version

Summary of OsREG645 (All List)

OrganismOryza sativa  
IDOsREG645  
SequenceGGGCCGTA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count917  

Entry Sequences (917 entries)

LocusGene modelSequenceDescription
Os01g0101600AK099952TACGGCCCAACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK122118TACGGCCCAACANONE 
J013123J12TACGGCCCAACANONE 
J033026O19TACGGCCCAACANONE 
J033128C08TACGGCCCAACANONE 
J065116M14TACGGCCCAACANONE 
J090058F15TACGGCCCAACANONE 
J090079F20TACGGCCCAACANONE 
Os01g0141600016-051-A03GGGCCGTANONE 
AK066922GGGCCGTAProtein of unknown function DUF647 family protein. 
Os01g0146200J090080H03CGGGCCGTAConserved hypothetical protein. 
Os01g0220200J100075D14TACGGCCCCCAACGGCCNONE 
Os01g0269100011-080-F08GTGTGGGCCGTANONE 
AK067610GTGTGGGCCGTASimilar to Rab proteins geranylgeranyltransferase component A 2 (Rab escort protein 2) (REP-2) (Choroideraemia-like protein). 
J013059P18GTGTGGGCCGTANONE 
J013112F12GTGTGGGCCGTANONE 
J023002M17GTGTGGGCCGTANONE 
J023022J24GTGTGGGCCGTANONE 
J033050A10GTGTGGGCCGTANONE 
J033091A17GTGTGGGCCGTANONE 
J033123E17GTGTGGGCCGTANONE 
J033143H04GTGTGGGCCGTANONE 
J043005H18GTGTGGGCCGTANONE 
J075038A05GTGTGGGCCGTANONE 
J075091K23GTGTGGGCCGTANONE 
J075118O05GTGTGGGCCGTANONE 
J075195P17GTGTGGGCCGTANONE 
J090027J21GTGTGGGCCGTANONE 
J100024I09GTGTGGGCCGTANONE 
J100032D15GTGTGGGCCGTANONE 
J100071I02GTGTGGGCCGTANONE 
J100080E01GTGTGGGCCGTANONE 
J100086A08GTGTGGGCCGTANONE 
Os01g0276500006-030-E04ACGTGGGCCGTANONE 
AK061002ACGTGGGCCGTASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335ACGTGGGCCGTANONE 
Os01g0286000AK109824AACGGGCCGTAAGTGGGCCGAGSnf7 family protein. 
Os01g0299400AK107814GGTTGGGCCAATTTTGGGCCGTASterile alpha motif homology domain containing protein. 
J065112H10GGTTGGGCCAATTTTGGGCCGTANONE 
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE 
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE 
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE 
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE 
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE 
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE 
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE 
Os01g0618500011-019-D03GAGGCCCACTACGGCCCACCTNONE 
AK067476GAGGCCCACTACGGCCCACCTSimilar to RNA helicase (Fragment). 
J013020E19GAGGCCCACTACGGCCCACCTNONE 
J033046J12GAGGCCCACTACGGCCCACCTNONE 
J033055D06GAGGCCCACTACGGCCCACCTNONE 
Os01g0821800015-005-A04TACGGCCCAATTNONE 
AK073951TACGGCCCAATTNONE 
AK103171TACGGCCCAATTNONE 
AK119168TACGGCCCAATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22TACGGCCCAATTNONE 
J033098N09TACGGCCCAATTNONE 
J033121G11TACGGCCCAATTNONE 
J090030L03TACGGCCCAATTNONE 
Os01g0838300J090017B22AATGGGCCGTANONE 
J090061B04AATGGGCCGTANONE 
Os01g0852200AK063954GGGCCGTATGGGCTTTNONE 
Os01g0853600AK107747AACGGGCCGTANONE 
AK108628AACGGGCCGTANONE 
AK120975AACGGGCCGTAConserved hypothetical protein. 
J023041K02AACGGGCCGTANONE 
Os01g0888800AK070163TACGGCCCAAAAConserved hypothetical protein. 
J065181H02TACGGCCCAAAANONE 
Os01g0915800AK103859TACGGCCCAATASimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TACGGCCCAATANONE 
J090056H03TACGGCCCAATANONE 
J090058L14TACGGCCCAATANONE 
J090058P16TACGGCCCAATANONE 
J090076C19TACGGCCCAATANONE 
J100086P14TACGGCCCAATANONE 
Os01g0924000004-020-C09TGATGGGCCGTANONE 
005-014-A06TGATGGGCCGTANONE 
009-085-G12TGATGGGCCGTANONE 
009-123-A08TGATGGGCCGTANONE 
009-134-A05TGATGGGCCGTANONE 
009-137-F06TGATGGGCCGTANONE 
016-016-B08TGATGGGCCGTANONE 
AF050674TGATGGGCCGTANONE 
AK061690TGATGGGCCGTASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797TGATGGGCCGTANONE 
J013040A15TGATGGGCCGTANONE 
J013104L20TGATGGGCCGTANONE 
J013127E12TGATGGGCCGTANONE 
J013158O05TGATGGGCCGTANONE 
J023012E09TGATGGGCCGTANONE 
J023126L23TGATGGGCCGTANONE 
J023143B03TGATGGGCCGTANONE 
J065005B16TGATGGGCCGTANONE 
J065101J15TGATGGGCCGTANONE 
J065105K16TGATGGGCCGTANONE 
J065155K16TGATGGGCCGTANONE 
J065171M17TGATGGGCCGTANONE 
J065182F07TGATGGGCCGTANONE 
J065187D10TGATGGGCCGTANONE 
J065194I24TGATGGGCCGTANONE 
J065207E24TGATGGGCCGTANONE 
J075001C24TGATGGGCCGTANONE 
J075090O10TGATGGGCCGTANONE 
J075095H17TGATGGGCCGTANONE 
J075109M24TGATGGGCCGTANONE 
J075123C18TGATGGGCCGTANONE 
J075148G22TGATGGGCCGTANONE 
J090009B09TGATGGGCCGTANONE 
J090075K17TGATGGGCCGTANONE 
J090081H23TGATGGGCCGTANONE 
J090097H21TGATGGGCCGTANONE 
J100063P14TGATGGGCCGTANONE 
Os01g0934500AK073211CCGTGGGCCGTAConserved hypothetical protein. 
Os01g0939100AK070064GTTTGGGCCGTASimilar to Calmodulin-stimulated calcium-ATPase. 
Os01g0953100AK064981AGTGGGCCGTANONE 
AK068882AGTGGGCCGTAProtein of unknown function DUF594 family protein. 
J013001C07AGTGGGCCGTANONE 
J013169K14AGTGGGCCGTANONE 
J033114G07AGTGGGCCGTANONE 
J065035K15AGTGGGCCGTANONE 
J065082E12AGTGGGCCGTANONE 
Os01g0960300AK100099TCTGGGCCGTASimilar to Glucose inhibited division protein A. 
Os01g0966200009-079-H11TGTTGGGCCGTANONE 
009-124-G10TGTTGGGCCGTANONE 
AK058564TGTTGGGCCGTAProtein of unknown function YGGT family protein. 
AK098935TGTTGGGCCGTANONE 
Os02g0119700AK108777TTGGCCCAAATACGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0129900Os02g0129900TACGGCCCAACTPGAP1-like family protein. 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
Os02g0321800AK067188GGGCTGGGCCGTANONE 
AK070852GGGCTGGGCCGTAB-cell receptor-associated 31-like family protein. 
J013094K24GGGCTGGGCCGTANONE 
Os02g0655300006-024-H05TACGGCCCAAGNONE 
006-032-G04TACGGCCCAAGNONE 
006-045-F03TACGGCCCAAGNONE 
006-076-D04TACGGCCCAAGNONE 
006-086-C09TACGGCCCAAGNONE 
006-104-C07TACGGCCCAAGNONE 
AK061544TACGGCCCAAGNONE 
AK103778TACGGCCCAAGNONE 
AK106107TACGGCCCAAGNONE 
AK120006TACGGCCCAAGNONE 
AY363174TACGGCCCAAGSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21TACGGCCCAAGNONE 
J065021C16TACGGCCCAAGNONE 
J065182F01TACGGCCCAAGNONE 
J075063I18TACGGCCCAAGNONE 
J075151E01TACGGCCCAAGNONE 
J075198K18TACGGCCCAAGNONE 
J090026M06TACGGCCCAAGNONE 
J090081H02TACGGCCCAAGNONE 
J100061E20TACGGCCCAAGNONE 
Os02g0682600AK108470TACGGCCCAATTZinc finger, Tim10/DDP-type family protein. 
J065019B06TACGGCCCAATTNONE 
J065065L01TACGGCCCAATTNONE 
Os02g0717100014-089-G06TACGGCCCGTTNONE 
AK063741TACGGCCCGTTEsterase/lipase/thioesterase domain containing protein. 
J065052A22TACGGCCCGTTNONE 
Os02g0732900AK065796GCAGCCCATTACGGCCCProtein of unknown function DUF794, plant family protein. 
AK104342GCAGCCCATTACGGCCCNONE 
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05TACGGCCCGGCCCAATANONE 
J065054F02TACGGCCCGGCCCAATANONE 
J065124N03TACGGCCCGGCCCAATANONE 
J090001H12TACGGCCCGGCCCAATANONE 
J100057J01TACGGCCCGGCCCAATANONE 
J100062F12TACGGCCCGGCCCAATANONE 
Os02g0754500AK069965TACGGCCCNONE 
AK105696TACGGCCCAmidase family protein. 
Os02g0782200AK070439TACGGCCCAGANONE 
AK101869TACGGCCCAGANOT2/NOT3/NOT5 domain containing protein. 
Os02g0816700009-132-E07TAATGGGCCGTAGGCCCATTTNONE 
AK059572TAATGGGCCGTAGGCCCATTTConserved hypothetical protein. 
Os02g0816800013-089-A09AAATGGGCCTACGGCCCATTANONE 
AK102271AAATGGGCCTACGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
J013105O04AAATGGGCCTACGGCCCATTANONE 
J013124I08AAATGGGCCTACGGCCCATTANONE 
J023002E08AAATGGGCCTACGGCCCATTANONE 
J023025C01AAATGGGCCTACGGCCCATTANONE 
J023037O12AAATGGGCCTACGGCCCATTANONE 
J023049N06AAATGGGCCTACGGCCCATTANONE 
J023069G18AAATGGGCCTACGGCCCATTANONE 
J033029M02AAATGGGCCTACGGCCCATTANONE 
J033037L22AAATGGGCCTACGGCCCATTANONE 
J033089A08AAATGGGCCTACGGCCCATTANONE 
J033103L07AAATGGGCCTACGGCCCATTANONE 
J033125L19AAATGGGCCTACGGCCCATTANONE 
J090008N20AAATGGGCCTACGGCCCATTANONE 
J090041F23AAATGGGCCTACGGCCCATTANONE 
J090092H16AAATGGGCCTACGGCCCATTANONE 
Os02g0828200AK071199TACGGCCCAGANONE 
Os03g0101600006-047-B09TACGGCCCNONE 
006-082-H11TACGGCCCNONE 
AK061143TACGGCCCNONE 
AK069374TACGGCCCSimilar to Quinone oxidoreductase. 
J023012O14TACGGCCCNONE 
Os03g0114300AK121970TACGGCCCProtein kinase-like domain containing protein. 
Os03g0137500006-040-G01GCCGGGCCGTANONE 
015-054-G04GCCGGGCCGTANONE 
AK060148GCCGGGCCGTANONE 
AK073584GCCGGGCCGTANONE 
AK100231GCCGGGCCGTASimilar to VDAC3.1. 
J013146L24GCCGGGCCGTANONE 
J023022O09GCCGGGCCGTANONE 
J023049J19GCCGGGCCGTANONE 
J023133L05GCCGGGCCGTANONE 
J023143P12GCCGGGCCGTANONE 
J033040B12GCCGGGCCGTANONE 
J033050O14GCCGGGCCGTANONE 
J033066G05GCCGGGCCGTANONE 
J065007J18GCCGGGCCGTANONE 
J100067H13GCCGGGCCGTANONE 
Os03g0139000006-059-C06TACGGCCCATCTNONE 
009-055-F07TACGGCCCATCTNONE 
AK060973TACGGCCCATCTConserved hypothetical protein. 
AK103850TACGGCCCATCTNONE 
Os03g0153900015-084-H06GTTTGGGCCGTANONE 
AK106420GTTTGGGCCGTAAromatic-ring hydroxylase family protein. 
Os03g0159700012-100-B09TTTTGGGCCGTANONE 
AK063559TTTTGGGCCGTAProtein prenyltransferase domain containing protein. 
J065197I24TTTTGGGCCGTANONE 
J090089G20TTTTGGGCCGTANONE 
Os03g0181600AK067807TACGGCCCAACTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TACGGCCCAACTNONE 
Os03g0192400009-081-A03TACGGCCCGGTNONE 
009-159-B02TACGGCCCGGTNONE 
AK070573TACGGCCCGGTGRIM-19 family protein. 
J023056B01TACGGCCCGGTNONE 
J023075G06TACGGCCCGGTNONE 
J033048K16TACGGCCCGGTNONE 
J033048L16TACGGCCCGGTNONE 
J053031H23TACGGCCCGGTNONE 
J065002H14TACGGCCCGGTNONE 
J065006G22TACGGCCCGGTNONE 
J065032G13TACGGCCCGGTNONE 
J065056A09TACGGCCCGGTNONE 
J065078I01TACGGCCCGGTNONE 
J065095G01TACGGCCCGGTNONE 
J065095I18TACGGCCCGGTNONE 
J065134M18TACGGCCCGGTNONE 
J065158P07TACGGCCCGGTNONE 
J065165K17TACGGCCCGGTNONE 
J065181J12TACGGCCCGGTNONE 
J065189N09TACGGCCCGGTNONE 
J065200D13TACGGCCCGGTNONE 
J065202H20TACGGCCCGGTNONE 
J065215K20TACGGCCCGGTNONE 
J075049N19TACGGCCCGGTNONE 
J075147J16TACGGCCCGGTNONE 
J090081E19TACGGCCCGGTNONE 
J100017C16TACGGCCCGGTNONE 
J100039M16TACGGCCCGGTNONE 
J100043E23TACGGCCCGGTNONE 
J100063L12TACGGCCCGGTNONE 
J100079F22TACGGCCCGGTNONE 
Os03g0195200AK068949TACGGCCCAPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0250400AK121385CGGGCCGTAPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J023108J02CGGGCCGTANONE 
J023127J05CGGGCCGTANONE 
J023128E15CGGGCCGTANONE 
J075058L21CGGGCCGTANONE 
Os03g0270700AK119531TGTTGGGCCGTANONE 
Os03g0278900006-049-H12TACGGCCCAAATNONE 
006-049-H12TACGGCCCGTTNONE 
006-082-A07TACGGCCCAAATNONE 
006-082-A07TACGGCCCGTTNONE 
009-169-C04TACGGCCCAAATNONE 
009-169-C04TACGGCCCGTTNONE 
AK066019TACGGCCCAAATATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK066019TACGGCCCGTTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TACGGCCCAAATNONE 
AK105925TACGGCCCGTTNONE 
AY224460TACGGCCCAAATNONE 
AY224460TACGGCCCGTTNONE 
J065021K17TACGGCCCAAATNONE 
J065021K17TACGGCCCGTTNONE 
J065141H24TACGGCCCAAATNONE 
J065141H24TACGGCCCGTTNONE 
J065142J20TACGGCCCAAATNONE 
J065142J20TACGGCCCGTTNONE 
J065152J03TACGGCCCAAATNONE 
J065152J03TACGGCCCGTTNONE 
J065163A13TACGGCCCAAATNONE 
J065163A13TACGGCCCGTTNONE 
J065191I21TACGGCCCAAATNONE 
J065191I21TACGGCCCGTTNONE 
J065193K12TACGGCCCAAATNONE 
J065193K12TACGGCCCGTTNONE 
J075003D01TACGGCCCAAATNONE 
J075003D01TACGGCCCGTTNONE 
J075017D24TACGGCCCAAATNONE 
J075017D24TACGGCCCGTTNONE 
J075060F20TACGGCCCAAATNONE 
J075060F20TACGGCCCGTTNONE 
J075154C11TACGGCCCAAATNONE 
J075154C11TACGGCCCGTTNONE 
J075173F04TACGGCCCAAATNONE 
J075173F04TACGGCCCGTTNONE 
Os03g0298800009-079-B10TACGGCCCATCGNONE 
AK103337TACGGCCCATCGSimilar to Spliceosomal protein. 
Os03g0352800009-030-G08ACATGGGCCGTANONE 
AK059673ACATGGGCCGTASimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17ACATGGGCCGTANONE 
J075050N19ACATGGGCCGTANONE 
J075104J18ACATGGGCCGTANONE 
J075142K05ACATGGGCCGTANONE 
J100050I19ACATGGGCCGTANONE 
J100057N04ACATGGGCCGTANONE 
Os03g0647500015-025-E10AGTTGGGCTGGGCCGTANONE 
AK064308AGTTGGGCTGGGCCGTAConserved hypothetical protein. 
AK103649AGTTGGGCTGGGCCGTANONE 
J033135D01AGTTGGGCTGGGCCGTANONE 
Os03g0656900AK066416TACGGCCCATTTNusB/RsmB/TIM44 domain containing protein. 
J065157L23TACGGCCCATTTNONE 
J065166P22TACGGCCCATTTNONE 
Os03g0727100AK068587GTTTGGGCCGTAAGGCCCAACAConserved hypothetical protein. 
J013153F04GTTTGGGCCGTAAGGCCCAACANONE 
J065165J09GTTTGGGCCGTAAGGCCCAACANONE 
Os03g0786600AK109838TACGGCCCAATAProtein of unknown function DUF860, plant family protein. 
Os03g0824400AK070153TACGGCCCACGCTGCGGCCCNONE 
AK104298TACGGCCCACGCTGCGGCCCSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0829000AK071107TTATGGGCCGTAFumarylacetoacetate (FAA) hydrolase family protein. 
AK109501TTATGGGCCGTANONE 
AK121596TTATGGGCCGTANONE 
J065045C17TTATGGGCCGTANONE 
J065068E23TTATGGGCCGTANONE 
J065083N15TTATGGGCCGTANONE 
J065166P10TTATGGGCCGTANONE 
J065189B13TTATGGGCCGTANONE 
J090082J08TTATGGGCCGTANONE 
J100030P13TTATGGGCCGTANONE 
Os03g0843500AK067985TACGGCCCACANONE 
AK101661TACGGCCCACASimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454TACGGCCCACANONE 
J080302L23TACGGCCCACANONE 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0855600006-029-G09TCTGGGCCGTANONE 
006-033-E02TCTGGGCCGTANONE 
006-069-G07TCTGGGCCGTANONE 
006-083-A02TCTGGGCCGTANONE 
006-098-H04TCTGGGCCGTANONE 
009-054-C04TCTGGGCCGTANONE 
AK060030TCTGGGCCGTANONE 
AK061467TCTGGGCCGTAConserved hypothetical protein. 
AK067858TCTGGGCCGTANONE 
AK106030TCTGGGCCGTANONE 
J013123A10TCTGGGCCGTANONE 
J065001I24TCTGGGCCGTANONE 
J065015N21TCTGGGCCGTANONE 
J065016H07TCTGGGCCGTANONE 
J065040A05TCTGGGCCGTANONE 
J065040F01TCTGGGCCGTANONE 
J065066G17TCTGGGCCGTANONE 
J065077I09TCTGGGCCGTANONE 
J065099M22TCTGGGCCGTANONE 
J065135B13TCTGGGCCGTANONE 
J065144H19TCTGGGCCGTANONE 
J065146I03TCTGGGCCGTANONE 
J065169E02TCTGGGCCGTANONE 
J065177D21TCTGGGCCGTANONE 
J065189L20TCTGGGCCGTANONE 
J065207H13TCTGGGCCGTANONE 
J065210D24TCTGGGCCGTANONE 
J065212I03TCTGGGCCGTANONE 
J075007E21TCTGGGCCGTANONE 
J075013H07TCTGGGCCGTANONE 
J075023K06TCTGGGCCGTANONE 
J075031D23TCTGGGCCGTANONE 
J075038K09TCTGGGCCGTANONE 
J075084C08TCTGGGCCGTANONE 
J075098K20TCTGGGCCGTANONE 
J090028E04TCTGGGCCGTANONE 
J090031E20TCTGGGCCGTANONE 
J090042F06TCTGGGCCGTANONE 
J090049L05TCTGGGCCGTANONE 
J090086G03TCTGGGCCGTANONE 
J090096J04TCTGGGCCGTANONE 
J100035O03TCTGGGCCGTANONE 
J100053H24TCTGGGCCGTANONE 
J100056L17TCTGGGCCGTANONE 
J100058K06TCTGGGCCGTANONE 
J100059G09TCTGGGCCGTANONE 
J100081C15TCTGGGCCGTANONE 
Os04g0105500AK068066TACGGCCCAGTANONE 
AK071444TACGGCCCAGTASimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis. 
J013130G18TACGGCCCAGTANONE 
J023093I17TACGGCCCAGTANONE 
J033079J01TACGGCCCAGTANONE 
J043027J02TACGGCCCAGTANONE 
J065135G05TACGGCCCAGTANONE 
Os04g0115400015-048-B05TACGGCCCAATANONE 
AK070523TACGGCCCAATAD111/G-patch domain containing protein. 
Os04g0337500AK061807TACGGCCCCCACACNONE 
Os04g0444900AK063657TACGGCCCAAGSimilar to Alfin-1. 
AK098960TACGGCCCAAGNONE 
J065037L14TACGGCCCAAGNONE 
J065037P22TACGGCCCAAGNONE 
J065173O15TACGGCCCAAGNONE 
Os04g0479300AK106088TACGGCCCAGCCConserved hypothetical protein. 
Os04g0490000AK108365TTGTGGGCCGTASimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0495900AK061559TACGGCCCAAAAConserved hypothetical protein. 
Os04g0528100009-090-G06TACGGCCCACCCNONE 
009-168-C11TACGGCCCACCCNONE 
AK065957TACGGCCCACCCConserved hypothetical protein. 
J013039G20TACGGCCCACCCNONE 
J013044D08TACGGCCCACCCNONE 
J065013L14TACGGCCCACCCNONE 
J065143H08TACGGCCCACCCNONE 
J065146C14TACGGCCCACCCNONE 
J065149K22TACGGCCCACCCNONE 
J065156B18TACGGCCCACCCNONE 
J065201A04TACGGCCCACCCNONE 
J065209A04TACGGCCCACCCNONE 
Os04g0576800AK073542TACGGCCC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
AK104042TACGGCCCNONE 
Os04g0589600011-100-F04ATATGGGCTACTGGGCCGTANONE 
AK061833ATATGGGCTACTGGGCCGTAGlycosyl transferase, group 1 domain containing protein. 
AK098964ATATGGGCTACTGGGCCGTANONE 
AK100053ATATGGGCTACTGGGCCGTANONE 
Os04g0592500AK066893TACGGCCCAAAAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18TACGGCCCAAAANONE 
Os04g0610500006-115-C07TACGGCCCAAATNONE 
AK066289TACGGCCCAAATPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817TACGGCCCAAATNONE 
J013096N09TACGGCCCAAATNONE 
J023054I11TACGGCCCAAATNONE 
J023121P20TACGGCCCAAATNONE 
J053039O20TACGGCCCAAATNONE 
J053071L20TACGGCCCAAATNONE 
J053088H23TACGGCCCAAATNONE 
J053096J03TACGGCCCAAATNONE 
Os04g0649900006-036-D07TACGGCCCACTTGNONE 
013-084-F02TACGGCCCACTTGNONE 
AK061488TACGGCCCACTTGProtein of unknown function DUF579, plant family protein. 
J100036B10TACGGCCCACTTGNONE 
J100058F04TACGGCCCACTTGNONE 
J100065C02TACGGCCCACTTGNONE 
Os04g0658600AK064729TACGGCCCATCANONE 
AK119253TACGGCCCATCANucleolar, Nop52 family protein. 
J075132J07TACGGCCCATCANONE 
J075157N21TACGGCCCATCANONE 
Os04g0670400012-048-A10CGGGCCGTANONE 
012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099CGGGCCGTAOvarian tumour, otubain domain containing protein. 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06CGGGCCGTANONE 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03CGGGCCGTANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TACGGCCCGCysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os05g0110500AK060179TACGGCCCAAATNONE 
AK066175TACGGCCCAAATSimilar to RNA helicase (Fragment). 
J013055E22TACGGCCCAAATNONE 
J090056E03TACGGCCCAAATNONE 
Os05g0150600011-043-D06TACGGCCCAGATNONE 
AK072977TACGGCCCAGATATP-dependent DNA helicase RecQ family protein. 
AY180331TACGGCCCAGATNONE 
J090053A16TACGGCCCAGATNONE 
Os05g0184901Os05g0184901CGCGTGGGCCGTASigma factor, regions 3 and 4 domain containing protein. 
Os05g0413000AK058277TACGGCCCGMitochodrial transcription termination factor-related family protein. 
Os05g0437800015-045-B10TACGGCCCATATNONE 
AK106328TACGGCCCATATConserved hypothetical protein. 
Os05g0440100015-006-F06TACGGCCCACGCNONE 
015-076-D04TACGGCCCACGCNONE 
AK073094TACGGCCCACGCNONE 
AK102786TACGGCCCACGCHistone deacetylase superfamily protein. 
J033107M16TACGGCCCACGCNONE 
Os05g0481600009-067-H08TACGGCCCATTANONE 
009-085-H10TACGGCCCATTANONE 
009-147-F04TACGGCCCATTANONE 
AK063820TACGGCCCATTAConserved hypothetical protein. 
AK121540TACGGCCCATTANONE 
J023027H12TACGGCCCATTANONE 
J033031M01TACGGCCCATTANONE 
J053031M02TACGGCCCATTANONE 
Os05g0490000011-076-C07CTTGGGCCGTANONE 
015-026-D07CTTGGGCCGTANONE 
015-074-A08CTTGGGCCGTANONE 
AK064335CTTGGGCCGTANONE 
AK101340CTTGGGCCGTAKrr1 family protein. 
J033034J18CTTGGGCCGTANONE 
Os05g0520200006-031-F07TACGGCCCACTGGCCCATTANONE 
AK061451TACGGCCCACTGGCCCATTAThioredoxin-related domain containing protein. 
AK099433TACGGCCCACTGGCCCATTANONE 
Os05g0565000AK102673TACGGCCCAACTSimilar to 60S ribosomal protein L18a-1. 
J033102C12TACGGCCCAACTNONE 
J033124C13TACGGCCCAACTNONE 
J043003L04TACGGCCCAACTNONE 
J043006N08TACGGCCCAACTNONE 
Os05g0568600009-024-B09TTATGGGCCGTANONE 
AK063781TTATGGGCCGTAProtein of unknown function DUF1645 family protein. 
J080049H14TTATGGGCCGTANONE 
J080062M08TTATGGGCCGTANONE 
J080064I07TTATGGGCCGTANONE 
J080068A12TTATGGGCCGTANONE 
J080086J10TTATGGGCCGTANONE 
Os06g0147600AK107817TTATGGGCCGTAConserved hypothetical protein. 
Os06g0150600011-051-F03GGCCGGGCCGTANONE 
AK063346GGCCGGGCCGTATransferase family protein. 
Os06g0214300AK108107TACGGCCCAACTEsterase/lipase/thioesterase domain containing protein. 
Os06g0306600006-117-A07ACATGGGCCGTANONE 
AK070763ACATGGGCCGTAEsterase/lipase/thioesterase domain containing protein. 
AK099262ACATGGGCCGTANONE 
AK106075ACATGGGCCGTANONE 
Os06g0498500AK099764TACGGCCCACTNONE 
AK103794TACGGCCCACTNucleolar complex-associated family protein. 
AK121899TACGGCCCACTNONE 
Os06g0547900AK100950TACGGCCCATCASimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665TACGGCCCATCANONE 
J023139I22TACGGCCCATCANONE 
J090066J10TACGGCCCATCANONE 
Y13437TACGGCCCATCANONE 
Os06g0555500016-056-B08AAATGGGCCGTANONE 
AK102375AAATGGGCCGTANONE 
AK106546AAATGGGCCGTAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08AAATGGGCCGTANONE 
J033091P04AAATGGGCCGTANONE 
J090082P16AAATGGGCCGTANONE 
Os06g0560400AK103575TACGGCCCAAANONE 
AK108074TACGGCCCAAAProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0598900AK100386TACGGCCCAGCCCAACASimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05TACGGCCCAGCCCAACANONE 
J090043L20TACGGCCCAGCCCAACANONE 
Os06g0656800AK109762ATCTGGGCCGTABeta-Ig-H3/fasciclin domain containing protein. 
Os06g0670100AK102577TACGGCCCGGTHypothetical protein. 
Os06g0673800AK066054TACGGCCCAAATHypothetical protein. 
Os06g0683200AK060024CTTGGGCCGTASimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432CTTGGGCCGTANONE 
J023002B12CTTGGGCCGTANONE 
J023054E10CTTGGGCCGTANONE 
J023123F19CTTGGGCCGTANONE 
J065035K13CTTGGGCCGTANONE 
J065129P09CTTGGGCCGTANONE 
J065184B14CTTGGGCCGTANONE 
Os07g0158300006-049-G04TACGGCCCATTANONE 
AK099188TACGGCCCATTANONE 
AK104773TACGGCCCATTANONE 
J013106F16TACGGCCCATTANONE 
J013123H22TACGGCCCATTANONE 
J023029J02TACGGCCCATTANONE 
J023029J03TACGGCCCATTANONE 
J033138N08TACGGCCCATTANONE 
J075011F05TACGGCCCATTANONE 
J075022F10TACGGCCCATTANONE 
J075071L13TACGGCCCATTANONE 
J075094B08TACGGCCCATTANONE 
J075119B21TACGGCCCATTANONE 
J075140L02TACGGCCCATTANONE 
J075199O21TACGGCCCATTANONE 
J080001I17TACGGCCCATTANONE 
J080005M04TACGGCCCATTANONE 
J080011P17TACGGCCCATTANONE 
J080026B14TACGGCCCATTANONE 
J080026C12TACGGCCCATTANONE 
J080030N16TACGGCCCATTANONE 
J080035K23TACGGCCCATTANONE 
J080039J22TACGGCCCATTANONE 
J080045D04TACGGCCCATTANONE 
J080050C06TACGGCCCATTANONE 
J080050K14TACGGCCCATTANONE 
J080051I09TACGGCCCATTANONE 
J080053F18TACGGCCCATTANONE 
J080053G10TACGGCCCATTANONE 
J080055F05TACGGCCCATTANONE 
J080057E22TACGGCCCATTANONE 
J080058F17TACGGCCCATTANONE 
J080063C18TACGGCCCATTANONE 
J080065E02TACGGCCCATTANONE 
J080066E06TACGGCCCATTANONE 
J080067O05TACGGCCCATTANONE 
J080068N15TACGGCCCATTANONE 
J080071O04TACGGCCCATTANONE 
J080074A20TACGGCCCATTANONE 
J080074E14TACGGCCCATTANONE 
J080074L05TACGGCCCATTANONE 
J080075E08TACGGCCCATTANONE 
J080075H07TACGGCCCATTANONE 
J080077D04TACGGCCCATTANONE 
J080077N15TACGGCCCATTANONE 
J080078A07TACGGCCCATTANONE 
J080079H22TACGGCCCATTANONE 
J080080F20TACGGCCCATTANONE 
J080080M22TACGGCCCATTANONE 
J080081K09TACGGCCCATTANONE 
J080081L04TACGGCCCATTANONE 
J080090K09TACGGCCCATTANONE 
J080093O13TACGGCCCATTANONE 
J080094A18TACGGCCCATTANONE 
J080094E10TACGGCCCATTANONE 
J080094H06TACGGCCCATTANONE 
J080096I21TACGGCCCATTANONE 
J100081A19TACGGCCCATTANONE 
Os07g0481400AK121542GGGCCGTADisease resistance protein family protein. 
J033031P15GGGCCGTANONE 
Os07g0545400009-136-E03TACGGCCCNONE 
013-015-G08TACGGCCCNONE 
AK059228TACGGCCCNONE 
J065040D09TACGGCCCNONE 
J065051C19TACGGCCCNONE 
J065139B05TACGGCCCNONE 
J065160E20TACGGCCCNONE 
J065207I17TACGGCCCNONE 
J080319M24TACGGCCCNONE 
Os07g0598100AK068136GTATGGGCCTGGGCCGTASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os07g0688100AK101635ATATGGGCCGTAProtein prenyltransferase domain containing protein. 
J033055B02ATATGGGCCGTANONE 
J090013O08ATATGGGCCGTANONE 
J090074A17ATATGGGCCGTANONE 
Os07g0693100AB111050CCGTGGGCCGTANONE 
AK100433CCGTGGGCCGTASimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC). 
J023054O07CCGTGGGCCGTANONE 
J023088C24CCGTGGGCCGTANONE 
J023088I11CCGTGGGCCGTANONE 
Os08g0136700011-099-G08TACGGCCCNONE 
AF090872TACGGCCCNONE 
AF093570TACGGCCCNONE 
AF097724TACGGCCCNONE 
AK073888TACGGCCCProtein of unknown function DUF26 domain containing protein. 
J033034I12TACGGCCCNONE 
J033073I01TACGGCCCNONE 
J033075I11TACGGCCCNONE 
J033113L15TACGGCCCNONE 
J033118C04TACGGCCCNONE 
J053054M19TACGGCCCNONE 
J053065I02TACGGCCCNONE 
J053091F18TACGGCCCNONE 
J065045D10TACGGCCCNONE 
J065057G03TACGGCCCNONE 
Os08g0175200AK072367TACGGCCCAGATProtein of unknown function DUF292, eukaryotic domain containing protein. 
J013149H16TACGGCCCAGATNONE 
J023075K04TACGGCCCAGATNONE 
J023082L15TACGGCCCAGATNONE 
J043015G07TACGGCCCAGATNONE 
J065052L17TACGGCCCAGATNONE 
J065202P07TACGGCCCAGATNONE 
J075061D17TACGGCCCAGATNONE 
J100088P13TACGGCCCAGATNONE 
Os08g0230000014-096-F01CCGTGGGCCGGGCCGTCGGGCCGTANONE 
AK067127CCGTGGGCCGGGCCGTCGGGCCGTAConserved hypothetical protein. 
J013096C05CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J100032D12CCGTGGGCCGGGCCGTCGGGCCGTANONE 
Os08g0412100AK072641TACGGCCCAGCDisease resistance protein family protein. 
Os08g0427900AK103217GGGCTGGGCCGTASimilar to Hin19 (Fragment). 
AK109208GGGCTGGGCCGTANONE 
J080005C08GGGCTGGGCCGTANONE 
J080010B10GGGCTGGGCCGTANONE 
J080013C21GGGCTGGGCCGTANONE 
J080022L12GGGCTGGGCCGTANONE 
J080029C08GGGCTGGGCCGTANONE 
J080029G09GGGCTGGGCCGTANONE 
J080035L14GGGCTGGGCCGTANONE 
J080040M20GGGCTGGGCCGTANONE 
J080043M18GGGCTGGGCCGTANONE 
J080045K15GGGCTGGGCCGTANONE 
J080048I17GGGCTGGGCCGTANONE 
J080051P16GGGCTGGGCCGTANONE 
J080053L16GGGCTGGGCCGTANONE 
J080059P14GGGCTGGGCCGTANONE 
J080063E13GGGCTGGGCCGTANONE 
J080075N18GGGCTGGGCCGTANONE 
J080077E05GGGCTGGGCCGTANONE 
J080080H23GGGCTGGGCCGTANONE 
J080081L16GGGCTGGGCCGTANONE 
J080083F17GGGCTGGGCCGTANONE 
J080085C23GGGCTGGGCCGTANONE 
J080086A12GGGCTGGGCCGTANONE 
J080088N06GGGCTGGGCCGTANONE 
J080092G10GGGCTGGGCCGTANONE 
J080093F04GGGCTGGGCCGTANONE 
J080094C03GGGCTGGGCCGTANONE 
J090032L12GGGCTGGGCCGTANONE 
Os08g0433200013-023-E07TACGGCCCGGCCCAAANONE 
AK099471TACGGCCCGGCCCAAAConserved hypothetical protein. 
J013024A05TACGGCCCGGCCCAAANONE 
J013065N03TACGGCCCGGCCCAAANONE 
J023111A21TACGGCCCGGCCCAAANONE 
J065035F10TACGGCCCGGCCCAAANONE 
J065083H01TACGGCCCGGCCCAAANONE 
J065159E03TACGGCCCGGCCCAAANONE 
J065186A03TACGGCCCGGCCCAAANONE 
J075032B02TACGGCCCGGCCCAAANONE 
J075038L14TACGGCCCGGCCCAAANONE 
J075047N21TACGGCCCGGCCCAAANONE 
J075076H05TACGGCCCGGCCCAAANONE 
J075110C08TACGGCCCGGCCCAAANONE 
J090096K17TACGGCCCGGCCCAAANONE 
Os08g0495300Os08g0495300GTTTGGGCCGTAConserved hypothetical protein. 
Os08g0511000AK107578TGGTGGGCCGTAProtein prenyltransferase domain containing protein. 
Os08g0517900015-019-D06AAAAGCCCATTACGGCCCACACNONE 
AK064304AAAAGCCCATTACGGCCCACACSimilar to 30S ribosomal protein S16. 
Os08g0532300009-122-A05TACGGCCCATAANONE 
009-129-H05TACGGCCCATAANONE 
AB011262TACGGCCCATAANONE 
AK065141TACGGCCCATAANONE 
AK119730TACGGCCCATAASimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14TACGGCCCATAANONE 
J013042K23TACGGCCCATAANONE 
J023057J08TACGGCCCATAANONE 
J023057N10TACGGCCCATAANONE 
J023113C21TACGGCCCATAANONE 
J053054E03TACGGCCCATAANONE 
J053062B07TACGGCCCATAANONE 
J053075O17TACGGCCCATAANONE 
J053075P09TACGGCCCATAANONE 
J065024H05TACGGCCCATAANONE 
J065049F22TACGGCCCATAANONE 
J065063L03TACGGCCCATAANONE 
J065102O07TACGGCCCATAANONE 
J065104M12TACGGCCCATAANONE 
J065119E04TACGGCCCATAANONE 
J065153E10TACGGCCCATAANONE 
J065168M24TACGGCCCATAANONE 
J065173I10TACGGCCCATAANONE 
J065181L04TACGGCCCATAANONE 
J065184I18TACGGCCCATAANONE 
J065203M15TACGGCCCATAANONE 
J075004C21TACGGCCCATAANONE 
J075047B11TACGGCCCATAANONE 
J075055F18TACGGCCCATAANONE 
J075065G09TACGGCCCATAANONE 
J075094O14TACGGCCCATAANONE 
J075143C22TACGGCCCATAANONE 
J075153K18TACGGCCCATAANONE 
J075164N10TACGGCCCATAANONE 
J075197C11TACGGCCCATAANONE 
J080001A01TACGGCCCATAANONE 
J080003B11TACGGCCCATAANONE 
J080006G17TACGGCCCATAANONE 
J080007J06TACGGCCCATAANONE 
J080010H12TACGGCCCATAANONE 
J080014I01TACGGCCCATAANONE 
J080015C16TACGGCCCATAANONE 
J080016P19TACGGCCCATAANONE 
J080020G24TACGGCCCATAANONE 
J080021E12TACGGCCCATAANONE 
J080023I11TACGGCCCATAANONE 
J080024H24TACGGCCCATAANONE 
J080025G18TACGGCCCATAANONE 
J080028H08TACGGCCCATAANONE 
J080030G08TACGGCCCATAANONE 
J080031H20TACGGCCCATAANONE 
J080034C20TACGGCCCATAANONE 
J080040H13TACGGCCCATAANONE 
J080044M04TACGGCCCATAANONE 
J080047D02TACGGCCCATAANONE 
J080049D17TACGGCCCATAANONE 
J080049J17TACGGCCCATAANONE 
J080050A05TACGGCCCATAANONE 
J080051C11TACGGCCCATAANONE 
J080051K06TACGGCCCATAANONE 
J080053A07TACGGCCCATAANONE 
J080053I08TACGGCCCATAANONE 
J080056L12TACGGCCCATAANONE 
J080061I19TACGGCCCATAANONE 
J080075G09TACGGCCCATAANONE 
J080078C23TACGGCCCATAANONE 
J080080I21TACGGCCCATAANONE 
J080084F04TACGGCCCATAANONE 
J080085K16TACGGCCCATAANONE 
J080097A12TACGGCCCATAANONE 
J080097N01TACGGCCCATAANONE 
J090027L10TACGGCCCATAANONE 
J100034N17TACGGCCCATAANONE 
Os08g0532400AK101608TTATGGGCCGTASimilar to AT.I.24-7 protein. 
Os08g0540500AK106511TACGGCCCAAACSAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0554000AK111661AGATGGGCCGGGCCGTAWD-40 repeat containing protein. 
AK112044AGATGGGCCGGGCCGTANONE 
J013039N12AGATGGGCCGGGCCGTANONE 
J013134D02AGATGGGCCGGGCCGTANONE 
J013153B06AGATGGGCCGGGCCGTANONE 
J033044L16AGATGGGCCGGGCCGTANONE 
J033073P14AGATGGGCCGGGCCGTANONE 
Os09g0324300AK109691TACGGCCCATATCyclin-like F-box domain containing protein. 
Os09g0395400AK109221TAGGCCCATAAGGATGGGCCGTAConserved hypothetical protein. 
J075009I06TAGGCCCATAAGGATGGGCCGTANONE 
Os09g0416400J075067A16TACGGCCCATAAConserved hypothetical protein. 
J075104N21TACGGCCCATAANONE 
J075106F04TACGGCCCATAANONE 
J075131F08TACGGCCCATAANONE 
Os09g0432300J080031G07TACGGCCCGConserved hypothetical protein. 
Os09g0458100AK109625TTATGGGCCGTAXyloglucan fucosyltransferase family protein. 
Os09g0525500AK107918TACGGCCCATCTYY1 protein precursor. 
D50575TACGGCCCATCTNONE 
Os09g0540600AK101798ATATGGGCTTTACGGCCCATAAAAGCCCATTANONE 
AK103397ATATGGGCTTTACGGCCCATAAAAGCCCATTASimilar to WD-40 repeat protein MSI1. 
Os09g0547300AK102669TACGGCCCNONE 
Os09g0565200004-007-A08TACGGCCCAGATNONE 
006-045-E10TACGGCCCAGATNONE 
006-051-A01TACGGCCCAGATNONE 
006-079-G03TACGGCCCAGATNONE 
006-097-C05TACGGCCCAGATNONE 
006-097-E11TACGGCCCAGATNONE 
006-111-E07TACGGCCCAGATNONE 
AK069121TACGGCCCAGATSimilar to Nucleic acid-binding protein precursor. 
AK104354TACGGCCCAGATNONE 
J013090J23TACGGCCCAGATNONE 
J013093C19TACGGCCCAGATNONE 
J023007A14TACGGCCCAGATNONE 
J023099J21TACGGCCCAGATNONE 
J065023L09TACGGCCCAGATNONE 
J075060J06TACGGCCCAGATNONE 
J075092C03TACGGCCCAGATNONE 
Os11g0119200016-068-E03TGGTGGGCCGTANONE 
AK103124TGGTGGGCCGTAZinc finger, RING-type domain containing protein. 
J033119L05TGGTGGGCCGTANONE 
J065036I18TGGTGGGCCGTANONE 
J065160A20TGGTGGGCCGTANONE 
J065183G16TGGTGGGCCGTANONE 
J065205L01TGGTGGGCCGTANONE 
J065211I07TGGTGGGCCGTANONE 
J065219B08TGGTGGGCCGTANONE 
Os11g0130500J065119D16ATATGGGCCGTANONE 
J065169E14ATATGGGCCGTACyclin-like F-box domain containing protein. 
Os11g0130600AK066342TACGGCCCATATConserved hypothetical protein. 
J065192M10TACGGCCCATATNONE 
Os11g0595200009-005-A06TACGGCCCAGANONE 
AK071115TACGGCCCAGANONE 
AK106159TACGGCCCAGAPAP fibrillin family protein. 
AY387683TACGGCCCAGANONE 
AY387684TACGGCCCAGANONE 
J065166K17TACGGCCCAGANONE 
Os12g0106900006-093-E08CTGGGGCCGTANONE 
AK099547CTGGGGCCGTANONE 
Os12g0127500AK064595TACGGCCCATATConserved hypothetical protein. 
J065067F11TACGGCCCATATNONE 
J090007D02TACGGCCCATATNONE 
J100035G10TACGGCCCATATNONE 
J100077J10TACGGCCCATATNONE 
Os12g0167900005-004-A06ATTTGGGCCGTANONE 
006-024-H01ATTTGGGCCGTANONE 
006-044-H12ATTTGGGCCGTANONE 
006-053-B08ATTTGGGCCGTANONE 
015-080-F12ATTTGGGCCGTANONE 
AK060925ATTTGGGCCGTA60S ribosomal protein L3. 
D10403ATTTGGGCCGTANONE 
D12630ATTTGGGCCGTANONE 
J013046A17ATTTGGGCCGTANONE 
J013048A16ATTTGGGCCGTANONE 
J013057L14ATTTGGGCCGTANONE 
J023058G08ATTTGGGCCGTANONE 
J023058I08ATTTGGGCCGTANONE 
J023078E17ATTTGGGCCGTANONE 
J023087E03ATTTGGGCCGTANONE 
J023097D18ATTTGGGCCGTANONE 
J023141E14ATTTGGGCCGTANONE 
J023150P21ATTTGGGCCGTANONE 
J033045K05ATTTGGGCCGTANONE 
J033071G03ATTTGGGCCGTANONE 
J033071I15ATTTGGGCCGTANONE 
J033136D08ATTTGGGCCGTANONE 
J043012M21ATTTGGGCCGTANONE 
J043015C13ATTTGGGCCGTANONE 
J053031L19ATTTGGGCCGTANONE 
J053050C01ATTTGGGCCGTANONE 
J053055I20ATTTGGGCCGTANONE 
J053074B18ATTTGGGCCGTANONE 
J053091I08ATTTGGGCCGTANONE 
J053097N01ATTTGGGCCGTANONE 
J065058A02ATTTGGGCCGTANONE 
J065141H11ATTTGGGCCGTANONE 
J075019D10ATTTGGGCCGTANONE 
J075078G18ATTTGGGCCGTANONE 
J075094C12ATTTGGGCCGTANONE 
J075165H12ATTTGGGCCGTANONE 
J090011E05ATTTGGGCCGTANONE 
J090021H18ATTTGGGCCGTANONE 
J090027N07ATTTGGGCCGTANONE 
J090035F04ATTTGGGCCGTANONE 
J090050F21ATTTGGGCCGTANONE 
J090051M02ATTTGGGCCGTANONE 
J090060F21ATTTGGGCCGTANONE 
J090075G15ATTTGGGCCGTANONE 
J090092P11ATTTGGGCCGTANONE 
J090097B18ATTTGGGCCGTANONE 
J100019C17ATTTGGGCCGTANONE 
J100022O04ATTTGGGCCGTANONE 
J100034G13ATTTGGGCCGTANONE 
J100048A13ATTTGGGCCGTANONE 
J100050P18ATTTGGGCCGTANONE 
J100054B21ATTTGGGCCGTANONE 
J100062L01ATTTGGGCCGTANONE 
J100065E11ATTTGGGCCGTANONE 
J100074P09ATTTGGGCCGTANONE 
J100086E10ATTTGGGCCGTANONE 
Os12g0610100Os12g0610100TACGGCCCAATAConserved hypothetical protein. 
Os12g0633200009-073-D03TGTGGGGCCGTANONE 
AK062615TGTGGGGCCGTAErg28-like family protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.