D78505TGCGGCCCATCCASimilar to W-3 fatty acid desaturase (Fragment). 
J013109G14TGCGGCCCATCCANONE 
J075027J03TGCGGCCCATCCANONE 
J090006L16TGCGGCCCATCCANONE 
J090021A01TGCGGCCCATCCANONE 
J090049M01TGCGGCCCATCCANONE 
J090084O20TGCGGCCCATCCANONE 
Os11g0128400AK102291TGCGGCCCAAGCDC45-like protein family protein. 
J033089K18TGCGGCCCAAGNONE 
Os11g0131900AK065240GGGCCGCASimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II. 
Os11g0147800005-013-G01TGCGGCCCCCACGTNONE 
006-022-F04TGCGGCCCCCACGTNONE 
006-029-E06TGCGGCCCCCACGTNONE 
006-036-H09TGCGGCCCCCACGTNONE 
006-043-F11TGCGGCCCCCACGTNONE 
006-045-G11TGCGGCCCCCACGTNONE 
006-062-C07TGCGGCCCCCACGTNONE 
006-062-G04TGCGGCCCCCACGTNONE 
006-063-C01TGCGGCCCCCACGTNONE 
006-065-A03TGCGGCCCCCACGTNONE 
006-074-E02TGCGGCCCCCACGTNONE 
006-076-H11TGCGGCCCCCACGTNONE 
006-078-E12TGCGGCCCCCACGTNONE 
006-098-A12TGCGGCCCCCACGTNONE 
006-103-B01TGCGGCCCCCACGTNONE 
006-107-C01TGCGGCCCCCACGTNONE 
006-111-D09TGCGGCCCCCACGTNONE 
006-113-H09TGCGGCCCCCACGTNONE 
006-118-D07TGCGGCCCCCACGTNONE 
006-120-B04TGCGGCCCCCACGTNONE 
009-064-G07TGCGGCCCCCACGTNONE 
009-200-A06TGCGGCCCCCACGTNONE 
AK071762TGCGGCCCCCACGTNONE 
AK102998TGCGGCCCCCACGTNONE 
AK104445TGCGGCCCCCACGTNONE 
AK105169TGCGGCCCCCACGTNONE 
AK119185TGCGGCCCCCACGTSimilar to Wali7 protein (Fragment). 
Os11g0184900011-088-C07TGCGGCCCAGGCCCACGCNONE 
015-036-B03TGCGGCCCAGGCCCACGCNONE 
016-087-F07TGCGGCCCAGGCCCACGCNONE 
AB028184TGCGGCCCAGGCCCACGCNONE 
AK063399TGCGGCCCAGGCCCACGCSimilar to NAC-domain protein 5-7. 
AK064292TGCGGCCCAGGCCCACGCNONE 
AK102475TGCGGCCCAGGCCCACGCNONE 
J033094I01TGCGGCCCAGGCCCACGCNONE 
J090087J16TGCGGCCCAGGCCCACGCNONE 
Os11g0227600AK101375TTGTGGGCCGCAConserved hypothetical protein. 
AK102193TTGTGGGCCGCANONE 
J033087C03TTGTGGGCCGCANONE 
Os11g0233900J065063O08TGCGGCCCHypothetical protein. 
Os11g0554200016-030-B02TGCGGCCCNONE 
AK106479TGCGGCCCConserved hypothetical protein. 
Os12g0112250J013069O10TATTGGGCCGCASaposin B domain containing protein. 
J065206G04TATTGGGCCGCANONE 
J080302C06TATTGGGCCGCANONE 
J080306K06TATTGGGCCGCANONE 
J080307O09TATTGGGCCGCANONE 
J080310J07TATTGGGCCGCANONE 
J080311G18TATTGGGCCGCANONE 
J080318C07TATTGGGCCGCANONE 
Os12g0124700AK073156TGCGGCCCAAGCDC45-like protein family protein. 
AK073156TGCGGCCCATGTCDC45-like protein family protein. 
J090013O22TGCGGCCCAAGNONE 
J090013O22TGCGGCCCATGTNONE 
Os12g0133600AK103096TATTGGGCCGCAConserved hypothetical protein. 
J033118M03TATTGGGCCGCANONE 
Os12g0572400016-084-F04GCAGCCCAAACATATGGGCCGCANONE 
AK065531GCAGCCCAAACATATGGGCCGCASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03GCAGCCCAAACATATGGGCCGCANONE 
J013034H02GCAGCCCAAACATATGGGCCGCANONE 
J033117N05GCAGCCCAAACATATGGGCCGCANONE 
J065027L09GCAGCCCAAACATATGGGCCGCANONE 
J065037D09GCAGCCCAAACATATGGGCCGCANONE 
J065197I09GCAGCCCAAACATATGGGCCGCANONE 
J090045C01GCAGCCCAAACATATGGGCCGCANONE 
J100031E11GCAGCCCAAACATATGGGCCGCANONE 
Os12g0615300AK119448AAATGGGCCGCAEGF-like calcium-binding domain containing protein. 
AK119448TATTGGGCCGCAEGF-like calcium-binding domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.