version

Summary of OsREG644 (All List)

OrganismOryza sativa  
IDOsREG644  
SequenceGGGCCGGA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2092  

Entry Sequences (2092 entries)

LocusGene modelSequenceDescription
Os01g0147200016-005-F02ATTTGGGCCGGANONE 
AK106463ATTTGGGCCGGANONE 
AK121921ATTTGGGCCGGAIWS1, C-terminal family protein. 
J033098O16ATTTGGGCCGGANONE 
J033106E16ATTTGGGCCGGANONE 
J043026D12ATTTGGGCCGGANONE 
J065070B04ATTTGGGCCGGANONE 
J065162L03ATTTGGGCCGGANONE 
J065166F01ATTTGGGCCGGANONE 
J075030A13ATTTGGGCCGGANONE 
J075093O12ATTTGGGCCGGANONE 
J075106K15ATTTGGGCCGGANONE 
J075107F20ATTTGGGCCGGANONE 
J090031F21ATTTGGGCCGGANONE 
J090079E17ATTTGGGCCGGANONE 
Os01g0150000006-053-H07GGGCCGGANONE 
006-081-C11GGGCCGGANONE 
009-050-D04GGGCCGGANONE 
AK060948GGGCCGGA3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18GGGCCGGANONE 
J023112H22GGGCCGGANONE 
J065048P05GGGCCGGANONE 
J100068N20GGGCCGGANONE 
J100073A02GGGCCGGANONE 
Os01g0158000AK058679TCCGGCCCAGTNONE 
AK103127TCCGGCCCAGTImportin alpha-2 subunit. 
D78504TCCGGCCCAGTNONE 
Os01g0166800AK073783ATATGGGCCGGAConserved hypothetical protein. 
AK099378ATATGGGCCGGANONE 
J033026H10ATATGGGCCGGANONE 
J033067O18ATATGGGCCGGANONE 
J033108A17ATATGGGCCGGANONE 
J065015J11ATATGGGCCGGANONE 
J065204P09ATATGGGCCGGANONE 
Os01g0172000012-070-G06GGGCCGGAGGCCCATGANONE 
012-070-G06GGTTGGGCCGGANONE 
AK068405GGGCCGGAGGCCCATGAALG3 family protein. 
AK068405GGTTGGGCCGGAALG3 family protein. 
J013149A07GGGCCGGAGGCCCATGANONE 
J013149A07GGTTGGGCCGGANONE 
J053047H05GGGCCGGAGGCCCATGANONE 
J053047H05GGTTGGGCCGGANONE 
J065075N03GGGCCGGAGGCCCATGANONE 
J065075N03GGTTGGGCCGGANONE 
J065093G22GGGCCGGAGGCCCATGANONE 
J065093G22GGTTGGGCCGGANONE 
J065130N21GGGCCGGAGGCCCATGANONE 
J065130N21GGTTGGGCCGGANONE 
J065143P05GGGCCGGAGGCCCATGANONE 
J065143P05GGTTGGGCCGGANONE 
J065216H07GGGCCGGAGGCCCATGANONE 
J065216H07GGTTGGGCCGGANONE 
J075013B06GGGCCGGAGGCCCATGANONE 
J075013B06GGTTGGGCCGGANONE 
J075196M05GGGCCGGAGGCCCATGANONE 
J075196M05GGTTGGGCCGGANONE 
J100039G24GGGCCGGAGGCCCATGANONE 
J100039G24GGTTGGGCCGGANONE 
J100041B11GGGCCGGAGGCCCATGANONE 
J100041B11GGTTGGGCCGGANONE 
J100069A16GGGCCGGAGGCCCATGANONE 
J100069A16GGTTGGGCCGGANONE 
J100069L12GGGCCGGAGGCCCATGANONE 
J100069L12GGTTGGGCCGGANONE 
J100074P16GGGCCGGAGGCCCATGANONE 
J100074P16GGTTGGGCCGGANONE 
Os01g0172200AK100326TGTGGGCTGGGCCGGAWW/Rsp5/WWP domain containing protein. 
Os01g0191100009-011-A02TCCGGCCCACGANONE 
009-028-D05TCCGGCCCACGANONE 
009-058-B11TCCGGCCCACGANONE 
009-151-D09TCCGGCCCACGANONE 
013-026-G03TCCGGCCCACGANONE 
013-063-F04TCCGGCCCACGANONE 
013-069-B05TCCGGCCCACGANONE 
014-029-E04TCCGGCCCACGANONE 
014-072-H04TCCGGCCCACGANONE 
014-089-E09TCCGGCCCACGANONE 
015-047-G05TCCGGCCCACGANONE 
016-033-G06TCCGGCCCACGANONE 
AK058815TCCGGCCCACGASimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08TCCGGCCCACGANONE 
J023077K21TCCGGCCCACGANONE 
J023081F19TCCGGCCCACGANONE 
J033052N11TCCGGCCCACGANONE 
J033058N11TCCGGCCCACGANONE 
J033114G05TCCGGCCCACGANONE 
J033114O17TCCGGCCCACGANONE 
J033129L14TCCGGCCCACGANONE 
J053029I12TCCGGCCCACGANONE 
J065067N19TCCGGCCCACGANONE 
J065084I19TCCGGCCCACGANONE 
J065099O03TCCGGCCCACGANONE 
J065201I08TCCGGCCCACGANONE 
J075035B08TCCGGCCCACGANONE 
J075037B22TCCGGCCCACGANONE 
J075054L16TCCGGCCCACGANONE 
J075059D15TCCGGCCCACGANONE 
J075164I08TCCGGCCCACGANONE 
J075185J01TCCGGCCCACGANONE 
J090042O06TCCGGCCCACGANONE 
J090044F12TCCGGCCCACGANONE 
J090063L02TCCGGCCCACGANONE 
J090073I10TCCGGCCCACGANONE 
J090078E18TCCGGCCCACGANONE 
J100072K16TCCGGCCCACGANONE 
Os01g0193400AK069948ATCTGGGCCGGANONE 
AK099271ATCTGGGCCGGANONE 
AK107005ATCTGGGCCGGAConserved hypothetical protein. 
Os01g0220300009-063-C12TCCGGCCCANONE 
AK105167TCCGGCCCAConserved hypothetical protein. 
J065124E17TCCGGCCCANONE 
J090096L11TCCGGCCCANONE 
Os01g0223600AK110821TCCGGCCCSimilar to Pto kinase interactor 1-like protein. 
Os01g0270100006-096-H09TCCGGCCCAAGNONE 
009-009-C10TCCGGCCCAAGNONE 
009-054-E06TCCGGCCCAAGNONE 
014-085-F09TCCGGCCCAAGNONE 
AK073275TCCGGCCCAAGNONE 
AK104155TCCGGCCCAAGNONE 
AK119511TCCGGCCCAAGSimilar to Cysteine protease inhibitor. 
J033025K21TCCGGCCCAAGNONE 
J075065H10TCCGGCCCAAGNONE 
J075143G10TCCGGCCCAAGNONE 
J100059J02TCCGGCCCAAGNONE 
Os01g0506200AK073118TCCGGCCCTetratricopeptide-like helical domain containing protein. 
J065002A07TCCGGCCCNONE 
J065079J08TCCGGCCCNONE 
J065167M18TCCGGCCCNONE 
Os01g0508000AK069177TCCGGCCCACGCSimilar to Beta-glucosidase. 
Os01g0581300AK066182TCCGGCCCATAGCAGCCCATATSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015TCCGGCCCATAGCAGCCCATATNONE 
Os01g0582400AK069484TGGATGGGCCGGASimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12TGGATGGGCCGGANONE 
J023036F15TGGATGGGCCGGANONE 
J023095O16TGGATGGGCCGGANONE 
J033102M15TGGATGGGCCGGANONE 
J043013I06TGGATGGGCCGGANONE 
J065083M21TGGATGGGCCGGANONE 
J065176A17TGGATGGGCCGGANONE 
Os01g0631500011-029-C05TCCGGCCCNONE 
AK063308TCCGGCCCSimilar to Beta-1,3-glucanase-like protein. 
Os01g0642900009-109-F01ACCGGGCCGGANONE 
AK063836ACCGGGCCGGASingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560ACCGGGCCGGANONE 
J033043K18ACCGGGCCGGANONE 
J100023C05ACCGGGCCGGANONE 
J100038C15ACCGGGCCGGANONE 
J100039C23ACCGGGCCGGANONE 
Os01g0670800AK103776TCCGGCCCNONE 
J033143P19TCCGGCCCNONE 
Os01g0680400AK067914TCCGGCCCTAFII28-like protein family protein. 
J065039K13TCCGGCCCNONE 
J065042K22TCCGGCCCNONE 
J080016E23TCCGGCCCNONE 
J080064E22TCCGGCCCNONE 
Os01g0692400AK110723GGGCCGGAConserved hypothetical protein. 
Os01g0706000006-098-D12GGGCCGGANONE 
AK059936GGGCCGGASimilar to RNA polymerase II transcriptional coactivator KELP. 
AK070545GGGCCGGANONE 
AK104192GGGCCGGANONE 
J023055M24GGGCCGGANONE 
J033102J04GGGCCGGANONE 
J065050P18GGGCCGGANONE 
J065076D07GGGCCGGANONE 
J065078O14GGGCCGGANONE 
J065104L13GGGCCGGANONE 
J065115J23GGGCCGGANONE 
J065143P08GGGCCGGANONE 
J065178N17GGGCCGGANONE 
J065179H14GGGCCGGANONE 
J065187J06GGGCCGGANONE 
J075047B18GGGCCGGANONE 
Os01g0748100AK071261TCTGGGCCGGAHypothetical protein. 
J023084C08TCTGGGCCGGANONE 
J065058A07TCTGGGCCGGANONE 
Os01g0764600AK060621TGATGGGCCGGAFosfomycin resistance kinase FomA family protein. 
J013111L18TGATGGGCCGGANONE 
J013134N08TGATGGGCCGGANONE 
Os01g0769700014-082-A10GGGCCGGANONE 
AK105465GGGCCGGANONE 
J090037F10GGGCCGGANONE 
Os01g0773500009-029-F02TCCGGCCCAAATNONE 
AK062417TCCGGCCCAAATConserved hypothetical protein. 
Os01g0800300006-097-C12TCCGGCCCGGCCNONE 
014-070-C12TCCGGCCCGGCCNONE 
AK072549TCCGGCCCGGCCNONE 
AK100942TCCGGCCCGGCCNONE 
AK100951TCCGGCCCGGCCConserved hypothetical protein. 
AK106023TCCGGCCCGGCCNONE 
J023138D05TCCGGCCCGGCCNONE 
J075097P16TCCGGCCCGGCCNONE 
J075099F23TCCGGCCCGGCCNONE 
Os01g0801000AK064082ACATGGGCCGGGCCGGANONE 
AK101426ACATGGGCCGGGCCGGASimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0830500006-117-F06TCCGGCCCATCCNONE 
AK061475TCCGGCCCATCCNONE 
AK105801TCCGGCCCATCC2OG-Fe(II) oxygenase domain containing protein. 
J065168H17TCCGGCCCATCCNONE 
J065211O10TCCGGCCCATCCNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0848300AK120668TCCGGCCCATGProtein prenyltransferase domain containing protein. 
Os01g0860601011-099-B05TCCGGCCCNONE 
013-093-G06TCCGGCCCNONE 
AK069860TCCGGCCCSimilar to Ferredoxin, root R-B1. 
J065017K08TCCGGCCCNONE 
J065020D23TCCGGCCCNONE 
J065041N15TCCGGCCCNONE 
J065119F17TCCGGCCCNONE 
J065169G20TCCGGCCCNONE 
J065179F21TCCGGCCCNONE 
J065182L09TCCGGCCCNONE 
Os01g0914700AK069261GGGCCGGAPeptidase A22B, minor histocompatibility antigen H13 family protein. 
J023010L21GGGCCGGANONE 
J023150J10GGGCCGGANONE 
Os01g0921600AK071344CACTGACAGGTGGGGCCGGASimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CACTGACAGGTGGGGCCGGANONE 
J013109E03CACTGACAGGTGGGGCCGGANONE 
J023081J12CACTGACAGGTGGGGCCGGANONE 
J023091E24CACTGACAGGTGGGGCCGGANONE 
J033022A01CACTGACAGGTGGGGCCGGANONE 
J033074C13CACTGACAGGTGGGGCCGGANONE 
J065199E03CACTGACAGGTGGGGCCGGANONE 
J075172O04CACTGACAGGTGGGGCCGGANONE 
J090007G18CACTGACAGGTGGGGCCGGANONE 
J090052B17CACTGACAGGTGGGGCCGGANONE 
J090074H01CACTGACAGGTGGGGCCGGANONE 
J100043J09CACTGACAGGTGGGGCCGGANONE 
J100059J05CACTGACAGGTGGGGCCGGANONE 
Os01g0924000004-020-C09ACGTGGGCCGGANONE 
005-014-A06ACGTGGGCCGGANONE 
009-085-G12ACGTGGGCCGGANONE 
009-123-A08ACGTGGGCCGGANONE 
009-134-A05ACGTGGGCCGGANONE 
009-137-F06ACGTGGGCCGGANONE 
016-016-B08ACGTGGGCCGGANONE 
AF050674ACGTGGGCCGGANONE 
AK061690ACGTGGGCCGGASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797ACGTGGGCCGGANONE 
J013040A15ACGTGGGCCGGANONE 
J013104L20ACGTGGGCCGGANONE 
J013127E12ACGTGGGCCGGANONE 
J013158O05ACGTGGGCCGGANONE 
J023012E09ACGTGGGCCGGANONE 
J023126L23ACGTGGGCCGGANONE 
J023143B03ACGTGGGCCGGANONE 
J065005B16ACGTGGGCCGGANONE 
J065101J15ACGTGGGCCGGANONE 
J065105K16ACGTGGGCCGGANONE 
J065155K16ACGTGGGCCGGANONE 
J065171M17ACGTGGGCCGGANONE 
J065182F07ACGTGGGCCGGANONE 
J065187D10ACGTGGGCCGGANONE 
J065194I24ACGTGGGCCGGANONE 
J065207E24ACGTGGGCCGGANONE 
J075001C24ACGTGGGCCGGANONE 
J075090O10ACGTGGGCCGGANONE 
J075095H17ACGTGGGCCGGANONE 
J075109M24ACGTGGGCCGGANONE 
J075123C18ACGTGGGCCGGANONE 
J075148G22ACGTGGGCCGGANONE 
J090009B09ACGTGGGCCGGANONE 
J090075K17ACGTGGGCCGGANONE 
J090081H23ACGTGGGCCGGANONE 
J090097H21ACGTGGGCCGGANONE 
J100063P14ACGTGGGCCGGANONE 
Os02g0148400AK070451TCCGGCCCATGANONE 
AK072039TCCGGCCCATGAPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10TCCGGCCCATGANONE 
Os02g0178400009-151-B08TAGGCCCATGGGCCGGANONE 
AK063815TAGGCCCATGGGCCGGAProtein transport protein SEC61 gamma subunit. 
AK121516TAGGCCCATGGGCCGGANONE 
J033026A17TAGGCCCATGGGCCGGANONE 
J065011K14TAGGCCCATGGGCCGGANONE 
J065056D01TAGGCCCATGGGCCGGANONE 
J065061L22TAGGCCCATGGGCCGGANONE 
J065076M01TAGGCCCATGGGCCGGANONE 
J075092E14TAGGCCCATGGGCCGGANONE 
Os02g0179100AK058557TCCGGCCCAACAMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10TCCGGCCCAACANONE 
Os02g0208200J023104K09TCCGGCCCACGTNONE 
J033080L20TCCGGCCCACGTNONE 
J033105D08TCCGGCCCACGTNONE 
J090079N16TCCGGCCCACGTNONE 
Os02g0227400AK103143GGGCCGGANONE 
AY785765GGGCCGGAPoly(A) polymerase, central region domain containing protein. 
Os02g0285300009-064-E02TCCGGCCCNONE 
AK058613TCCGGCCCDREPP plasma membrane polypeptide family protein. 
Os02g0304800Os02g0304800TCCGGCCCATTAProtein prenyltransferase domain containing protein. 
Os02g0537500AK068689TCCGGCCCATTGGGCCGCSimilar to E2F homolog. 
Os02g0565000AK120665GGGCCGGAHomeodomain-like containing protein. 
AK120665TCCGTCCGGCCCAACAHomeodomain-like containing protein. 
J100070C12GGGCCGGANONE 
J100070C12TCCGTCCGGCCCAACANONE 
J100074L08GGGCCGGANONE 
J100074L08TCCGTCCGGCCCAACANONE 
Os02g0600100AK071215TCCGGCCCATGGSimilar to 26S proteasome subunit RPN7. 
AK071215TCCGGCCCATGGGCTGTSimilar to 26S proteasome subunit RPN7. 
Os02g0634800003-004-F03CTTGGGCCGGANONE 
AK059694CTTGGGCCGGAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17CTTGGGCCGGANONE 
J053077G20CTTGGGCCGGANONE 
J075195F14CTTGGGCCGGANONE 
Os02g0634900006-032-G12TCCGGCCCAAGNONE 
006-033-E09TCCGGCCCAAGNONE 
006-117-F10TCCGGCCCAAGNONE 
006-118-E01TCCGGCCCAAGNONE 
013-056-G08TCCGGCCCAAGNONE 
AK059769TCCGGCCCAAGNONE 
AK068583TCCGGCCCAAGNONE 
AK072855TCCGGCCCAAGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210TCCGGCCCAAGNONE 
J023138P05TCCGGCCCAAGNONE 
J023143J07TCCGGCCCAAGNONE 
J033022O09TCCGGCCCAAGNONE 
J033111L02TCCGGCCCAAGNONE 
J033135O03TCCGGCCCAAGNONE 
J065005K19TCCGGCCCAAGNONE 
J065044C17TCCGGCCCAAGNONE 
J065116K09TCCGGCCCAAGNONE 
J065119O21TCCGGCCCAAGNONE 
J075014L05TCCGGCCCAAGNONE 
J075109H16TCCGGCCCAAGNONE 
J075117D04TCCGGCCCAAGNONE 
Os02g0644000AB081464TCCGGCCCNONE 
AK101360TCCGGCCCNONE 
AY062178TCCGGCCCNONE 
J023043E22TCCGGCCCNONE 
J033024F05TCCGGCCCNONE 
J033035H01TCCGGCCCNONE 
J033042J19TCCGGCCCNONE 
J033057G18TCCGGCCCNONE 
J033111F09TCCGGCCCNONE 
J033115L11TCCGGCCCNONE 
J033143I16TCCGGCCCNONE 
J033143M21TCCGGCCCNONE 
J075072B10TCCGGCCCNONE 
J075072L04TCCGGCCCNONE 
J075088F01TCCGGCCCNONE 
J075196H23TCCGGCCCNONE 
Os02g0673600009-071-C12TCCGGCCCATGAGGGGCCCAATANONE 
J023037G24TCCGGCCCATGAGGGGCCCAATANONE 
J023038E07TCCGGCCCATGAGGGGCCCAATAORMDL family protein. 
J023142L24TCCGGCCCATGAGGGGCCCAATANONE 
J033115B14TCCGGCCCATGAGGGGCCCAATANONE 
J075004B15TCCGGCCCATGAGGGGCCCAATANONE 
J075067J21TCCGGCCCATGAGGGGCCCAATANONE 
J075072K07TCCGGCCCATGAGGGGCCCAATANONE 
J075147H21TCCGGCCCATGAGGGGCCCAATANONE 
J075154F03TCCGGCCCATGAGGGGCCCAATANONE 
Os02g0697500006-055-B12GGGCCGGANONE 
AK105891GGGCCGGANONE 
Os02g0741500AK068867TCCGGCCCAAACRibbon-helix-helix domain containing protein. 
Os02g0744000AK064898TCCGGCCCAAACConserved hypothetical protein. 
AK104827TCCGGCCCAAACNONE 
J013000L12TCCGGCCCAAACNONE 
J013156N02TCCGGCCCAAACNONE 
J065001H14TCCGGCCCAAACNONE 
J065038D18TCCGGCCCAAACNONE 
J065039I18TCCGGCCCAAACNONE 
J065047C13TCCGGCCCAAACNONE 
J065053J09TCCGGCCCAAACNONE 
J065064G03TCCGGCCCAAACNONE 
J065066M05TCCGGCCCAAACNONE 
J065068O10TCCGGCCCAAACNONE 
J065090H22TCCGGCCCAAACNONE 
J065113L19TCCGGCCCAAACNONE 
J065121M02TCCGGCCCAAACNONE 
J065122K23TCCGGCCCAAACNONE 
J065138C12TCCGGCCCAAACNONE 
J065153E14TCCGGCCCAAACNONE 
J065156N12TCCGGCCCAAACNONE 
J065158L20TCCGGCCCAAACNONE 
J065166I06TCCGGCCCAAACNONE 
J065174L15TCCGGCCCAAACNONE 
J065175N03TCCGGCCCAAACNONE 
J090092C23TCCGGCCCAAACNONE 
Os02g0768600006-034-F01AGGTGGGCCGGANONE 
006-046-G07AGGTGGGCCGGANONE 
006-054-C07AGGTGGGCCGGANONE 
006-056-F07AGGTGGGCCGGANONE 
006-100-C02AGGTGGGCCGGANONE 
AK059725AGGTGGGCCGGANONE 
AK098996AGGTGGGCCGGANONE 
AK099120AGGTGGGCCGGANONE 
AK104659AGGTGGGCCGGANONE 
J065043H04AGGTGGGCCGGANONE 
J075034N21AGGTGGGCCGGANONE 
J075145C18AGGTGGGCCGGANONE 
J080016H01AGGTGGGCCGGANONE 
J080040F01AGGTGGGCCGGANONE 
J080047L23AGGTGGGCCGGANONE 
J080049B22AGGTGGGCCGGANONE 
J080062J16AGGTGGGCCGGANONE 
J080064C23AGGTGGGCCGGANONE 
J080064L22AGGTGGGCCGGANONE 
J080077N01AGGTGGGCCGGANONE 
J080097G17AGGTGGGCCGGANONE 
J100065L15AGGTGGGCCGGANONE 
J100066K23AGGTGGGCCGGANONE 
J100088C07AGGTGGGCCGGANONE 
J100090H09AGGTGGGCCGGANONE 
Os02g0775900AK119974GGTTGGGCCGGAConserved hypothetical protein. 
Os02g0780500AK072784CCATGGGCCGGACCGTTGGGCCTCNONE 
AK072784CTTGGGCCGGANONE 
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein. 
AK121143CTTGGGCCGGAConserved hypothetical protein. 
J023075M13CCATGGGCCGGACCGTTGGGCCTCNONE 
J023075M13CTTGGGCCGGANONE 
J023077P14CCATGGGCCGGACCGTTGGGCCTCNONE 
J023077P14CTTGGGCCGGANONE 
J023123C16CCATGGGCCGGACCGTTGGGCCTCNONE 
J023123C16CTTGGGCCGGANONE 
J023142P06CCATGGGCCGGACCGTTGGGCCTCNONE 
J023142P06CTTGGGCCGGANONE 
Os02g0788400AK060351TCCGGCCCNONE 
AK103497TCCGGCCCSimilar to Eukaryotic translation initiation factor 3 subunit-like protein. 
Os02g0791400009-106-F11AACGGGCCGGANONE 
AK062787AACGGGCCGGACytochrome oxidase c, subunit VIb family protein. 
Os02g0798700AK101070GCTGGGCCGGANeurochondrin family protein. 
AK103079GCTGGGCCGGANONE 
J090045L09GCTGGGCCGGANONE 
Os02g0803200AK063404AGATGGGCCGGASimilar to 30S ribosomal protein S15. 
Os02g0814200AK068166TCCGGCCCSimilar to CER1-like gene protein (Fragment). 
J013032M18TCCGGCCCNONE 
J013158P07TCCGGCCCNONE 
Os02g0823600AK070498TCCGGCCCAAAConserved hypothetical protein. 
AK070498TCCGGCCCATTTConserved hypothetical protein. 
J065055C02TCCGGCCCAAANONE 
J065055C02TCCGGCCCATTTNONE 
J065098A17TCCGGCCCAAANONE 
J065098A17TCCGGCCCATTTNONE 
J065119B13TCCGGCCCAAANONE 
J065119B13TCCGGCCCATTTNONE 
J065146F10TCCGGCCCAAANONE 
J065146F10TCCGGCCCATTTNONE 
J065209G06TCCGGCCCAAANONE 
J065209G06TCCGGCCCATTTNONE 
J080001K12TCCGGCCCAAANONE 
J080001K12TCCGGCCCATTTNONE 
J080004O17TCCGGCCCAAANONE 
J080004O17TCCGGCCCATTTNONE 
J080005P21TCCGGCCCAAANONE 
J080005P21TCCGGCCCATTTNONE 
J080009M18TCCGGCCCAAANONE 
J080009M18TCCGGCCCATTTNONE 
J080013O18TCCGGCCCAAANONE 
J080013O18TCCGGCCCATTTNONE 
J080014B04TCCGGCCCAAANONE 
J080014B04TCCGGCCCATTTNONE 
J080014O21TCCGGCCCAAANONE 
J080014O21TCCGGCCCATTTNONE 
J080015B04TCCGGCCCAAANONE 
J080015B04TCCGGCCCATTTNONE 
J080016B17TCCGGCCCAAANONE 
J080016B17TCCGGCCCATTTNONE 
J080017G09TCCGGCCCAAANONE 
J080017G09TCCGGCCCATTTNONE 
J080022A17TCCGGCCCAAANONE 
J080022A17TCCGGCCCATTTNONE 
J080024M10TCCGGCCCAAANONE 
J080024M10TCCGGCCCATTTNONE 
J080025F17TCCGGCCCAAANONE 
J080025F17TCCGGCCCATTTNONE 
J080025O16TCCGGCCCAAANONE 
J080025O16TCCGGCCCATTTNONE 
J080029H09TCCGGCCCAAANONE 
J080029H09TCCGGCCCATTTNONE 
J080030G24TCCGGCCCAAANONE 
J080030G24TCCGGCCCATTTNONE 
J080031E02TCCGGCCCAAANONE 
J080031E02TCCGGCCCATTTNONE 
J080032A18TCCGGCCCAAANONE 
J080032A18TCCGGCCCATTTNONE 
J080032G24TCCGGCCCAAANONE 
J080032G24TCCGGCCCATTTNONE 
J080033C05TCCGGCCCAAANONE 
J080033C05TCCGGCCCATTTNONE 
J080033N19TCCGGCCCAAANONE 
J080033N19TCCGGCCCATTTNONE 
J080035H10TCCGGCCCAAANONE 
J080035H10TCCGGCCCATTTNONE 
J080035L05TCCGGCCCAAANONE 
J080035L05TCCGGCCCATTTNONE 
J080042N09TCCGGCCCAAANONE 
J080042N09TCCGGCCCATTTNONE 
J080044C14TCCGGCCCAAANONE 
J080044C14TCCGGCCCATTTNONE 
J080048K16TCCGGCCCAAANONE 
J080048K16TCCGGCCCATTTNONE 
J080050L07TCCGGCCCAAANONE 
J080050L07TCCGGCCCATTTNONE 
J080051L06TCCGGCCCAAANONE 
J080051L06TCCGGCCCATTTNONE 
J080051P22TCCGGCCCAAANONE 
J080051P22TCCGGCCCATTTNONE 
J080053D09TCCGGCCCAAANONE 
J080053D09TCCGGCCCATTTNONE 
J080053J15TCCGGCCCAAANONE 
J080053J15TCCGGCCCATTTNONE 
J080053O12TCCGGCCCAAANONE 
J080053O12TCCGGCCCATTTNONE 
J080057L01TCCGGCCCAAANONE 
J080057L01TCCGGCCCATTTNONE 
J080062E08TCCGGCCCAAANONE 
J080062E08TCCGGCCCATTTNONE 
J080062I09TCCGGCCCAAANONE 
J080062I09TCCGGCCCATTTNONE 
J080063A21TCCGGCCCAAANONE 
J080063A21TCCGGCCCATTTNONE 
J080063E04TCCGGCCCAAANONE 
J080063E04TCCGGCCCATTTNONE 
J080063E08TCCGGCCCAAANONE 
J080063E08TCCGGCCCATTTNONE 
J080064D15TCCGGCCCAAANONE 
J080064D15TCCGGCCCATTTNONE 
J080064N15TCCGGCCCAAANONE 
J080064N15TCCGGCCCATTTNONE 
J080068F13TCCGGCCCAAANONE 
J080068F13TCCGGCCCATTTNONE 
J080070L16TCCGGCCCAAANONE 
J080070L16TCCGGCCCATTTNONE 
J080072O17TCCGGCCCAAANONE 
J080072O17TCCGGCCCATTTNONE 
J080075A07TCCGGCCCAAANONE 
J080075A07TCCGGCCCATTTNONE 
J080076H10TCCGGCCCAAANONE 
J080076H10TCCGGCCCATTTNONE 
J080077K19TCCGGCCCAAANONE 
J080077K19TCCGGCCCATTTNONE 
J080078E19TCCGGCCCAAANONE 
J080078E19TCCGGCCCATTTNONE 
J080082A02TCCGGCCCAAANONE 
J080082A02TCCGGCCCATTTNONE 
J080083O05TCCGGCCCAAANONE 
J080083O05TCCGGCCCATTTNONE 
J080091I07TCCGGCCCAAANONE 
J080091I07TCCGGCCCATTTNONE 
J080094K10TCCGGCCCAAANONE 
J080094K10TCCGGCCCATTTNONE 
J080094N03TCCGGCCCAAANONE 
J080094N03TCCGGCCCATTTNONE 
J080096F09TCCGGCCCAAANONE 
J080096F09TCCGGCCCATTTNONE 
J080097O04TCCGGCCCAAANONE 
J080097O04TCCGGCCCATTTNONE 
J090037B19TCCGGCCCAAANONE 
J090037B19TCCGGCCCATTTNONE 
J100017A13TCCGGCCCAAANONE 
J100017A13TCCGGCCCATTTNONE 
J100068N22TCCGGCCCAAANONE 
J100068N22TCCGGCCCATTTNONE 
J100072C06TCCGGCCCAAANONE 
J100072C06TCCGGCCCATTTNONE 
Os02g0831300AK106522TCCGGCCCNONE 
J065042E05TCCGGCCCNONE 
Os03g0115800012-084-C12TCCGGCCCNONE 
AK063981TCCGGCCCNONE 
AK102606TCCGGCCCConserved hypothetical protein. 
J033045E13TCCGGCCCNONE 
J033091C17TCCGGCCCNONE 
J033098P07TCCGGCCCNONE 
J053034A07TCCGGCCCNONE 
J065005L07TCCGGCCCNONE 
J065010K23TCCGGCCCNONE 
J065014B03TCCGGCCCNONE 
J065072E20TCCGGCCCNONE 
J065073A18TCCGGCCCNONE 
J065087D12TCCGGCCCNONE 
J065088I24TCCGGCCCNONE 
J065099O07TCCGGCCCNONE 
J065108E09TCCGGCCCNONE 
J065117K05TCCGGCCCNONE 
J065119E02TCCGGCCCNONE 
J065127B09TCCGGCCCNONE 
J065139M15TCCGGCCCNONE 
J065154I06TCCGGCCCNONE 
J065157C02TCCGGCCCNONE 
J065169D19TCCGGCCCNONE 
J065184L23TCCGGCCCNONE 
J065187K09TCCGGCCCNONE 
J065199B06TCCGGCCCNONE 
J065199L09TCCGGCCCNONE 
J065201P10TCCGGCCCNONE 
J065208J19TCCGGCCCNONE 
J065209B09TCCGGCCCNONE 
J065210F11TCCGGCCCNONE 
J065212L13TCCGGCCCNONE 
Os03g0122200009-052-H10CACGTGTCCGGCCCNONE 
AB042934CACGTGTCCGGCCCNONE 
AK065033CACGTGTCCGGCCCSimilar to 50S ribosomal protein L11. 
J013001H03CACGTGTCCGGCCCNONE 
J023149C23CACGTGTCCGGCCCNONE 
J065025J15CACGTGTCCGGCCCNONE 
J065093D22CACGTGTCCGGCCCNONE 
Os03g0122300AK068438TCCGGCCCSimilar to Flavanone 3-hydroxylase-like protein. 
AK071416TCCGGCCCNONE 
AK104414TCCGGCCCNONE 
J023078E24TCCGGCCCNONE 
J023141J19TCCGGCCCNONE 
J033050K09TCCGGCCCNONE 
Os03g0128500AB037900AATGGGCCGGANONE 
AB037900TCCGGCCCATTNONE 
AK067991AATGGGCCGGASimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
AK067991TCCGGCCCATTSimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
J013124O04AATGGGCCGGANONE 
J013124O04TCCGGCCCATTNONE 
J090032P09AATGGGCCGGANONE 
J090032P09TCCGGCCCATTNONE 
Os03g0130700AK110670TCCGGCCCATTTNONE 
Os03g0135600J065183G03TCCGGCCCAAAAnkyrin repeat containing protein. 
Os03g0172200AK069130TCCGGCCCAGCCACACGArmadillo-like helical domain containing protein. 
Os03g0181600AK067807TCCGGCCCATAASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TCCGGCCCATAANONE 
Os03g0218400AK069202TCCGGCCCGTGGGCCGCSimilar to Hexose transporter. 
AK099306TCCGGCCCGTGGGCCGCNONE 
AY342321TCCGGCCCGTGGGCCGCNONE 
J023066K08TCCGGCCCGTGGGCCGCNONE 
J100032N19TCCGGCCCGTGGGCCGCNONE 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
J033043K11ATATGGGCCGGATGGGCCTTGNONE 
Os03g0251800AK067333TCCGGCCCAGCCCAGCSimilar to Possible OmpA family member precursor. 
AK073337TCCGGCCCAGCCCAGCNONE 
Os03g0271100AB095095TCCGGCCCACGANONE 
AK060821TCCGGCCCACGASimilar to Sigma factor SIG2B. 
AK067693TCCGGCCCACGANONE 
AK099036TCCGGCCCACGANONE 
Os03g0284000Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein. 
Os03g0302700006-099-F12TCCGGCCCACGTNONE 
AK112010TCCGGCCCACGTZinc finger, RING-type domain containing protein. 
AK121656TCCGGCCCACGTNONE 
J075090A19TCCGGCCCACGTNONE 
J075148M06TCCGGCCCACGTNONE 
Os03g0305500AK070638TCCGGCCCATCCAArgininosuccinate lyase domain containing protein. 
Os03g0305600014-071-F12ACGTGTCCGGCCCNONE 
AK063714ACGTGTCCGGCCCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065005E12ACGTGTCCGGCCCNONE 
J075099I09ACGTGTCCGGCCCNONE 
J075152H24ACGTGTCCGGCCCNONE 
J075177J04ACGTGTCCGGCCCNONE 
Os03g0343900009-077-C03TCCGGCCCAATANONE 
AK105813TCCGGCCCAATAPhotosystem II protein PsbX family protein. 
J100059N03TCCGGCCCAATANONE 
J100079C20TCCGGCCCAATANONE 
Os03g0360700006-032-A11GGGCCGGANONE 
AK068764GGGCCGGASimilar to Protein-methionine-S-oxide reductase, PilB family. 
AK109429GGGCCGGANONE 
AY224463GGGCCGGANONE 
Os03g0391400AK105821GGGCCGGASimilar to Phospholipase D nu-2 (Fragment). 
Os03g0581800009-177-G11TAAGCCCATCCGGCCCAAATNONE 
AK059201TAAGCCCATCCGGCCCAAATNONE 
AK121839TAAGCCCATCCGGCCCAAATHypothetical protein. 
J023022K06TAAGCCCATCCGGCCCAAATNONE 
J023110K21TAAGCCCATCCGGCCCAAATNONE 
J033100N18TAAGCCCATCCGGCCCAAATNONE 
J033120D11TAAGCCCATCCGGCCCAAATNONE 
J065044P15TAAGCCCATCCGGCCCAAATNONE 
J065102G22TAAGCCCATCCGGCCCAAATNONE 
J065149N14TAAGCCCATCCGGCCCAAATNONE 
J065201L18TAAGCCCATCCGGCCCAAATNONE 
J065205K10TAAGCCCATCCGGCCCAAATNONE 
J075035D19TAAGCCCATCCGGCCCAAATNONE 
J075073E06TAAGCCCATCCGGCCCAAATNONE 
J075134M11TAAGCCCATCCGGCCCAAATNONE 
J090004P12TAAGCCCATCCGGCCCAAATNONE 
J090070H20TAAGCCCATCCGGCCCAAATNONE 
J090087B04TAAGCCCATCCGGCCCAAATNONE 
J100028F10TAAGCCCATCCGGCCCAAATNONE 
J100036M18TAAGCCCATCCGGCCCAAATNONE 
J100065C24TAAGCCCATCCGGCCCAAATNONE 
J100080O13TAAGCCCATCCGGCCCAAATNONE 
Os03g0701900AK068404GGGCCGGAConserved hypothetical protein. 
Os03g0709000009-027-F11CTTGGGCCGGANONE 
009-147-F02CTTGGGCCGGANONE 
015-068-A04CTTGGGCCGGANONE 
AK062406CTTGGGCCGGAMembrane-associated proteins in eicosanoid and glutathione metabolism (MAPEG) family protein. 
Os03g0711600X88799TCCGGCCCGGTSimilar to DNA binding protein (Fragment). 
Os03g0744700AK071178TCCGGCCCATTTConserved hypothetical protein. 
J075006D24TCCGGCCCATTTNONE 
J075165F21TCCGGCCCATTTNONE 
Os03g0754800AK101584ACATGGGCCGGAMitochondrial substrate carrier family protein. 
J080305A09ACATGGGCCGGANONE 
J080310E24ACATGGGCCGGANONE 
J080310O12ACATGGGCCGGANONE 
J080311N04ACATGGGCCGGANONE 
J080313N20ACATGGGCCGGANONE 
J080317H24ACATGGGCCGGANONE 
Os03g0761200011-038-H02AAATGGGCCGGAAAATGGGCCNONE 
015-055-D12AAATGGGCCGGAAAATGGGCCNONE 
016-032-B01AAATGGGCCGGAAAATGGGCCNONE 
AK064205AAATGGGCCGGAAAATGGGCCNONE 
AK101534AAATGGGCCGGAAAATGGGCCAnkyrin repeat containing protein. 
J075033L23AAATGGGCCGGAAAATGGGCCNONE 
J075046K09AAATGGGCCGGAAAATGGGCCNONE 
J075134K18AAATGGGCCGGAAAATGGGCCNONE 
J075157I10AAATGGGCCGGAAAATGGGCCNONE 
Os03g0766900AK066137TCCGGCCCATTTAllene oxide synthase. 
AK071361TCCGGCCCATTTNONE 
AK103989TCCGGCCCATTTNONE 
J023090K09TCCGGCCCATTTNONE 
J043022H11TCCGGCCCATTTNONE 
J053078F12TCCGGCCCATTTNONE 
Os03g0769600AK100054TCCGGCCCAGTTResB-like family protein. 
Os03g0784000AK067337GCTGGGCCGGANONE 
AK100003GCTGGGCCGGAFAD dependent oxidoreductase family protein. 
J013102O14GCTGGGCCGGANONE 
J013135F18GCTGGGCCGGANONE 
Os03g0784900006-053-H11TCCGGCCCACTNONE 
009-165-F11TCCGGCCCACTNONE 
AK060949TCCGGCCCACTConserved hypothetical protein. 
AK099097TCCGGCCCACTNONE 
J023019M19TCCGGCCCACTNONE 
J065024O11TCCGGCCCACTNONE 
J065106D20TCCGGCCCACTNONE 
J065201L15TCCGGCCCACTNONE 
J075031B04TCCGGCCCACTNONE 
J075033C19TCCGGCCCACTNONE 
J075035F11TCCGGCCCACTNONE 
J075074K14TCCGGCCCACTNONE 
J075083A22TCCGGCCCACTNONE 
J075120O10TCCGGCCCACTNONE 
J075153L20TCCGGCCCACTNONE 
J075159G02TCCGGCCCACTNONE 
J080001J18TCCGGCCCACTNONE 
J080015I03TCCGGCCCACTNONE 
J080027E23TCCGGCCCACTNONE 
J080046D24TCCGGCCCACTNONE 
J080053B17TCCGGCCCACTNONE 
J080070P07TCCGGCCCACTNONE 
J080076D18TCCGGCCCACTNONE 
J080078E13TCCGGCCCACTNONE 
J080090H03TCCGGCCCACTNONE 
J100024F19TCCGGCCCACTNONE 
J100052D15TCCGGCCCACTNONE 
J100079B14TCCGGCCCACTNONE 
Os03g0795800AK102207TCCGGCCCATATProtein of unknown function UPF0005 family protein. 
J023014M02TCCGGCCCATATNONE 
J023026E12TCCGGCCCATATNONE 
J023036I07TCCGGCCCATATNONE 
J023079M08TCCGGCCCATATNONE 
J023129D24TCCGGCCCATATNONE 
J033087H03TCCGGCCCATATNONE 
J033115G02TCCGGCCCATATNONE 
J033122G06TCCGGCCCATATNONE 
J033150J15TCCGGCCCATATNONE 
J065064L16TCCGGCCCATATNONE 
J065065H20TCCGGCCCATATNONE 
J065096I18TCCGGCCCATATNONE 
J065114A10TCCGGCCCATATNONE 
J065164G10TCCGGCCCATATNONE 
J065178L20TCCGGCCCATATNONE 
J075071D20TCCGGCCCATATNONE 
Os03g0795900012-092-G05ATATGGGCCGGANONE 
015-043-D09ATATGGGCCGGANONE 
016-078-G11ATATGGGCCGGANONE 
AK068660ATATGGGCCGGASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14ATATGGGCCGGANONE 
J023001L04ATATGGGCCGGANONE 
J053032K11ATATGGGCCGGANONE 
J065059E10ATATGGGCCGGANONE 
J065095H19ATATGGGCCGGANONE 
J065181M06ATATGGGCCGGANONE 
J100047D11ATATGGGCCGGANONE 
J100068G04ATATGGGCCGGANONE 
Os03g0797000AK073440TCCGGCCCATATSimilar to Indole synthase. 
AK073440TCCGGCCCATATSimilar to Indole synthase. 
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18GGCCGGGCCGGAACACGTGGGCCTANONE 
J033079G18GGCCGGGCCGGAACACGTGGGCCTANONE 
J043038B19GGCCGGGCCGGAACACGTGGGCCTANONE 
J065091E15GGCCGGGCCGGAACACGTGGGCCTANONE 
J065092P10GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189F18GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189L12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075021B11GGCCGGGCCGGAACACGTGGGCCTANONE 
J075022L15GGCCGGGCCGGAACACGTGGGCCTANONE 
J075046G12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075080H15GGCCGGGCCGGAACACGTGGGCCTANONE 
J090045H01GGCCGGGCCGGAACACGTGGGCCTANONE 
J090077H16GGCCGGGCCGGAACACGTGGGCCTANONE 
J090083D22GGCCGGGCCGGAACACGTGGGCCTANONE 
J100021D24GGCCGGGCCGGAACACGTGGGCCTANONE 
J100023G04GGCCGGGCCGGAACACGTGGGCCTANONE 
J100049J23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100075K23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100077G22GGCCGGGCCGGAACACGTGGGCCTANONE 
Os03g0800500006-075-C12TCCGGCCCCACCNONE 
AK061104TCCGGCCCCACCNONE 
AK070229TCCGGCCCCACCPutative small multi-drug export family protein. 
J065152L13TCCGGCCCCACCNONE 
Os03g0803800012-043-D10TCCGGCCCAATTNONE 
AK063484TCCGGCCCAATTConserved hypothetical protein. 
Os03g0822200AK069405GCTGGGCCGGANAD-dependent epimerase/dehydratase family protein. 
AK104151GCTGGGCCGGANONE 
AK104209GCTGGGCCGGANONE 
J065107D01GCTGGGCCGGANONE 
J065191L23GCTGGGCCGGANONE 
J065217B05GCTGGGCCGGANONE 
Os03g0822300AK060050TCCGGCCCAGCRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein. 
J065198I20TCCGGCCCAGCNONE 
Os03g0835400AK061773TCCGGCCCATTTSimilar to Uvs101. 
AK098986TCCGGCCCATTTNONE 
AK105896TCCGGCCCATTTNONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0850600AK067191TATTGGGCCGGAConserved hypothetical protein. 
J013095N12TATTGGGCCGGANONE 
J065214L06TATTGGGCCGGANONE 
J075093J10TATTGGGCCGGANONE 
Os04g0170500AK103323TCCGGCCCHypothetical protein. 
Os04g0306800AK058450GGGCCGGATCGGNONE 
Os04g0428900009-068-A06CCTGGGCCGGANONE 
AK061355CCTGGGCCGGASimilar to CSN8. 
AK099153CCTGGGCCGGANONE 
AY336991CCTGGGCCGGANONE 
J023069F08CCTGGGCCGGANONE 
J065112H12CCTGGGCCGGANONE 
J075022F23CCTGGGCCGGANONE 
J090045D23CCTGGGCCGGANONE 
J090067E18CCTGGGCCGGANONE 
J090099H14CCTGGGCCGGANONE 
Os04g0445100014-052-B04TCCGGCCCGGCNONE 
AK063700TCCGGCCCGGCSimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0486500AK111976TCCGGCCCACCTSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0528100009-090-G06TCCGGCCCATATNONE 
009-168-C11TCCGGCCCATATNONE 
AK065957TCCGGCCCATATConserved hypothetical protein. 
J013039G20TCCGGCCCATATNONE 
J013044D08TCCGGCCCATATNONE 
J065013L14TCCGGCCCATATNONE 
J065143H08TCCGGCCCATATNONE 
J065146C14TCCGGCCCATATNONE 
J065149K22TCCGGCCCATATNONE 
J065156B18TCCGGCCCATATNONE 
J065201A04TCCGGCCCATATNONE 
J065209A04TCCGGCCCATATNONE 
Os04g0562000006-096-A05AAATGGGCCGGANONE 
006-105-B08AAATGGGCCGGANONE 
AK060894AAATGGGCCGGANONE 
AK072630AAATGGGCCGGAZinc finger, DHHC-type domain containing protein. 
AK104521AAATGGGCCGGANONE 
J023038A11AAATGGGCCGGANONE 
J023130P03AAATGGGCCGGANONE 
J090006F10AAATGGGCCGGANONE 
J090007M22AAATGGGCCGGANONE 
Os04g0569300AK058648TCCGGCCCSimilar to Membrane protein. 
AK099082TCCGGCCCNONE 
J023002M21TCCGGCCCNONE 
J100080J18TCCGGCCCNONE 
Os04g0577000AK073711AACTGGGCCGGAUbiquitin fusion degradation protein UFD1 family protein. 
AK119957AACTGGGCCGGANONE 
J013127H04AACTGGGCCGGANONE 
J033035G06AACTGGGCCGGANONE 
J033061G23AACTGGGCCGGANONE 
J033127L07AACTGGGCCGGANONE 
J065015F17AACTGGGCCGGANONE 
J065062G08AACTGGGCCGGANONE 
J065132M07AACTGGGCCGGANONE 
J065155C12AACTGGGCCGGANONE 
J075055I08AACTGGGCCGGANONE 
J075140D07AACTGGGCCGGANONE 
J090055B21AACTGGGCCGGANONE 
J100031D23AACTGGGCCGGANONE 
Os04g0587300AK119483TCCGGCCCSimilar to Purine permease-like protein. 
Os04g0595000AK106907TCCGGCCCATGAPeptidase A1, pepsin family protein. 
Os04g0625600AK070994TTTTGGGCCGGATRAF-like domain containing protein. 
J023080H04TTTTGGGCCGGANONE 
J023086H15TTTTGGGCCGGANONE 
J033037L21TTTTGGGCCGGANONE 
J033044P14TTTTGGGCCGGANONE 
J065075C23TTTTGGGCCGGANONE 
J065167C18TTTTGGGCCGGANONE 
J100024E02TTTTGGGCCGGANONE 
J100068N24TTTTGGGCCGGANONE 
J100070G20TTTTGGGCCGGANONE 
Os04g0629700AK064973TCCGGCCCNONE 
Os04g0640800AK065522TATTGGGCCGGAProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0665000009-149-A12TCCGGCCCAAAANONE 
AK062995TCCGGCCCAAAACHCH domain containing protein. 
J065017G19TCCGGCCCAAAANONE 
J080301G12TCCGGCCCAAAANONE 
Os04g0684500AK066014TCCGGCCCACCCGGGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os05g0110300AK067116TCCGGCCCACANONE 
AK071038TCCGGCCCACANAD-dependent epimerase/dehydratase family protein. 
J065060E20TCCGGCCCACANONE 
J065093K05TCCGGCCCACANONE 
Os05g0110500AK060179TCCGGCCCACTNONE 
AK066175TCCGGCCCACTSimilar to RNA helicase (Fragment). 
J013055E22TCCGGCCCACTNONE 
J090056E03TCCGGCCCACTNONE 
Os05g0120800AK066865TCCGGCCCAACAConserved hypothetical protein. 
Os05g0122900009-052-C11TCCGGCCCACTNONE 
009-132-C12TCCGGCCCACTNONE 
014-091-G03TCCGGCCCACTNONE 
AB072977TCCGGCCCACTNONE 
AK071296TCCGGCCCACTNONE 
AK099375TCCGGCCCACTNONE 
AK104970TCCGGCCCACTBLE1 protein. 
J065007I09TCCGGCCCACTNONE 
J065081H07TCCGGCCCACTNONE 
J065122B18TCCGGCCCACTNONE 
J065181G15TCCGGCCCACTNONE 
J065182J07TCCGGCCCACTNONE 
J065197D23TCCGGCCCACTNONE 
J065197G08TCCGGCCCACTNONE 
J065201H20TCCGGCCCACTNONE 
J090034E11TCCGGCCCACTNONE 
J100077M04TCCGGCCCACTNONE 
Os05g0125900009-168-E11GGGCCGGANONE 
AK063078GGGCCGGAConserved hypothetical protein. 
AK119230GGGCCGGANONE 
Os05g0155100006-075-B02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
006-075-B02CCGTGGGCCGGANONE 
AK061929CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK061929CCGTGGGCCGGANONE 
AK102810CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK102810CCGTGGGCCGGANONE 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
AK120877CCGTGGGCCGGASimilar to 60S ribosomal protein L18. 
J013023E03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013023E03CCGTGGGCCGGANONE 
J013038C16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013038C16CCGTGGGCCGGANONE 
J013120M14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013120M14CCGTGGGCCGGANONE 
J013153B04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013153B04CCGTGGGCCGGANONE 
J013159B07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013159B07CCGTGGGCCGGANONE 
J023012A02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023012A02CCGTGGGCCGGANONE 
J023027F08CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027F08CCGTGGGCCGGANONE 
J023027I12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027I12CCGTGGGCCGGANONE 
J023120F05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023120F05CCGTGGGCCGGANONE 
J023138O03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023138O03CCGTGGGCCGGANONE 
J023142H13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023142H13CCGTGGGCCGGANONE 
J023143P06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023143P06CCGTGGGCCGGANONE 
J033023P09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033023P09CCGTGGGCCGGANONE 
J033035O14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033035O14CCGTGGGCCGGANONE 
J033042N19CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033042N19CCGTGGGCCGGANONE 
J033043B12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033043B12CCGTGGGCCGGANONE 
J033065D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033065D10CCGTGGGCCGGANONE 
J033081A12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033081A12CCGTGGGCCGGANONE 
J033084N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033084N05CCGTGGGCCGGANONE 
J033085M03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033085M03CCGTGGGCCGGANONE 
J033112D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033112D15CCGTGGGCCGGANONE 
J033114O07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033114O07CCGTGGGCCGGANONE 
J033119D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033119D15CCGTGGGCCGGANONE 
J033140E06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033140E06CCGTGGGCCGGANONE 
J033141K23CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033141K23CCGTGGGCCGGANONE 
J043040I22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J043040I22CCGTGGGCCGGANONE 
J053050B21CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053050B21CCGTGGGCCGGANONE 
J053065I18CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053065I18CCGTGGGCCGGANONE 
J053074O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053074O16CCGTGGGCCGGANONE 
J065072K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065072K13CCGTGGGCCGGANONE 
J065211I09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065211I09CCGTGGGCCGGANONE 
J090004K04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090004K04CCGTGGGCCGGANONE 
J090016L06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090016L06CCGTGGGCCGGANONE 
J090040F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090040F22CCGTGGGCCGGANONE 
J090063F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090063F22CCGTGGGCCGGANONE 
J090081J09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090081J09CCGTGGGCCGGANONE 
J100032A10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100032A10CCGTGGGCCGGANONE 
J100037G20CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100037G20CCGTGGGCCGGANONE 
J100056O10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100056O10CCGTGGGCCGGANONE 
J100071D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100071D10CCGTGGGCCGGANONE 
J100075K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100075K13CCGTGGGCCGGANONE 
J100079F16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100079F16CCGTGGGCCGGANONE 
J100080O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100080O16CCGTGGGCCGGANONE 
J100086N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100086N05CCGTGGGCCGGANONE 
Os05g0169400AK073439GCTGGGCCGGATCGGGCCGAProtein of unknown function DUF1421 family protein. 
AK073439TCCGGCCCAACProtein of unknown function DUF1421 family protein. 
J013110E15GCTGGGCCGGATCGGGCCGANONE 
J013110E15TCCGGCCCAACNONE 
J033044H02GCTGGGCCGGATCGGGCCGANONE 
J033044H02TCCGGCCCAACNONE 
Os05g0227800AK110997GGGCCGGAHomeodomain-like containing protein. 
Os05g0286100AK108829TCCGGCCCSimilar to Zinc-finger protein KNUCKLES. 
Os05g0347000009-013-E04AGTTGGGCCGGANONE 
AK109444AGTTGGGCCGGATAFII55 protein conserved region domain containing protein. 
J065049M12AGTTGGGCCGGANONE 
J065190K18AGTTGGGCCGGANONE 
J075169G13AGTTGGGCCGGANONE 
Os05g0372400AK068781TCCGGCCCLipase, class 3 family protein. 
Os05g0377000Os05g0377000GCTGGGCCAGATGGGCCGGASimilar to Acyl carrier protein (ACP). 
Os05g0395600Os05g0395600TGTGGGCCGGANONE 
Os05g0400600AK072045TCCGGCCCAACTCobalt transport protein family protein. 
Os05g0445500009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE 
Os05g0451200AK073037GCTGGGCCGGAConserved hypothetical protein. 
Os05g0456000AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
AK102036TCCGGCCCAACATGGATGGGCCTANONE 
J065066F02TCCGGCCCAACATGGATGGGCCTANONE 
Os05g0461000006-113-A06TCCGGCCCAATTNONE 
AB042259TCCGGCCCAATTNONE 
AK059189TCCGGCCCAATTNONE 
AK066739TCCGGCCCAATTClathrin adaptor complex, small chain family protein. 
AK099044TCCGGCCCAATTNONE 
AK104166TCCGGCCCAATTNONE 
Os05g0488900AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0490800J065037L19TCCGGCCCAACTNONE 
Os05g0539300Os05g0539300AGATGGGCCGGAProtein of unknown function DUF295 family protein. 
Os05g0565000AK102673TCCGGCCCAAACSimilar to 60S ribosomal protein L18a-1. 
J033102C12TCCGGCCCAAACNONE 
J033124C13TCCGGCCCAAACNONE 
J043003L04TCCGGCCCAAACNONE 
J043006N08TCCGGCCCAAACNONE 
Os05g0565200004-015-E06TCCGGCCCAACCNONE 
AK067090TCCGGCCCAACCSimilar to Urease accessory protein G. 
AK104200TCCGGCCCAACCNONE 
AK104368TCCGGCCCAACCNONE 
Os05g0573900J080085J19TCCGGCCCConserved hypothetical protein. 
Os05g0587400AK102121TCCGGCCCATCPrefoldin domain containing protein. 
J033084N12TCCGGCCCATCNONE 
Os06g0101600AF093636TCCGGCCCAGANONE 
AK070447TCCGGCCCAGAPlastocyanin, chloroplast precursor. 
J065001A20TCCGGCCCAGANONE 
J065019M17TCCGGCCCAGANONE 
J065021H18TCCGGCCCAGANONE 
J065061A17TCCGGCCCAGANONE 
J065073L02TCCGGCCCAGANONE 
J065099F17TCCGGCCCAGANONE 
J065101C23TCCGGCCCAGANONE 
J065121E23TCCGGCCCAGANONE 
J065122N04TCCGGCCCAGANONE 
J065141N05TCCGGCCCAGANONE 
J065143N21TCCGGCCCAGANONE 
J065161H09TCCGGCCCAGANONE 
J065161J04TCCGGCCCAGANONE 
J065162P20TCCGGCCCAGANONE 
J065182K10TCCGGCCCAGANONE 
J065184M05TCCGGCCCAGANONE 
J065186H24TCCGGCCCAGANONE 
J065189G21TCCGGCCCAGANONE 
J065190N14TCCGGCCCAGANONE 
J065191H08TCCGGCCCAGANONE 
J065205H17TCCGGCCCAGANONE 
J075001E03TCCGGCCCAGANONE 
J075001H21TCCGGCCCAGANONE 
J075003J23TCCGGCCCAGANONE 
J075003K01TCCGGCCCAGANONE 
J075005I11TCCGGCCCAGANONE 
J075007F16TCCGGCCCAGANONE 
J075017I11TCCGGCCCAGANONE 
J075018O05TCCGGCCCAGANONE 
J075019G24TCCGGCCCAGANONE 
J075032D04TCCGGCCCAGANONE 
J075032N13TCCGGCCCAGANONE 
J075033C09TCCGGCCCAGANONE 
J075033D11TCCGGCCCAGANONE 
J075039A20TCCGGCCCAGANONE 
J075058P12TCCGGCCCAGANONE 
J075062E10TCCGGCCCAGANONE 
J075062P16TCCGGCCCAGANONE 
J075063C17TCCGGCCCAGANONE 
J075066E07TCCGGCCCAGANONE 
J075066I20TCCGGCCCAGANONE 
J075075K21TCCGGCCCAGANONE 
J075078F03TCCGGCCCAGANONE 
J075082F10TCCGGCCCAGANONE 
J075086G16TCCGGCCCAGANONE 
J075087E07TCCGGCCCAGANONE 
J075087K06TCCGGCCCAGANONE 
J075087L04TCCGGCCCAGANONE 
J075088B16TCCGGCCCAGANONE 
J075088D02TCCGGCCCAGANONE 
J075094H21TCCGGCCCAGANONE 
J075094I24TCCGGCCCAGANONE 
J075094K10TCCGGCCCAGANONE 
J075095C18TCCGGCCCAGANONE 
J075097B05TCCGGCCCAGANONE 
J075099C13TCCGGCCCAGANONE 
J075099H22TCCGGCCCAGANONE 
J075099L16TCCGGCCCAGANONE 
J075104K08TCCGGCCCAGANONE 
J075118O06TCCGGCCCAGANONE 
J075119E15TCCGGCCCAGANONE 
J075124N06TCCGGCCCAGANONE 
J075126G02TCCGGCCCAGANONE 
J075127L24TCCGGCCCAGANONE 
J075131E23TCCGGCCCAGANONE 
J075140H06TCCGGCCCAGANONE 
J075146I20TCCGGCCCAGANONE 
J075146N24TCCGGCCCAGANONE 
J075147I19TCCGGCCCAGANONE 
J075155K07TCCGGCCCAGANONE 
J075156C05TCCGGCCCAGANONE 
J075161G07TCCGGCCCAGANONE 
J075164G01TCCGGCCCAGANONE 
J075170J18TCCGGCCCAGANONE 
J075172G17TCCGGCCCAGANONE 
J075176G10TCCGGCCCAGANONE 
J075178C05TCCGGCCCAGANONE 
J075179G01TCCGGCCCAGANONE 
J075181E24TCCGGCCCAGANONE 
J080029D19TCCGGCCCAGANONE 
J080034L11TCCGGCCCAGANONE 
J080039G07TCCGGCCCAGANONE 
J080062M23TCCGGCCCAGANONE 
J080302A01TCCGGCCCAGANONE 
J100042I15TCCGGCCCAGANONE 
J100043G22TCCGGCCCAGANONE 
J100056L12TCCGGCCCAGANONE 
J100061A12TCCGGCCCAGANONE 
J100073O20TCCGGCCCAGANONE 
J100082I08TCCGGCCCAGANONE 
Os06g0113600016-067-E03ATTTGGGCCGGANONE 
AK062095ATTTGGGCCGGANONE 
AK101235ATTTGGGCCGGACyclin-like F-box domain containing protein. 
AK122025ATTTGGGCCGGANONE 
J013022O19ATTTGGGCCGGANONE 
J023045P05ATTTGGGCCGGANONE 
J033031K01ATTTGGGCCGGANONE 
J033034I09ATTTGGGCCGGANONE 
J033041O04ATTTGGGCCGGANONE 
J033071K03ATTTGGGCCGGANONE 
J033075K16ATTTGGGCCGGANONE 
J033097M01ATTTGGGCCGGANONE 
J033099M22ATTTGGGCCGGANONE 
J033108N15ATTTGGGCCGGANONE 
J033121D18ATTTGGGCCGGANONE 
J033125O06ATTTGGGCCGGANONE 
J033139M16ATTTGGGCCGGANONE 
J033145P18ATTTGGGCCGGANONE 
J033149D05ATTTGGGCCGGANONE 
Os06g0114600015-077-E06TCCGGCCCAGTANONE 
AK067972TCCGGCCCAGTAConserved hypothetical protein. 
Os06g0131100AK112079CCAGGCCCAGCCCTCCGGCCCACTWD40-like domain containing protein. 
J033066L01CCAGGCCCAGCCCTCCGGCCCACTNONE 
J100044P22CCAGGCCCAGCCCTCCGGCCCACTNONE 
Os06g0134000AK102796TCCGGCCCAACCGGCCCACCCNONE 
Os06g0157800AK121504TCATGGGCCGGASimilar to CG7224 (Fragment). 
J033022L20TCATGGGCCGGANONE 
J075033D09TCATGGGCCGGANONE 
Os06g0168000AK059250TGTGGGCCGGANONE 
AK099356TGTGGGCCGGAGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19TGTGGGCCGGANONE 
J033097H04TGTGGGCCGGANONE 
J075087M11TGTGGGCCGGANONE 
J075146H06TGTGGGCCGGANONE 
J075188H11TGTGGGCCGGANONE 
J090071D03TGTGGGCCGGANONE 
J090097L20TGTGGGCCGGANONE 
J100051M05TGTGGGCCGGANONE 
J100082H13TGTGGGCCGGANONE 
Os06g0174350J043034B05AGTGGGCCTAGTTGGGCCGGAConserved hypothetical protein. 
Os06g0184300AK102933TCCGGCCCGCAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os06g0291100J043017O10CTTGGGCTTCCGGCCCAGCHypothetical protein. 
Os06g0604200AK100278TCCGGCCCCACCPhospholipase D. 
AK121264TCCGGCCCCACCNONE 
J023003G11TCCGGCCCCACCNONE 
J023012G13TCCGGCCCCACCNONE 
J023036E06TCCGGCCCCACCNONE 
J023054O05TCCGGCCCCACCNONE 
J023060H02TCCGGCCCCACCNONE 
J023073L15TCCGGCCCCACCNONE 
J023093E12TCCGGCCCCACCNONE 
J023095B08TCCGGCCCCACCNONE 
J023098K03TCCGGCCCCACCNONE 
J023109O19TCCGGCCCCACCNONE 
J023127M22TCCGGCCCCACCNONE 
J023135H10TCCGGCCCCACCNONE 
J023139M05TCCGGCCCCACCNONE 
J023145B08TCCGGCCCCACCNONE 
J043005P03TCCGGCCCCACCNONE 
J090054L01TCCGGCCCCACCNONE 
Os06g0650100009-016-C02GGGCCGGANONE 
AK062354GGGCCGGASimilar to Polyubiquitin gene (Fragment). 
Os06g0677600009-200-F02GGTTGGGCCGGANONE 
AK063252GGTTGGGCCGGALike-Sm ribonucleoprotein, core family protein. 
J075028G10GGTTGGGCCGGANONE 
J075189D08GGTTGGGCCGGANONE 
J090045C02GGTTGGGCCGGANONE 
Os06g0682800011-092-E01GCCGGGCCACATGGGCCGGANONE 
AK064816GCCGGGCCACATGGGCCGGAZinc finger, CCCH-type domain containing protein. 
J013000E13GCCGGGCCACATGGGCCGGANONE 
J013035J22GCCGGGCCACATGGGCCGGANONE 
J013045M06GCCGGGCCACATGGGCCGGANONE 
J013120A07GCCGGGCCACATGGGCCGGANONE 
J033144H15GCCGGGCCACATGGGCCGGANONE 
J033145H15GCCGGGCCACATGGGCCGGANONE 
J033145N16GCCGGGCCACATGGGCCGGANONE 
J090019J02GCCGGGCCACATGGGCCGGANONE 
Os06g0712900AK106648ACATGGGCCGGADihydrouridine synthase, DuS family protein. 
J075055M19ACATGGGCCGGANONE 
J075122I03ACATGGGCCGGANONE 
Os06g0715000AK107114TAATGGGCCGGAConserved hypothetical protein. 
Os06g0716700AB037681CGCCACGTGTCCGGCCCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385CGCCACGTGTCCGGCCCNONE 
AK102478CGCCACGTGTCCGGCCCNONE 
J013030D18CGCCACGTGTCCGGCCCNONE 
J090091L06CGCCACGTGTCCGGCCCNONE 
Os06g0717400AK072887TCCGGCCCPseudouridine synthase, Rlu family protein. 
Os07g0110100009-059-D11TATTGGGCCGGANONE 
AK071499TATTGGGCCGGAConserved hypothetical protein. 
J065064P17TATTGGGCCGGANONE 
J065111B09TATTGGGCCGGANONE 
J075099A14TATTGGGCCGGANONE 
J075139C23TATTGGGCCGGANONE 
Os07g0187300AK103069CCCGTGGGCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12CCCGTGGGCCGGANONE 
J033117P16CCCGTGGGCCGGANONE 
Os07g0209000AK059111CCACTGACGGTGGGGCCGGASimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319CCACTGACGGTGGGGCCGGANONE 
Os07g0213400003-104-B01TATGGGCCGGANONE 
AK062273TATGGGCCGGAConserved hypothetical protein. 
J065122P17TATGGGCCGGANONE 
J065160A01TATGGGCCGGANONE 
J090065M11TATGGGCCGGANONE 
Os07g0242600AK065752CCTGGGCCGGACyclin-like F-box domain containing protein. 
J013037K22CCTGGGCCGGANONE 
Os07g0408100AK108466TCCGGCCCATTTNONE 
AK111780TCCGGCCCATTTWD40-like domain containing protein. 
Os07g0555400AK070977CACGTGGGCCGGAConserved hypothetical protein. 
Os07g0570300AK100076TCCGGCCCAGCCCATCTPeptidase M16, C-terminal domain containing protein. 
J100033J04TCCGGCCCAGCCCATCTNONE 
J100065L10TCCGGCCCAGCCCATCTNONE 
Os07g0603100AK101352TCATGGGCCGGANuclear transport factor 2 domain containing protein. 
J023077E09TCATGGGCCGGANONE 
J023081N15TCATGGGCCGGANONE 
J033022N22TCATGGGCCGGANONE 
J033024M18TCATGGGCCGGANONE 
J033034P09TCATGGGCCGGANONE 
J033046A06TCATGGGCCGGANONE 
J033051K01TCATGGGCCGGANONE 
J033081P09TCATGGGCCGGANONE 
J033091B17TCATGGGCCGGANONE 
J033092K23TCATGGGCCGGANONE 
J033132J09TCATGGGCCGGANONE 
J033144A14TCATGGGCCGGANONE 
J033145A14TCATGGGCCGGANONE 
J043021B20TCATGGGCCGGANONE 
J053024D23TCATGGGCCGGANONE 
J065212J10TCATGGGCCGGANONE 
J090055M05TCATGGGCCGGANONE 
J090065E14TCATGGGCCGGANONE 
J090092J06TCATGGGCCGGANONE 
Os07g0614100AB032062ATTTGGGCCGGANONE 
AK058885ATTTGGGCCGGANONE 
AK069145ATTTGGGCCGGANONE 
AK102448ATTTGGGCCGGAAlpha 1-2 subunit of 20S proteasome. 
J023007E07ATTTGGGCCGGANONE 
J033093O06ATTTGGGCCGGANONE 
Os07g0618800009-116-H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
AK074019TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCSimilar to Centrin (Caltractin). 
J033074L14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J065187P13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080002E06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080010A10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080012N16TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080014F21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080016E05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080018L10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080021F24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080022M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023F12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023H02TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080024A13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080028H05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080030B18TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080031E07TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080033H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080038J06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080039M20TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042E01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042G10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080044H14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080046F19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080047A01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080049O03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080050H10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P09TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080056I06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061A12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061I04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080063K06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080069I24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080072D24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076D19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076F15TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076I22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076J11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080077C19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080080A22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081E12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081I23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080084H01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085A04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085N21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086A14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086G22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080096H06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080097G06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J090002O14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100072G23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100077M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
Os07g0630400AK060320TCCGGCCCRibonuclease T2 family protein. 
AK104512TCCGGCCCNONE 
J065002F22TCCGGCCCNONE 
Os07g0653100J065130E21TCATGGGCCGGAConserved hypothetical protein. 
J065186P07TCATGGGCCGGANONE 
Os07g0661600006-050-D12TCCGGCCCCACGCGNONE 
009-124-B10TCCGGCCCCACGCGNONE 
AK061123TCCGGCCCCACGCGNONE 
AK066432TCCGGCCCCACGCGSimilar to RNA-binding protein-like protein. 
AK104664TCCGGCCCCACGCGNONE 
J013064M13TCCGGCCCCACGCGNONE 
J013122O12TCCGGCCCCACGCGNONE 
J033044A16TCCGGCCCCACGCGNONE 
J033144D14TCCGGCCCCACGCGNONE 
J090078P13TCCGGCCCCACGCGNONE 
Os07g0680300009-195-E06TCCGGCCCATCTNONE 
AK063800TCCGGCCCATCTSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCCGGCCCATCTNONE 
J075066A20TCCGGCCCATCTNONE 
J075088I17TCCGGCCCATCTNONE 
J075147M19TCCGGCCCATCTNONE 
J075153L02TCCGGCCCATCTNONE 
J080013A21TCCGGCCCATCTNONE 
J080051B13TCCGGCCCATCTNONE 
J080077I24TCCGGCCCATCTNONE 
J080302B14TCCGGCCCATCTNONE 
J080309D22TCCGGCCCATCTNONE 
J100083B16TCCGGCCCATCTNONE 
Os07g0681700AK103213TCCGGCCCAGCGlycosyl transferase, family 8 protein. 
Os07g0695100AB189039AGATGGGCCGGATAGGCCCAGANONE 
AB189042AGATGGGCCGGATAGGCCCAGANONE 
AK059514AGATGGGCCGGATAGGCCCAGANONE 
AK066112AGATGGGCCGGATAGGCCCAGACheY-like domain containing protein. 
J013051N02AGATGGGCCGGATAGGCCCAGANONE 
J013127M02AGATGGGCCGGATAGGCCCAGANONE 
J023007I05AGATGGGCCGGATAGGCCCAGANONE 
Os08g0107500013-094-H02TCCGGCCCACGAACCAGCCCAATTNONE 
013-095-E07TCCGGCCCACGAACCAGCCCAATTNONE 
AK064053TCCGGCCCACGAACCAGCCCAATTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK101418TCCGGCCCACGAACCAGCCCAATTNONE 
J033037P14TCCGGCCCACGAACCAGCCCAATTNONE 
J090025I15TCCGGCCCACGAACCAGCCCAATTNONE 
J100022F23TCCGGCCCACGAACCAGCCCAATTNONE 
Os08g0107900014-055-C03TCCGGCCCAATTNONE 
J065062G20TCCGGCCCAATTNONE 
Os08g0116500009-007-E05AACGGGCCGGANONE 
009-007-E05GAGGCCCACGATCCGGCCCAAGNONE 
009-074-C07AACGGGCCGGANONE 
009-074-C07GAGGCCCACGATCCGGCCCAAGNONE 
009-098-A07AACGGGCCGGANONE 
009-098-A07GAGGCCCACGATCCGGCCCAAGNONE 
009-100-C03AACGGGCCGGANONE 
009-100-C03GAGGCCCACGATCCGGCCCAAGNONE 
009-136-E04AACGGGCCGGANONE 
009-136-E04GAGGCCCACGATCCGGCCCAAGNONE 
009-138-B08AACGGGCCGGANONE 
009-138-B08GAGGCCCACGATCCGGCCCAAGNONE 
009-144-B06AACGGGCCGGANONE 
009-144-B06GAGGCCCACGATCCGGCCCAAGNONE 
009-184-E04AACGGGCCGGANONE 
009-184-E04GAGGCCCACGATCCGGCCCAAGNONE 
009-189-F01AACGGGCCGGANONE 
009-189-F01GAGGCCCACGATCCGGCCCAAGNONE 
013-006-E05AACGGGCCGGANONE 
013-006-E05GAGGCCCACGATCCGGCCCAAGNONE 
013-015-C10AACGGGCCGGANONE 
013-015-C10GAGGCCCACGATCCGGCCCAAGNONE 
013-019-F09AACGGGCCGGANONE 
013-019-F09GAGGCCCACGATCCGGCCCAAGNONE 
013-020-C01AACGGGCCGGANONE 
013-020-C01GAGGCCCACGATCCGGCCCAAGNONE 
013-021-F05AACGGGCCGGANONE 
013-021-F05GAGGCCCACGATCCGGCCCAAGNONE 
013-035-D08AACGGGCCGGANONE 
013-035-D08GAGGCCCACGATCCGGCCCAAGNONE 
013-038-C09AACGGGCCGGANONE 
013-038-C09GAGGCCCACGATCCGGCCCAAGNONE 
013-054-B07AACGGGCCGGANONE 
013-054-B07GAGGCCCACGATCCGGCCCAAGNONE 
013-061-G10AACGGGCCGGANONE 
013-061-G10GAGGCCCACGATCCGGCCCAAGNONE 
013-074-B01AACGGGCCGGANONE 
013-074-B01GAGGCCCACGATCCGGCCCAAGNONE 
013-079-B06AACGGGCCGGANONE 
013-079-B06GAGGCCCACGATCCGGCCCAAGNONE 
013-099-B09AACGGGCCGGANONE 
013-099-B09GAGGCCCACGATCCGGCCCAAGNONE 
013-099-G11AACGGGCCGGANONE 
013-099-G11GAGGCCCACGATCCGGCCCAAGNONE 
014-023-F04AACGGGCCGGANONE 
014-023-F04GAGGCCCACGATCCGGCCCAAGNONE 
014-032-C07AACGGGCCGGANONE 
014-032-C07GAGGCCCACGATCCGGCCCAAGNONE 
014-045-E02AACGGGCCGGANONE 
014-045-E02GAGGCCCACGATCCGGCCCAAGNONE 
014-085-C02AACGGGCCGGANONE 
014-085-C02GAGGCCCACGATCCGGCCCAAGNONE 
014-087-F04AACGGGCCGGANONE 
014-087-F04GAGGCCCACGATCCGGCCCAAGNONE 
014-089-C04AACGGGCCGGANONE 
014-089-C04GAGGCCCACGATCCGGCCCAAGNONE 
014-090-E01AACGGGCCGGANONE 
014-090-E01GAGGCCCACGATCCGGCCCAAGNONE 
014-094-G11AACGGGCCGGANONE 
014-094-G11GAGGCCCACGATCCGGCCCAAGNONE 
014-097-B07AACGGGCCGGANONE 
014-097-B07GAGGCCCACGATCCGGCCCAAGNONE 
015-024-A12AACGGGCCGGANONE 
015-024-A12GAGGCCCACGATCCGGCCCAAGNONE 
015-032-C06AACGGGCCGGANONE 
015-032-C06GAGGCCCACGATCCGGCCCAAGNONE 
016-053-E09AACGGGCCGGANONE 
016-053-E09GAGGCCCACGATCCGGCCCAAGNONE 
016-081-F10AACGGGCCGGANONE 
016-081-F10GAGGCCCACGATCCGGCCCAAGNONE 
AK058240AACGGGCCGGASimilar to 60S acidic ribosomal protein P1 (L12). 
AK058240GAGGCCCACGATCCGGCCCAAGSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09AACGGGCCGGANONE 
J023079C09GAGGCCCACGATCCGGCCCAAGNONE 
J023107O19AACGGGCCGGANONE 
J023107O19GAGGCCCACGATCCGGCCCAAGNONE 
J053029K21AACGGGCCGGANONE 
J053029K21GAGGCCCACGATCCGGCCCAAGNONE 
J053073P11AACGGGCCGGANONE 
J053073P11GAGGCCCACGATCCGGCCCAAGNONE 
J053074B04AACGGGCCGGANONE 
J053074B04GAGGCCCACGATCCGGCCCAAGNONE 
J053078M14AACGGGCCGGANONE 
J053078M14GAGGCCCACGATCCGGCCCAAGNONE 
J065001E12AACGGGCCGGANONE 
J065001E12GAGGCCCACGATCCGGCCCAAGNONE 
J065006J12AACGGGCCGGANONE 
J065006J12GAGGCCCACGATCCGGCCCAAGNONE 
J065015C06AACGGGCCGGANONE 
J065015C06GAGGCCCACGATCCGGCCCAAGNONE 
J065025D13AACGGGCCGGANONE 
J065025D13GAGGCCCACGATCCGGCCCAAGNONE 
J065029A04AACGGGCCGGANONE 
J065029A04GAGGCCCACGATCCGGCCCAAGNONE 
J065031D23AACGGGCCGGANONE 
J065031D23GAGGCCCACGATCCGGCCCAAGNONE 
J065032E24AACGGGCCGGANONE 
J065032E24GAGGCCCACGATCCGGCCCAAGNONE 
J065034P16AACGGGCCGGANONE 
J065034P16GAGGCCCACGATCCGGCCCAAGNONE 
J065043B04AACGGGCCGGANONE 
J065043B04GAGGCCCACGATCCGGCCCAAGNONE 
J065044A15AACGGGCCGGANONE 
J065044A15GAGGCCCACGATCCGGCCCAAGNONE 
J065062D18AACGGGCCGGANONE 
J065062D18GAGGCCCACGATCCGGCCCAAGNONE 
J065079G13AACGGGCCGGANONE 
J065079G13GAGGCCCACGATCCGGCCCAAGNONE 
J065080A19AACGGGCCGGANONE 
J065080A19GAGGCCCACGATCCGGCCCAAGNONE 
J065080A20AACGGGCCGGANONE 
J065080A20GAGGCCCACGATCCGGCCCAAGNONE 
J065089N19AACGGGCCGGANONE 
J065089N19GAGGCCCACGATCCGGCCCAAGNONE 
J065111O07AACGGGCCGGANONE 
J065111O07GAGGCCCACGATCCGGCCCAAGNONE 
J065115N15AACGGGCCGGANONE 
J065115N15GAGGCCCACGATCCGGCCCAAGNONE 
J065131A04AACGGGCCGGANONE 
J065131A04GAGGCCCACGATCCGGCCCAAGNONE 
J065138H02AACGGGCCGGANONE 
J065138H02GAGGCCCACGATCCGGCCCAAGNONE 
J065139K10AACGGGCCGGANONE 
J065139K10GAGGCCCACGATCCGGCCCAAGNONE 
J065144A02AACGGGCCGGANONE 
J065144A02GAGGCCCACGATCCGGCCCAAGNONE 
J065155J17AACGGGCCGGANONE 
J065155J17GAGGCCCACGATCCGGCCCAAGNONE 
J065159D18AACGGGCCGGANONE 
J065159D18GAGGCCCACGATCCGGCCCAAGNONE 
J065159I18AACGGGCCGGANONE 
J065159I18GAGGCCCACGATCCGGCCCAAGNONE 
J065167H12AACGGGCCGGANONE 
J065167H12GAGGCCCACGATCCGGCCCAAGNONE 
J065174C22AACGGGCCGGANONE 
J065174C22GAGGCCCACGATCCGGCCCAAGNONE 
J065184A05AACGGGCCGGANONE 
J065184A05GAGGCCCACGATCCGGCCCAAGNONE 
J065188M15AACGGGCCGGANONE 
J065188M15GAGGCCCACGATCCGGCCCAAGNONE 
J065191D23AACGGGCCGGANONE 
J065191D23GAGGCCCACGATCCGGCCCAAGNONE 
J065203C07AACGGGCCGGANONE 
J065203C07GAGGCCCACGATCCGGCCCAAGNONE 
J065207C23AACGGGCCGGANONE 
J065207C23GAGGCCCACGATCCGGCCCAAGNONE 
J065207L16AACGGGCCGGANONE 
J065207L16GAGGCCCACGATCCGGCCCAAGNONE 
J065212F01AACGGGCCGGANONE 
J065212F01GAGGCCCACGATCCGGCCCAAGNONE 
J065212F05AACGGGCCGGANONE 
J065212F05GAGGCCCACGATCCGGCCCAAGNONE 
J075037B07AACGGGCCGGANONE 
J075037B07GAGGCCCACGATCCGGCCCAAGNONE 
J075042F15AACGGGCCGGANONE 
J075042F15GAGGCCCACGATCCGGCCCAAGNONE 
J075059J03AACGGGCCGGANONE 
J075059J03GAGGCCCACGATCCGGCCCAAGNONE 
J075068M18AACGGGCCGGANONE 
J075068M18GAGGCCCACGATCCGGCCCAAGNONE 
J075079E13AACGGGCCGGANONE 
J075079E13GAGGCCCACGATCCGGCCCAAGNONE 
J075081F12AACGGGCCGGANONE 
J075081F12GAGGCCCACGATCCGGCCCAAGNONE 
J075083I05AACGGGCCGGANONE 
J075083I05GAGGCCCACGATCCGGCCCAAGNONE 
J075123K23AACGGGCCGGANONE 
J075123K23GAGGCCCACGATCCGGCCCAAGNONE 
J075142F16AACGGGCCGGANONE 
J075142F16GAGGCCCACGATCCGGCCCAAGNONE 
J075156N03AACGGGCCGGANONE 
J075156N03GAGGCCCACGATCCGGCCCAAGNONE 
J075162K05AACGGGCCGGANONE 
J075162K05GAGGCCCACGATCCGGCCCAAGNONE 
J075171E08AACGGGCCGGANONE 
J075171E08GAGGCCCACGATCCGGCCCAAGNONE 
J075177N03AACGGGCCGGANONE 
J075177N03GAGGCCCACGATCCGGCCCAAGNONE 
J075182K17AACGGGCCGGANONE 
J075182K17GAGGCCCACGATCCGGCCCAAGNONE 
J075186K02AACGGGCCGGANONE 
J075186K02GAGGCCCACGATCCGGCCCAAGNONE 
J075191K05AACGGGCCGGANONE 
J075191K05GAGGCCCACGATCCGGCCCAAGNONE 
J080011E10AACGGGCCGGANONE 
J080011E10GAGGCCCACGATCCGGCCCAAGNONE 
J080016M21AACGGGCCGGANONE 
J080016M21GAGGCCCACGATCCGGCCCAAGNONE 
J080017A17AACGGGCCGGANONE 
J080017A17GAGGCCCACGATCCGGCCCAAGNONE 
J080031O09AACGGGCCGGANONE 
J080031O09GAGGCCCACGATCCGGCCCAAGNONE 
J080039G21AACGGGCCGGANONE 
J080039G21GAGGCCCACGATCCGGCCCAAGNONE 
J080041B01AACGGGCCGGANONE 
J080041B01GAGGCCCACGATCCGGCCCAAGNONE 
J080050G20AACGGGCCGGANONE 
J080050G20GAGGCCCACGATCCGGCCCAAGNONE 
J080054A12AACGGGCCGGANONE 
J080054A12GAGGCCCACGATCCGGCCCAAGNONE 
J080058O08AACGGGCCGGANONE 
J080058O08GAGGCCCACGATCCGGCCCAAGNONE 
J080061N04AACGGGCCGGANONE 
J080061N04GAGGCCCACGATCCGGCCCAAGNONE 
J080064L23AACGGGCCGGANONE 
J080064L23GAGGCCCACGATCCGGCCCAAGNONE 
J080064P05AACGGGCCGGANONE 
J080064P05GAGGCCCACGATCCGGCCCAAGNONE 
J080069I17AACGGGCCGGANONE 
J080069I17GAGGCCCACGATCCGGCCCAAGNONE 
J080070E07AACGGGCCGGANONE 
J080070E07GAGGCCCACGATCCGGCCCAAGNONE 
J080071B20AACGGGCCGGANONE 
J080071B20GAGGCCCACGATCCGGCCCAAGNONE 
J080074L08AACGGGCCGGANONE 
J080074L08GAGGCCCACGATCCGGCCCAAGNONE 
J080076N08AACGGGCCGGANONE 
J080076N08GAGGCCCACGATCCGGCCCAAGNONE 
J080081A14AACGGGCCGGANONE 
J080081A14GAGGCCCACGATCCGGCCCAAGNONE 
J080081J17AACGGGCCGGANONE 
J080081J17GAGGCCCACGATCCGGCCCAAGNONE 
J080085N14AACGGGCCGGANONE 
J080085N14GAGGCCCACGATCCGGCCCAAGNONE 
J080090B09AACGGGCCGGANONE 
J080090B09GAGGCCCACGATCCGGCCCAAGNONE 
J080097L11AACGGGCCGGANONE 
J080097L11GAGGCCCACGATCCGGCCCAAGNONE 
J080306H13AACGGGCCGGANONE 
J080306H13GAGGCCCACGATCCGGCCCAAGNONE 
J080307H13AACGGGCCGGANONE 
J080307H13GAGGCCCACGATCCGGCCCAAGNONE 
J080311F12AACGGGCCGGANONE 
J080311F12GAGGCCCACGATCCGGCCCAAGNONE 
J080316L23AACGGGCCGGANONE 
J080316L23GAGGCCCACGATCCGGCCCAAGNONE 
J080318H02AACGGGCCGGANONE 
J080318H02GAGGCCCACGATCCGGCCCAAGNONE 
J090016L15AACGGGCCGGANONE 
J090016L15GAGGCCCACGATCCGGCCCAAGNONE 
J090019I02AACGGGCCGGANONE 
J090019I02GAGGCCCACGATCCGGCCCAAGNONE 
J090031G21AACGGGCCGGANONE 
J090031G21GAGGCCCACGATCCGGCCCAAGNONE 
J090066C15AACGGGCCGGANONE 
J090066C15GAGGCCCACGATCCGGCCCAAGNONE 
J100032I02AACGGGCCGGANONE 
J100032I02GAGGCCCACGATCCGGCCCAAGNONE 
J100032N07AACGGGCCGGANONE 
J100032N07GAGGCCCACGATCCGGCCCAAGNONE 
J100032N16AACGGGCCGGANONE 
J100032N16GAGGCCCACGATCCGGCCCAAGNONE 
J100041P21AACGGGCCGGANONE 
J100041P21GAGGCCCACGATCCGGCCCAAGNONE 
J100048M04AACGGGCCGGANONE 
J100048M04GAGGCCCACGATCCGGCCCAAGNONE 
J100048M14AACGGGCCGGANONE 
J100048M14GAGGCCCACGATCCGGCCCAAGNONE 
J100063B08AACGGGCCGGANONE 
J100063B08GAGGCCCACGATCCGGCCCAAGNONE 
J100088E20AACGGGCCGGANONE 
J100088E20GAGGCCCACGATCCGGCCCAAGNONE 
J100090I08AACGGGCCGGANONE 
J100090I08GAGGCCCACGATCCGGCCCAAGNONE 
Os08g0156900AJ605583TCCGGCCCACCANONE 
AK073344TCCGGCCCACCASpo11/DNA topoisomerase VI, subunit A family protein. 
AK106397TCCGGCCCACCANONE 
Os08g0158900AK067062ACATGGGCCGGAGTP1/OBG domain containing protein. 
J013089F04ACATGGGCCGGANONE 
J013092D16ACATGGGCCGGANONE 
J033120K14ACATGGGCCGGANONE 
J033133F24ACATGGGCCGGANONE 
J033145A10ACATGGGCCGGANONE 
J033145A11ACATGGGCCGGANONE 
J053048H24ACATGGGCCGGANONE 
J053075H10ACATGGGCCGGANONE 
Os08g0159000AK073617TCCGGCCCATGTNONE 
AK103973TCCGGCCCATGTSimilar to DnaJ homolog subfamily C member 1. 
J023130H14TCCGGCCCATGTNONE 
J033051J11TCCGGCCCATGTNONE 
J065101C10TCCGGCCCATGTNONE 
J065168B04TCCGGCCCATGTNONE 
J065184E22TCCGGCCCATGTNONE 
J080021D11TCCGGCCCATGTNONE 
J080025H10TCCGGCCCATGTNONE 
J080026N19TCCGGCCCATGTNONE 
J080034A12TCCGGCCCATGTNONE 
J080040L02TCCGGCCCATGTNONE 
J080042H19TCCGGCCCATGTNONE 
J080047B05TCCGGCCCATGTNONE 
J080047E09TCCGGCCCATGTNONE 
J080047I01TCCGGCCCATGTNONE 
J080052H19TCCGGCCCATGTNONE 
J080062K13TCCGGCCCATGTNONE 
J080063A22TCCGGCCCATGTNONE 
J080068G18TCCGGCCCATGTNONE 
J080068N19TCCGGCCCATGTNONE 
J080076G08TCCGGCCCATGTNONE 
J080077H13TCCGGCCCATGTNONE 
J080077K06TCCGGCCCATGTNONE 
J080093D15TCCGGCCCATGTNONE 
J080094D21TCCGGCCCATGTNONE 
J080097A20TCCGGCCCATGTNONE 
J080097E21TCCGGCCCATGTNONE 
J080097N17TCCGGCCCATGTNONE 
J100071K18TCCGGCCCATGTNONE 
J100072F09TCCGGCCCATGTNONE 
Os08g0363000015-090-A07TAATGGGCCTCCGGCCCGGTNONE 
AK103677TAATGGGCCTCCGGCCCGGTNONE 
AK106532TAATGGGCCTCCGGCCCGGTProtein of unknown function DUF295 family protein. 
J033136B21TAATGGGCCTCCGGCCCGGTNONE 
J033136E01TAATGGGCCTCCGGCCCGGTNONE 
J043029N11TAATGGGCCTCCGGCCCGGTNONE 
J065071G13TAATGGGCCTCCGGCCCGGTNONE 
J065105J22TAATGGGCCTCCGGCCCGGTNONE 
J075084B18TAATGGGCCTCCGGCCCGGTNONE 
Os08g0435800AK121712TCCGGCCCATGGSimilar to Lipoate protein ligase-like protein. 
J065121P15TCCGGCCCATGGNONE 
Os08g0442300006-067-F05GCTGGGCCAGGCCGGGCCGGANONE 
006-067-F05GGGCCGGANONE 
AK059843GCTGGGCCAGGCCGGGCCGGANONE 
AK059843GGGCCGGANONE 
AK071719GCTGGGCCAGGCCGGGCCGGASimilar to Calcineurin-like protein. 
AK071719GGGCCGGASimilar to Calcineurin-like protein. 
AK102411GCTGGGCCAGGCCGGGCCGGANONE 
AK102411GGGCCGGANONE 
J023108H11GCTGGGCCAGGCCGGGCCGGANONE 
J023108H11GGGCCGGANONE 
J033092P05GCTGGGCCAGGCCGGGCCGGANONE 
J033092P05GGGCCGGANONE 
J075109C09GCTGGGCCAGGCCGGGCCGGANONE 
J075109C09GGGCCGGANONE 
J090070B02GCTGGGCCAGGCCGGGCCGGANONE 
J090070B02GGGCCGGANONE 
J090076M14GCTGGGCCAGGCCGGGCCGGANONE 
J090076M14GGGCCGGANONE 
J100064B16GCTGGGCCAGGCCGGGCCGGANONE 
J100064B16GGGCCGGANONE 
Os08g0493900AK101284AAATGGGCCGGANONE 
AK111820AAATGGGCCGGAWD40-like domain containing protein. 
Os08g0517600009-066-H05TCCGGCCCATCTNONE 
AK073374TCCGGCCCATCTNONE 
AK105385TCCGGCCCATCTSAM (and some other nucleotide) binding motif domain containing protein. 
J065165P07TCCGGCCCATCTNONE 
J075004A12TCCGGCCCATCTNONE 
J075062F16TCCGGCCCATCTNONE 
J075115K05TCCGGCCCATCTNONE 
J075116H09TCCGGCCCATCTNONE 
Os08g0532300009-122-A05TCCGGCCCAGTANONE 
009-129-H05TCCGGCCCAGTANONE 
AB011262TCCGGCCCAGTANONE 
AK065141TCCGGCCCAGTANONE 
AK119730TCCGGCCCAGTASimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14TCCGGCCCAGTANONE 
J013042K23TCCGGCCCAGTANONE 
J023057J08TCCGGCCCAGTANONE 
J023057N10TCCGGCCCAGTANONE 
J023113C21TCCGGCCCAGTANONE 
J053054E03TCCGGCCCAGTANONE 
J053062B07TCCGGCCCAGTANONE 
J053075O17TCCGGCCCAGTANONE 
J053075P09TCCGGCCCAGTANONE 
J065024H05TCCGGCCCAGTANONE 
J065049F22TCCGGCCCAGTANONE 
J065063L03TCCGGCCCAGTANONE 
J065102O07TCCGGCCCAGTANONE 
J065104M12TCCGGCCCAGTANONE 
J065119E04TCCGGCCCAGTANONE 
J065153E10TCCGGCCCAGTANONE 
J065168M24TCCGGCCCAGTANONE 
J065173I10TCCGGCCCAGTANONE 
J065181L04TCCGGCCCAGTANONE 
J065184I18TCCGGCCCAGTANONE 
J065203M15TCCGGCCCAGTANONE 
J075004C21TCCGGCCCAGTANONE 
J075047B11TCCGGCCCAGTANONE 
J075055F18TCCGGCCCAGTANONE 
J075065G09TCCGGCCCAGTANONE 
J075094O14TCCGGCCCAGTANONE 
J075143C22TCCGGCCCAGTANONE 
J075153K18TCCGGCCCAGTANONE 
J075164N10TCCGGCCCAGTANONE 
J075197C11TCCGGCCCAGTANONE 
J080001A01TCCGGCCCAGTANONE 
J080003B11TCCGGCCCAGTANONE 
J080006G17TCCGGCCCAGTANONE 
J080007J06TCCGGCCCAGTANONE 
J080010H12TCCGGCCCAGTANONE 
J080014I01TCCGGCCCAGTANONE 
J080015C16TCCGGCCCAGTANONE 
J080016P19TCCGGCCCAGTANONE 
J080020G24TCCGGCCCAGTANONE 
J080021E12TCCGGCCCAGTANONE 
J080023I11TCCGGCCCAGTANONE 
J080024H24TCCGGCCCAGTANONE 
J080025G18TCCGGCCCAGTANONE 
J080028H08TCCGGCCCAGTANONE 
J080030G08TCCGGCCCAGTANONE 
J080031H20TCCGGCCCAGTANONE 
J080034C20TCCGGCCCAGTANONE 
J080040H13TCCGGCCCAGTANONE 
J080044M04TCCGGCCCAGTANONE 
J080047D02TCCGGCCCAGTANONE 
J080049D17TCCGGCCCAGTANONE 
J080049J17TCCGGCCCAGTANONE 
J080050A05TCCGGCCCAGTANONE 
J080051C11TCCGGCCCAGTANONE 
J080051K06TCCGGCCCAGTANONE 
J080053A07TCCGGCCCAGTANONE 
J080053I08TCCGGCCCAGTANONE 
J080056L12TCCGGCCCAGTANONE 
J080061I19TCCGGCCCAGTANONE 
J080075G09TCCGGCCCAGTANONE 
J080078C23TCCGGCCCAGTANONE 
J080080I21TCCGGCCCAGTANONE 
J080084F04TCCGGCCCAGTANONE 
J080085K16TCCGGCCCAGTANONE 
J080097A12TCCGGCCCAGTANONE 
J080097N01TCCGGCCCAGTANONE 
J090027L10TCCGGCCCAGTANONE 
J100034N17TCCGGCCCAGTANONE 
Os08g0532400AK101608TACTGGGCCGGASimilar to AT.I.24-7 protein. 
Os08g0548900006-043-D07TCCGGCCCATGGGCCAANONE 
006-043-H11TCCGGCCCATGGGCCAANONE 
006-081-G06TCCGGCCCATGGGCCAANONE 
006-109-E04TCCGGCCCATGGGCCAANONE 
011-033-E04TCCGGCCCATGGGCCAANONE 
AK061808TCCGGCCCATGGGCCAASimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK098875TCCGGCCCATGGGCCAANONE 
J013001D12TCCGGCCCATGGGCCAANONE 
J033126N14TCCGGCCCATGGGCCAANONE 
J053069M09TCCGGCCCATGGGCCAANONE 
J053098E10TCCGGCCCATGGGCCAANONE 
J053101C24TCCGGCCCATGGGCCAANONE 
J065002F21TCCGGCCCATGGGCCAANONE 
J065006C22TCCGGCCCATGGGCCAANONE 
J065076J02TCCGGCCCATGGGCCAANONE 
J065134M22TCCGGCCCATGGGCCAANONE 
J075007M19TCCGGCCCATGGGCCAANONE 
J075040I11TCCGGCCCATGGGCCAANONE 
J075047E20TCCGGCCCATGGGCCAANONE 
J075052D22TCCGGCCCATGGGCCAANONE 
J075076L13TCCGGCCCATGGGCCAANONE 
J075157P22TCCGGCCCATGGGCCAANONE 
J075161M18TCCGGCCCATGGGCCAANONE 
J075168P22TCCGGCCCATGGGCCAANONE 
J075181E04TCCGGCCCATGGGCCAANONE 
U92540TCCGGCCCATGGGCCAANONE 
Os08g0549300009-008-F01CATGGGCCGGANONE 
009-008-F01GGGCCGGANONE 
009-033-G10CATGGGCCGGANONE 
009-033-G10GGGCCGGANONE 
AK120938CATGGGCCGGASimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
AK120938GGGCCGGASimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420CATGGGCCGGANONE 
D10420GGGCCGGANONE 
J023037A21CATGGGCCGGANONE 
J023037A21GGGCCGGANONE 
J023066D20CATGGGCCGGANONE 
J023066D20GGGCCGGANONE 
J033099K13CATGGGCCGGANONE 
J033099K13GGGCCGGANONE 
J065116C14CATGGGCCGGANONE 
J065116C14GGGCCGGANONE 
J075009K15CATGGGCCGGANONE 
J075009K15GGGCCGGANONE 
J075071P13CATGGGCCGGANONE 
J075071P13GGGCCGGANONE 
J075080D18CATGGGCCGGANONE 
J075080D18GGGCCGGANONE 
J075124F24CATGGGCCGGANONE 
J075124F24GGGCCGGANONE 
J075198F23CATGGGCCGGANONE 
J075198F23GGGCCGGANONE 
J080006B15CATGGGCCGGANONE 
J080006B15GGGCCGGANONE 
J090078H13CATGGGCCGGANONE 
J090078H13GGGCCGGANONE 
J090089J09CATGGGCCGGANONE 
J090089J09GGGCCGGANONE 
J100017A03CATGGGCCGGANONE 
J100017A03GGGCCGGANONE 
J100023G03CATGGGCCGGANONE 
J100023G03GGGCCGGANONE 
Os08g0553450Os08g0553450TCCGGCCCACAHypothetical protein. 
Os08g0557000AK059917TCCGGCCCATGGNONE 
AK100496TCCGGCCCATGGSimilar to Protein-L-isoaspartate O-methyltransferase. 
Os08g0557100AK070743AAATGGGCCGGANONE 
AK101214AAATGGGCCGGASimilar to Nucleic acid-binding protein precursor. 
AK105901AAATGGGCCGGANONE 
J033031B04AAATGGGCCGGANONE 
J080004F08AAATGGGCCGGANONE 
J080004H12AAATGGGCCGGANONE 
J080005H08AAATGGGCCGGANONE 
J080005I02AAATGGGCCGGANONE 
J080008N16AAATGGGCCGGANONE 
J080009H23AAATGGGCCGGANONE 
J080012H17AAATGGGCCGGANONE 
J080012J21AAATGGGCCGGANONE 
J080013I20AAATGGGCCGGANONE 
J080016E07AAATGGGCCGGANONE 
J080018O04AAATGGGCCGGANONE 
J080020B18AAATGGGCCGGANONE 
J080021I16AAATGGGCCGGANONE 
J080022N01AAATGGGCCGGANONE 
J080023G08AAATGGGCCGGANONE 
J080023N09AAATGGGCCGGANONE 
J080024J24AAATGGGCCGGANONE 
J080025M12AAATGGGCCGGANONE 
J080028A22AAATGGGCCGGANONE 
J080028I01AAATGGGCCGGANONE 
J080029D22AAATGGGCCGGANONE 
J080030M02AAATGGGCCGGANONE 
J080031B06AAATGGGCCGGANONE 
J080035G08AAATGGGCCGGANONE 
J080036F19AAATGGGCCGGANONE 
J080038P14AAATGGGCCGGANONE 
J080039C17AAATGGGCCGGANONE 
J080043A10AAATGGGCCGGANONE 
J080044H02AAATGGGCCGGANONE 
J080044P12AAATGGGCCGGANONE 
J080047L06AAATGGGCCGGANONE 
J080050L06AAATGGGCCGGANONE 
J080052J11AAATGGGCCGGANONE 
J080052M10AAATGGGCCGGANONE 
J080053E20AAATGGGCCGGANONE 
J080054J01AAATGGGCCGGANONE 
J080059N09AAATGGGCCGGANONE 
J080064F19AAATGGGCCGGANONE 
J080064N22AAATGGGCCGGANONE 
J080065K14AAATGGGCCGGANONE 
J080065M12AAATGGGCCGGANONE 
J080068O07AAATGGGCCGGANONE 
J080076P20AAATGGGCCGGANONE 
J080087D08AAATGGGCCGGANONE 
J080087H16AAATGGGCCGGANONE 
J080090N23AAATGGGCCGGANONE 
J080091H04AAATGGGCCGGANONE 
J080091P13AAATGGGCCGGANONE 
J080094O15AAATGGGCCGGANONE 
J080094P14AAATGGGCCGGANONE 
J080095I07AAATGGGCCGGANONE 
J080097E22AAATGGGCCGGANONE 
Os08g0558000J080005K14TCCGGCCCAAAAGGCCCAGTANONE 
Os09g0397100J075141L14AACGGGCCGGANONE 
J100063H17AACGGGCCGGAConserved hypothetical protein. 
Os09g0416400J075067A16GTCAGTGGGCCGGAConserved hypothetical protein. 
J075104N21GTCAGTGGGCCGGANONE 
J075106F04GTCAGTGGGCCGGANONE 
J075131F08GTCAGTGGGCCGGANONE 
Os09g0437900AK107833TCCGGCCCAAGSimilar to Adrenodoxin. 
AK107833TCCGGCCCAGCSimilar to Adrenodoxin. 
Os09g0487500AK108131TCCGGCCCATAAConserved hypothetical protein. 
J080062L16TCCGGCCCATAANONE 
Os09g0498100015-046-G11AGTGGGCCGGANONE 
AK064108AGTGGGCCGGASimilar to 30S ribosomal protein S16. 
J065040H21AGTGGGCCGGANONE 
J065062F05AGTGGGCCGGANONE 
J065147B17AGTGGGCCGGANONE 
J075098J22AGTGGGCCGGANONE 
Os09g0510000AK121614TCCGGCCCAACCConserved hypothetical protein. 
J033043O11TCCGGCCCAACCNONE 
J065113F04TCCGGCCCAACCNONE 
J080044D13TCCGGCCCAACCNONE 
Os09g0516800009-017-A01TCCGGCCCACCCConserved hypothetical protein. 
Os09g0517700011-058-H11GGGCCGGANONE 
012-050-D08GGGCCGGANONE 
AK071305GGGCCGGAThioesterase superfamily domain containing protein. 
AK101141GGGCCGGANONE 
J023088I03GGGCCGGANONE 
J033026N19GGGCCGGANONE 
J065060F07GGGCCGGANONE 
J065073B06GGGCCGGANONE 
J065138A05GGGCCGGANONE 
J100047C23GGGCCGGANONE 
J100078F20GGGCCGGANONE 
Os09g0517800012-034-H10TCCGGCCCAACTNONE 
AK121391TCCGGCCCAACTCyclin-like F-box domain containing protein. 
J023129D04TCCGGCCCAACTNONE 
J043012D11TCCGGCCCAACTNONE 
Os09g0547200016-021-H03TCCGGCCCCACCNONE 
AK073078TCCGGCCCCACCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984TCCGGCCCCACCNONE 
J065005L05TCCGGCCCCACCNONE 
J065039C06TCCGGCCCCACCNONE 
J065116H17TCCGGCCCCACCNONE 
J100046A17TCCGGCCCCACCNONE 
Os09g0567000012-071-E09CATGGGCCGGANONE 
013-099-E05CATGGGCCGGANONE 
AK065613CATGGGCCGGAConserved hypothetical protein. 
J013026M04CATGGGCCGGANONE 
J023103F04CATGGGCCGGANONE 
J033119N04CATGGGCCGGANONE 
J065011I19CATGGGCCGGANONE 
J065042A10CATGGGCCGGANONE 
J100023F16CATGGGCCGGANONE 
Os11g0128400AK102291CTTGGGCCGGACDC45-like protein family protein. 
J033089K18CTTGGGCCGGANONE 
Os11g0132700AK103286TTGTGGGCTTCCGGCCCAAATCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0171400AK107165TCCGGCCCNONE 
AK107313TCCGGCCCConserved hypothetical protein. 
J065083M09TCCGGCCCNONE 
J065096I11TCCGGCCCNONE 
J065199P18TCCGGCCCNONE 
J075039I17TCCGGCCCNONE 
J075054E05TCCGGCCCNONE 
J075080H21TCCGGCCCNONE 
J075120G04TCCGGCCCNONE 
J075155C17TCCGGCCCNONE 
Os11g0209100016-063-F03TCCGGCCCGTTNONE 
AK064391TCCGGCCCGTTCyclin-like F-box domain containing protein. 
J075027K02TCCGGCCCGTTNONE 
J075154K15TCCGGCCCGTTNONE 
Os11g0216400Os11g0216400TCCGGCCCAGCCProteinase inhibitor, propeptide domain containing protein. 
Os11g0227600AK101375TAATGGGCTTAGCGTGGGCCGGAConserved hypothetical protein. 
AK102193TAATGGGCTTAGCGTGGGCCGGANONE 
J033087C03TAATGGGCTTAGCGTGGGCCGGANONE 
Os11g0544700AF464904AACGGGCCGGANONE 
AK072844AACGGGCCGGARepressor protein. 
J023143I16AACGGGCCGGANONE 
Os12g0124700AK073156AACTGGGCCGGACDC45-like protein family protein. 
J090013O22AACTGGGCCGGANONE 
Os12g0131300J090086B06TTGTGGGCTTCCGGCCCAAATHypothetical protein. 
Os12g0133600AK103096TCCGGCCCAGCCConserved hypothetical protein. 
J033118M03TCCGGCCCAGCCNONE 
Os12g0145700AK071391TGATGGGCCGGAPyruvate kinase family protein. 
J023013N02TGATGGGCCGGANONE 
J033085D15TGATGGGCCGGANONE 
J043021I09TGATGGGCCGGANONE 
J100055L05TGATGGGCCGGANONE 
Os12g0150100009-047-B11TCCGGCCCATCTNONE 
AK105075TCCGGCCCATCTSimilar to 60S ribosomal protein L26A. 
J013067G22TCCGGCCCATCTNONE 
J033103F08TCCGGCCCATCTNONE 
J065029P11TCCGGCCCATCTNONE 
J065043B18TCCGGCCCATCTNONE 
J065123E16TCCGGCCCATCTNONE 
J065141O20TCCGGCCCATCTNONE 
J065161O04TCCGGCCCATCTNONE 
J065201M07TCCGGCCCATCTNONE 
J075058I23TCCGGCCCATCTNONE 
J075172J08TCCGGCCCATCTNONE 
J100040L13TCCGGCCCATCTNONE 
Os12g0278900AK106816AAGGCCCATGCCCACGATCCGGCCCPeptidase C1A, papain family protein. 
Os12g0440400AK064643TCCGGCCCHypothetical protein. 
Os12g0477600009-115-E02ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-125-D04ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-152-E11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
013-003-H06ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
AK099534ACCGGGCCCACTGGGCCGGAGGCCCAAAAConserved hypothetical protein. 
J065109J18ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J065115L23ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075002K19ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075034D13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075038B07ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075051A21ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075052J11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075072A08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075080E10ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075101E13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075112F22ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075139O17ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075141K08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075146N01ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075171J24ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
Os12g0507600009-155-B05TCCGGCCCACTTGTCGGCCCATGANONE 
AK070613TCCGGCCCACTTGTCGGCCCATGAConserved hypothetical protein. 
J023063G03TCCGGCCCACTTGTCGGCCCATGANONE 
Os12g0540900AK060440TCCGGCCCGTTNONE 
AK102417TCCGGCCCGTTSimilar to Tryptophanyl-tRNA synthetase (EC 6.1.1.2) (Tryptophan--tRNA ligase) (TrpRS). 
D10401TCCGGCCCGTTNONE 
J023088E16TCCGGCCCGTTNONE 
Os12g0592200Os12g0592200TAATGGGCCGGAConserved hypothetical protein. 
Os12g0605900AK109696TCCGGCCCACCTSimilar to Kinase like protein. 
Os12g0621700AK073528TCCGGCCCATCCConserved hypothetical protein. 
J033043M23TCCGGCCCATCCNONE 
J033114G18TCCGGCCCATCCNONE 
J033120E10TCCGGCCCATCCNONE 
J033143J21TCCGGCCCATCCNONE 
J065080M02TCCGGCCCATCCNONE 
J065138O22TCCGGCCCATCCNONE 
J090048B16TCCGGCCCATCCNONE 
Os12g0621900AK072851TCCGGCCCNONE 
AK102645TCCGGCCCNONE 
AK103987TCCGGCCCNONE 
Os12g0622200016-050-H03TCCGGCCCNONE 
AK062307TCCGGCCCConserved hypothetical protein. 
J065034F05TCCGGCCCNONE 
J065154G03TCCGGCCCNONE 
J065164K08TCCGGCCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.