version

Summary of OsREG646 (All List)

OrganismOryza sativa  
IDOsREG646  
SequenceGGGCCTGA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1122  

Entry Sequences (1122 entries)

LocusGene modelSequenceDescription
Os01g0179500AK105394TCAGGCCCConserved hypothetical protein. 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
Os01g0215700011-079-A08TCAGGCCCNONE 
013-033-E05TCAGGCCCNONE 
013-052-D07TCAGGCCCNONE 
014-010-D04TCAGGCCCNONE 
014-044-G08TCAGGCCCNONE 
AK059088TCAGGCCCLipolytic enzyme, G-D-S-L family protein. 
AK061118TCAGGCCCNONE 
AK119598TCAGGCCCNONE 
AK119642TCAGGCCCNONE 
Os01g0276500006-030-E04GGCTGGGCCTGANONE 
AK061002GGCTGGGCCTGASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335GGCTGGGCCTGANONE 
Os01g0327600AK120216ATTTGGGCCTGANONE 
AK121799ATTTGGGCCTGAConserved hypothetical protein. 
J065081I07ATTTGGGCCTGANONE 
J065082D04ATTTGGGCCTGANONE 
J065082G10ATTTGGGCCTGANONE 
J065085G24ATTTGGGCCTGANONE 
J065105J24ATTTGGGCCTGANONE 
J065128D18ATTTGGGCCTGANONE 
J065155D13ATTTGGGCCTGANONE 
J065200C11ATTTGGGCCTGANONE 
Os01g0337900AK120645GGGCCTGASimilar to Dihydrolipoamide dehydrogenase. 
Os01g0560200AK102003TCAGGCCCAGGSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06TCAGGCCCAGGNONE 
J065092F14TCAGGCCCAGGNONE 
J065106D04TCAGGCCCAGGNONE 
J065194K23TCAGGCCCAGGNONE 
Os01g0571000AK066090GGGCCTGAMitochondrial substrate carrier family protein. 
AK121334GGGCCTGANONE 
Os01g0709000Os01g0709000TCAGGCCCAGCSimilar to Transcription factor MYB1. 
Os01g0764300J090053G03TCAGGCCCACCProtein of unknown function DUF155 family protein. 
Os01g0810000AK102143ATATGGGCCGTCAGGCCCAATTNONE 
AK120752ATATGGGCCGTCAGGCCCAATTUtp11 family protein. 
J023006E09ATATGGGCCGTCAGGCCCAATTNONE 
J033086A13ATATGGGCCGTCAGGCCCAATTNONE 
J033133K07ATATGGGCCGTCAGGCCCAATTNONE 
J065066L16ATATGGGCCGTCAGGCCCAATTNONE 
J065161C01ATATGGGCCGTCAGGCCCAATTNONE 
J100027D18ATATGGGCCGTCAGGCCCAATTNONE 
J100063J12ATATGGGCCGTCAGGCCCAATTNONE 
Os01g0836400AK073540TCAGGCCCGTTSAC3/GANP family protein. 
J023019D11TCAGGCCCGTTNONE 
J023139O22TCAGGCCCGTTNONE 
J033042J20TCAGGCCCGTTNONE 
J033046M18TCAGGCCCGTTNONE 
J033124J09TCAGGCCCGTTNONE 
J090015E05TCAGGCCCGTTNONE 
J090076J09TCAGGCCCGTTNONE 
Os01g0853800006-033-H02TCAGGCCCAATTNONE 
006-037-A10TCAGGCCCAATTNONE 
006-038-F10TCAGGCCCAATTNONE 
006-054-E01TCAGGCCCAATTNONE 
006-067-E10TCAGGCCCAATTNONE 
012-015-G05TCAGGCCCAATTNONE 
AK069147TCAGGCCCAATTC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK105929TCAGGCCCAATTNONE 
AK106144TCAGGCCCAATTNONE 
AK106186TCAGGCCCAATTNONE 
J023007P09TCAGGCCCAATTNONE 
J023007P10TCAGGCCCAATTNONE 
J065084L10TCAGGCCCAATTNONE 
J065179B10TCAGGCCCAATTNONE 
J065186D16TCAGGCCCAATTNONE 
J075040I08TCAGGCCCAATTNONE 
J075043K21TCAGGCCCAATTNONE 
J075051J08TCAGGCCCAATTNONE 
J075061D24TCAGGCCCAATTNONE 
J075095H04TCAGGCCCAATTNONE 
J075145J12TCAGGCCCAATTNONE 
J075148O18TCAGGCCCAATTNONE 
J075187J05TCAGGCCCAATTNONE 
J090042A20TCAGGCCCAATTNONE 
J100025K01TCAGGCCCAATTNONE 
Os01g0881100AK109822TCAGGCCCEpsin, N-terminal domain containing protein. 
Os01g0915800AK103859TCAGGCCCSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TCAGGCCCNONE 
J090056H03TCAGGCCCNONE 
J090058L14TCAGGCCCNONE 
J090058P16TCAGGCCCNONE 
J090076C19TCAGGCCCNONE 
J100086P14TCAGGCCCNONE 
Os01g0920200AK120182TCAGGCCCAGTASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
J013034A14TCAGGCCCAGTANONE 
J013063O14TCAGGCCCAGTANONE 
J023023D20TCAGGCCCAGTANONE 
J075121J02TCAGGCCCAGTANONE 
Os01g0951800AK069239TCAGGCCCAGCCCProtein prenyltransferase domain containing protein. 
Os01g0959900AK058375GCTGGGCCTGAConserved hypothetical protein. 
AK058375TCAGGCCCAGTConserved hypothetical protein. 
AK066497GCTGGGCCTGANONE 
AK066497TCAGGCCCAGTNONE 
Os01g0960800AK073977TAATGGGCCTGAProtein Transporter, Pam16 family protein. 
AY313247TAATGGGCCTGANONE 
J033075P16TAATGGGCCTGANONE 
J065051H06TAATGGGCCTGANONE 
J065167L02TAATGGGCCTGANONE 
J090083C22TAATGGGCCTGANONE 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os02g0188500AK102004TCAGGCCCATATNONE 
AK106917TCAGGCCCATATUbiquitin domain containing protein. 
J090039N13TCAGGCCCATATNONE 
Os02g0208200J023104K09AGATGGGCCTGANONE 
J033080L20AGATGGGCCTGANONE 
J033105D08AGATGGGCCTGANONE 
J090079N16AGATGGGCCTGANONE 
Os02g0252100AF139211TATTGGGCCTGANONE 
AK062577TATTGGGCCTGASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TATTGGGCCTGANONE 
J013156E01TATTGGGCCTGANONE 
J065001D02TATTGGGCCTGANONE 
J065042A05TATTGGGCCTGANONE 
J065116H01TATTGGGCCTGANONE 
J065167P13TATTGGGCCTGANONE 
J065168N07TATTGGGCCTGANONE 
J075093G21TATTGGGCCTGANONE 
J075109H15TATTGGGCCTGANONE 
J075194P17TATTGGGCCTGANONE 
Os02g0266500AK100307TCAGGCCCATTSimilar to RASPBERRY3. 
Os02g0656500011-045-C08TCAGGCCCACTNONE 
011-045-E06TCAGGCCCACTNONE 
016-046-A01TCAGGCCCACTNONE 
016-046-B01TCAGGCCCACTNONE 
AK062239TCAGGCCCACTNONE 
AK066420TCAGGCCCACTDnaJ-like protein. 
J013067J21TCAGGCCCACTNONE 
J065047L09TCAGGCCCACTNONE 
J065104M20TCAGGCCCACTNONE 
J065134B04TCAGGCCCACTNONE 
J065152C10TCAGGCCCACTNONE 
J065161O03TCAGGCCCACTNONE 
J065169F18TCAGGCCCACTNONE 
J065210M21TCAGGCCCACTNONE 
J065217B03TCAGGCCCACTNONE 
J065218C10TCAGGCCCACTNONE 
J075041F09TCAGGCCCACTNONE 
J075048A02TCAGGCCCACTNONE 
J075083F21TCAGGCCCACTNONE 
J080005F10TCAGGCCCACTNONE 
J080013P21TCAGGCCCACTNONE 
J080027J09TCAGGCCCACTNONE 
J080037O17TCAGGCCCACTNONE 
J080039F02TCAGGCCCACTNONE 
J080039G01TCAGGCCCACTNONE 
J080041I09TCAGGCCCACTNONE 
J080043M01TCAGGCCCACTNONE 
J080060H17TCAGGCCCACTNONE 
J080062O07TCAGGCCCACTNONE 
J080079F05TCAGGCCCACTNONE 
J080093H04TCAGGCCCACTNONE 
J080096B15TCAGGCCCACTNONE 
J080097H24TCAGGCCCACTNONE 
J090032O11TCAGGCCCACTNONE 
J090044F01TCAGGCCCACTNONE 
J090045E04TCAGGCCCACTNONE 
J090048O03TCAGGCCCACTNONE 
J090049E04TCAGGCCCACTNONE 
J090070E19TCAGGCCCACTNONE 
J090079E13TCAGGCCCACTNONE 
J090089L14TCAGGCCCACTNONE 
J090095K13TCAGGCCCACTNONE 
J090096I19TCAGGCCCACTNONE 
J090098B04TCAGGCCCACTNONE 
J100027P13TCAGGCCCACTNONE 
J100048H06TCAGGCCCACTNONE 
J100060J15TCAGGCCCACTNONE 
J100070K16TCAGGCCCACTNONE 
J100074O22TCAGGCCCACTNONE 
Os02g0693700AK103774GGGCCTGASimilar to P-glycoprotein ABCB5. 
AK106518GGGCCTGANONE 
Os02g0697200015-013-B10TGATGGGCCTGATGGGCCTTNONE 
AK059475TGATGGGCCTGATGGGCCTTNONE 
AK102993TGATGGGCCTGATGGGCCTTConserved hypothetical protein. 
J033079I18TGATGGGCCTGATGGGCCTTNONE 
J033082A14TGATGGGCCTGATGGGCCTTNONE 
J065047H08TGATGGGCCTGATGGGCCTTNONE 
J065131M14TGATGGGCCTGATGGGCCTTNONE 
Os02g0780500AK072784GGGCCTGANONE 
AK121143GGGCCTGAConserved hypothetical protein. 
J023075M13GGGCCTGANONE 
J023077P14GGGCCTGANONE 
J023123C16GGGCCTGANONE 
J023142P06GGGCCTGANONE 
Os02g0832200AK108268TCAGGCCCATCGConserved hypothetical protein. 
J065053F07TCAGGCCCATCGNONE 
J065095B09TCAGGCCCATCGNONE 
J065137I11TCAGGCCCATCGNONE 
J065187O12TCAGGCCCATCGNONE 
J075193O05TCAGGCCCATCGNONE 
Os03g0117100005-014-F09TCAGGCCCATATNONE 
006-027-C07TCAGGCCCATATNONE 
006-036-G11TCAGGCCCATATNONE 
006-038-H10TCAGGCCCATATNONE 
006-044-D08TCAGGCCCATATNONE 
006-105-H12TCAGGCCCATATNONE 
009-190-G08TCAGGCCCATATNONE 
AK070213TCAGGCCCATATPeroxisomal biogenesis factor 11 family protein. 
AK104570TCAGGCCCATATNONE 
AK104706TCAGGCCCATATNONE 
J013055H24TCAGGCCCATATNONE 
J023044I05TCAGGCCCATATNONE 
J075111G05TCAGGCCCATATNONE 
J080002K23TCAGGCCCATATNONE 
J080002N12TCAGGCCCATATNONE 
J080004B01TCAGGCCCATATNONE 
J080007H19TCAGGCCCATATNONE 
J080008M18TCAGGCCCATATNONE 
J080011D18TCAGGCCCATATNONE 
J080012J01TCAGGCCCATATNONE 
J080018C19TCAGGCCCATATNONE 
J080022C20TCAGGCCCATATNONE 
J080022I05TCAGGCCCATATNONE 
J080022M12TCAGGCCCATATNONE 
J080023P03TCAGGCCCATATNONE 
J080025A05TCAGGCCCATATNONE 
J080029C02TCAGGCCCATATNONE 
J080036H08TCAGGCCCATATNONE 
J080039P12TCAGGCCCATATNONE 
J080040H05TCAGGCCCATATNONE 
J080045I23TCAGGCCCATATNONE 
J080057O04TCAGGCCCATATNONE 
J080059K18TCAGGCCCATATNONE 
J080061E04TCAGGCCCATATNONE 
J080062C20TCAGGCCCATATNONE 
J080062F10TCAGGCCCATATNONE 
J080062L05TCAGGCCCATATNONE 
J080068L06TCAGGCCCATATNONE 
J080069N09TCAGGCCCATATNONE 
J080071M14TCAGGCCCATATNONE 
J080072K17TCAGGCCCATATNONE 
J080080A09TCAGGCCCATATNONE 
J080086A18TCAGGCCCATATNONE 
J080088O14TCAGGCCCATATNONE 
J080089O04TCAGGCCCATATNONE 
J080092G21TCAGGCCCATATNONE 
J080094K09TCAGGCCCATATNONE 
Os03g0126300AK061256TCAGGCCCAATTATGGCCCATAANONE 
AK061961TCAGGCCCAATTATGGCCCATAANONE 
AY346336TCAGGCCCAATTATGGCCCATAASAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17TCAGGCCCAATTATGGCCCATAANONE 
J090023H12TCAGGCCCAATTATGGCCCATAANONE 
Os03g0128500AB037900TTATGGGCCTGANONE 
AK067991TTATGGGCCTGASimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
J013124O04TTATGGGCCTGANONE 
J090032P09TTATGGGCCTGANONE 
Os03g0186600AJ293816GGGCCTGANONE 
AJ536158GGGCCTGATranscription factor, MADS-box domain containing protein. 
AY345221GGGCCTGANONE 
AY345222GGGCCTGANONE 
J065219F15GGGCCTGANONE 
J075018A17GGGCCTGANONE 
J075043O06GGGCCTGANONE 
J075104G17GGGCCTGANONE 
J075110O09GGGCCTGANONE 
J075171B08GGGCCTGANONE 
J075171C16GGGCCTGANONE 
J100053A08GGGCCTGANONE 
Os03g0193225012-084-B12TCAGGCCCACGTNONE 
AK069459TCAGGCCCACGTFrigida-like family protein. 
J023019D20TCAGGCCCACGTNONE 
Os03g0383100AK107106TCAGGCCCATAConserved hypothetical protein. 
Os03g0754200AK065954GGGCCTGACGCGACNONE 
AK067890GGGCCTGACGCGACNONE 
AK103031GGGCCTGACGCGACSimilar to Triosephosphate isomerase, cytosolic (EC 5.3.1.1) (TIM) (Triose- phosphate isomerase). 
J090023B20GGGCCTGACGCGACNONE 
J090058C20GGGCCTGACGCGACNONE 
Os03g0785200003-116-B06TTGTGGGCCTGANONE 
J013098I23TTGTGGGCCTGANONE 
J023002I24TTGTGGGCCTGAMitochodrial transcription termination factor-related family protein. 
J075150G04TTGTGGGCCTGANONE 
Os03g0807800AK064984TGATGGGCCTGASimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TGATGGGCCTGANONE 
J065015J20TGATGGGCCTGANONE 
J065122L11TGATGGGCCTGANONE 
J065217E10TGATGGGCCTGANONE 
J075023C02TGATGGGCCTGANONE 
J075102O04TGATGGGCCTGANONE 
J080024G24TGATGGGCCTGANONE 
J080033F02TGATGGGCCTGANONE 
J080047M13TGATGGGCCTGANONE 
J080048A22TGATGGGCCTGANONE 
J080056E06TGATGGGCCTGANONE 
J080064O11TGATGGGCCTGANONE 
Os03g0819900006-058-B05TAATGGGCCTGAATGGGCCGGGCCNONE 
AK111912TAATGGGCCTGAATGGGCCGGGCCNONE 
AK112029TAATGGGCCTGAATGGGCCGGGCCSimilar to RAB8C. 
AY576526TAATGGGCCTGAATGGGCCGGGCCNONE 
AY579410TAATGGGCCTGAATGGGCCGGGCCNONE 
J075041G24TAATGGGCCTGAATGGGCCGGGCCNONE 
J100070N08TAATGGGCCTGAATGGGCCGGGCCNONE 
Os04g0194000AK102654TCAGGCCCATTCyclin-like F-box domain containing protein. 
J033101G08TCAGGCCCATTNONE 
J090084B18TCAGGCCCATTNONE 
Os04g0430100009-125-A01AACTGGGCCTGAAAAGCCCAGCCCNONE 
AK102190AACTGGGCCTGAAAAGCCCAGCCCSimilar to 40S ribosomal protein S10-1. 
J033087A06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J053032M06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065033D05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045D15AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045K10AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065049N05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065064N09AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065068F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065088F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065104N22AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065117B19AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065119O12AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065134G24AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065150G16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065176C03AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065212M23AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075009P18AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075019G06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075037H14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075057C13AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075100E14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075120I16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075130F07AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075156M16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J100043J03AACTGGGCCTGAAAAGCCCAGCCCNONE 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0436800015-053-A06ACGTGGGCCTGANONE 
AK101115ACGTGGGCCTGAProtein prenyltransferase domain containing protein. 
J033025G14ACGTGGGCCTGANONE 
J033073N23ACGTGGGCCTGANONE 
J033097L19ACGTGGGCCTGANONE 
Os04g0476600014-086-A01TTTGGGCCTGANONE 
015-073-B12TTTGGGCCTGANONE 
AK105466TTTGGGCCTGAC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os04g0486400AJ535489TGATGGGCCTGANONE 
AK103296TGATGGGCCTGARML1 protein. 
J013045L03TGATGGGCCTGANONE 
J013045M03TGATGGGCCTGANONE 
J033034L24TGATGGGCCTGANONE 
J033125B02TGATGGGCCTGANONE 
J075001G08TGATGGGCCTGANONE 
J075011I16TGATGGGCCTGANONE 
J075033M08TGATGGGCCTGANONE 
J075044G01TGATGGGCCTGANONE 
J075047D04TGATGGGCCTGANONE 
J075061J09TGATGGGCCTGANONE 
J075085L07TGATGGGCCTGANONE 
J075087D20TGATGGGCCTGANONE 
J075117A04TGATGGGCCTGANONE 
J075134H06TGATGGGCCTGANONE 
J075184J12TGATGGGCCTGANONE 
Os04g0497600AK059415TCAGGCCCACALupus La protein family protein. 
AK099054TCAGGCCCACANONE 
J013121K15TCAGGCCCACANONE 
J013149O10TCAGGCCCACANONE 
J023112H08TCAGGCCCACANONE 
J033050F07TCAGGCCCACANONE 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0525000AK067753TCAGGCCCAGCCCATCTConserved hypothetical protein. 
J013118G14TCAGGCCCAGCCCATCTNONE 
J065026J15TCAGGCCCAGCCCATCTNONE 
J065184H21TCAGGCCCAGCCCATCTNONE 
J065186H22TCAGGCCCAGCCCATCTNONE 
J065193D20TCAGGCCCAGCCCATCTNONE 
J075060D12TCAGGCCCAGCCCATCTNONE 
J075179L24TCAGGCCCAGCCCATCTNONE 
Os04g0585200AK073062GGGCCTGANONE 
Os04g0594500015-024-B07TCAGGCCCAGCNONE 
AK106269TCAGGCCCAGCProtein of unknown function DUF674 family protein. 
Os04g0650500AK066690AATGGGCTGGGCCTGAConserved hypothetical protein. 
AK104273AATGGGCTGGGCCTGANONE 
Os04g0670600AK064255TCAGGCCCACGAANONE 
Os05g0121500006-117-B10TCAGGCCCATCCANONE 
009-059-D04TCAGGCCCATCCANONE 
J065066C12TCAGGCCCATCCAConserved hypothetical protein. 
J075013I12TCAGGCCCATCCANONE 
J090046D18TCAGGCCCATCCANONE 
Os05g0128100009-051-B07CCTGGGCCTGANONE 
009-127-B08CCTGGGCCTGANONE 
009-144-H03CCTGGGCCTGANONE 
009-176-B05CCTGGGCCTGANONE 
AK108556CCTGGGCCTGANONE 
AK119308CCTGGGCCTGANONE 
AK120934CCTGGGCCTGAConserved hypothetical protein. 
J023036J15CCTGGGCCTGANONE 
J065122L01CCTGGGCCTGANONE 
J075104P10CCTGGGCCTGANONE 
Os05g0148300009-031-A08AGATGGGCCTGANONE 
AK062421AGATGGGCCTGARibosomal protein S27, mitochondrial family protein. 
Os05g0243200009-073-F12TCAGGCCCACTCCNONE 
AK061317TCAGGCCCACTCCSimilar to Ribosomal protein L13. 
J065120F21TCAGGCCCACTCCNONE 
J065185K05TCAGGCCCACTCCNONE 
Os05g0443300Os05g0443300AAATGGGCCTGASec23/Sec24 trunk region domain containing protein. 
Os05g0443800AK106590TCAGGCCCATATSimilar to Plastid division protein ftsZ1 precursor. 
Os05g0484000AK106829TCAGGCCCAAGProtein of unknown function DUF295 family protein. 
Os05g0506000AF031609CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK062012CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK098900CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK122090CCGTCGGATCAGGCCCCGCGTCGCSimilar to MS5-like protein (Fragment). 
J013002B13CCGTCGGATCAGGCCCCGCGTCGCNONE 
J023149G13CCGTCGGATCAGGCCCCGCGTCGCNONE 
J033123O20CCGTCGGATCAGGCCCCGCGTCGCNONE 
J080315O17CCGTCGGATCAGGCCCCGCGTCGCNONE 
Os05g0508700009-197-C10GGGCCTGANONE 
AK105718GGGCCTGANONE 
Os05g0539300Os05g0539300TCAGGCCCProtein of unknown function DUF295 family protein. 
Os05g0541500AK101190TCAGGCCCATCTCyclin-like F-box domain containing protein. 
AK101531TCAGGCCCATCTNONE 
J033030F10TCAGGCCCATCTNONE 
Os05g0553700006-100-D08TCAGGCCCATATNONE 
AK099747TCAGGCCCATATNONE 
AK101606TCAGGCCCATATNONE 
AK103396TCAGGCCCATATSimilar to Syntaxin 71 (AtSYP71). 
J033022M23TCAGGCCCATATNONE 
J090086G01TCAGGCCCATATNONE 
Os05g0558000015-029-G05TAATGGGCCTGACTGGGCCTGANONE 
AK073857TAATGGGCCTGACTGGGCCTGARibosomal protein L1 family protein. 
J033074P11TAATGGGCCTGACTGGGCCTGANONE 
J090060I16TAATGGGCCTGACTGGGCCTGANONE 
Os05g0596600AK107823TCAGGCCCATTANONE 
AK121149TCAGGCCCATTASimilar to SMC5 protein. 
Os06g0119300AK067271CCTGGGCCTGAProtein of unknown function DUF594 family protein. 
Os06g0128500AK058563ATTTGGGCCTGARibosomal protein L47, mitochondrial family protein. 
AK122132ATTTGGGCCTGANONE 
J033133F04ATTTGGGCCTGANONE 
J065094M24ATTTGGGCCTGANONE 
J065122J07ATTTGGGCCTGANONE 
J065137G10ATTTGGGCCTGANONE 
J065178L09ATTTGGGCCTGANONE 
J080011E11ATTTGGGCCTGANONE 
J080020G21ATTTGGGCCTGANONE 
J080039H03ATTTGGGCCTGANONE 
J080039J04ATTTGGGCCTGANONE 
Os06g0251000J033111L12TCAGGCCCNONE 
J033111L12TCAGGCCCATAANONE 
J043001C08TCAGGCCCMolybdenum cofactor biosynthesis domain containing protein. 
J043001C08TCAGGCCCATAAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0292400J065040E24TATTGGGCCTGAConserved hypothetical protein. 
Os06g0515400AK071571TTGTGGGCCTGAConserved hypothetical protein. 
Os06g0531600AK120456TGGTGGGCCTGANONE 
J013105I19TGGTGGGCCTGANONE 
J090006G02TGGTGGGCCTGANONE 
Os06g0560400AK103575TCAGGCCCAGGGCCCAGGNONE 
AK108074TCAGGCCCAGGGCCCAGGProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0574200Os06g0574200GGGCCTGAUspA domain containing protein. 
Os06g0639000AK102470TGGGCCTGATGGGCTNONE 
J013106M02TGGGCCTGATGGGCTNONE 
J100051K23TGGGCCTGATGGGCTNONE 
Os06g0649500AK072591AGTTGGGCCTGAWD40-like domain containing protein. 
Os06g0682800011-092-E01ACATGGGCCTGANONE 
AK064816ACATGGGCCTGAZinc finger, CCCH-type domain containing protein. 
J013000E13ACATGGGCCTGANONE 
J013035J22ACATGGGCCTGANONE 
J013045M06ACATGGGCCTGANONE 
J013120A07ACATGGGCCTGANONE 
J033144H15ACATGGGCCTGANONE 
J033145H15ACATGGGCCTGANONE 
J033145N16ACATGGGCCTGANONE 
J090019J02ACATGGGCCTGANONE 
Os06g0704900AK103054TATTGGGCCTGASimilar to Cell division-like protein. 
J033117I21TATTGGGCCTGANONE 
Os06g0725400J065086O07TCAGGCCCATTASimilar to BLE1 protein. 
J065114J19TCAGGCCCATTANONE 
Os06g0731800012-049-D10TCAGGCCCNONE 
AK069288TCAGGCCCClathrin light chain family protein. 
J023014P04TCAGGCCCNONE 
J023058N12TCAGGCCCNONE 
J053035L13TCAGGCCCNONE 
J065097L21TCAGGCCCNONE 
J065099F07TCAGGCCCNONE 
J065144L02TCAGGCCCNONE 
J065161J11TCAGGCCCNONE 
J065181N05TCAGGCCCNONE 
J075087D09TCAGGCCCNONE 
J075088H19TCAGGCCCNONE 
J075116E21TCAGGCCCNONE 
J075147K03TCAGGCCCNONE 
J090083H22TCAGGCCCNONE 
J100079M09TCAGGCCCNONE 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0164500J013094M18TCAGGCCCATGGGCTNONE 
J013153L05TCAGGCCCATGGGCTNONE 
J023011J18TCAGGCCCATGGGCTNONE 
J023106H21TCAGGCCCATGGGCTNONE 
J033105F10TCAGGCCCATGGGCTNONE 
J065210M20TCAGGCCCATGGGCTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05TCAGGCCCATGGGCTNONE 
J090061C13TCAGGCCCATGGGCTNONE 
J090074K15TCAGGCCCATGGGCTNONE 
Os07g0516200AK061373GGCCCGTTCAGGCCCGGCCCACGCSimilar to Endoribonuclease, L-PSP family. 
Os07g0558200AK065243TCAGGCCCAAGInositol monophosphatase family protein. 
Os07g0680300009-195-E06TCAGGCCCATANONE 
AK063800TCAGGCCCATASimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCAGGCCCATANONE 
J075066A20TCAGGCCCATANONE 
J075088I17TCAGGCCCATANONE 
J075147M19TCAGGCCCATANONE 
J075153L02TCAGGCCCATANONE 
J080013A21TCAGGCCCATANONE 
J080051B13TCAGGCCCATANONE 
J080077I24TCAGGCCCATANONE 
J080302B14TCAGGCCCATANONE 
J080309D22TCAGGCCCATANONE 
J100083B16TCAGGCCCATANONE 
Os08g0117400006-086-A09TGATGGGCCTGANONE 
006-103-C02TGATGGGCCTGANONE 
AK059891TGATGGGCCTGASimilar to Calmodulin 1 (Fragment). 
AK103863TGATGGGCCTGANONE 
AY224521TGATGGGCCTGANONE 
J033149E23TGATGGGCCTGANONE 
J065062E05TGATGGGCCTGANONE 
J065083O05TGATGGGCCTGANONE 
J065116D14TGATGGGCCTGANONE 
J065158F16TGATGGGCCTGANONE 
J065179N16TGATGGGCCTGANONE 
J065206N23TGATGGGCCTGANONE 
Os08g0130500006-024-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-032-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-047-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-058-H06CCAAGCCCATCAGGCCCACCAACNONE 
006-062-D07CCAAGCCCATCAGGCCCACCAACNONE 
006-083-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-084-A11CCAAGCCCATCAGGCCCACCAACNONE 
006-096-F12CCAAGCCCATCAGGCCCACCAACNONE 
006-105-A04CCAAGCCCATCAGGCCCACCAACNONE 
006-110-D11CCAAGCCCATCAGGCCCACCAACNONE 
011-022-D11CCAAGCCCATCAGGCCCACCAACNONE 
AK064857CCAAGCCCATCAGGCCCACCAAC60S acidic ribosomal protein P0. 
D21130CCAAGCCCATCAGGCCCACCAACNONE 
J013000H12CCAAGCCCATCAGGCCCACCAACNONE 
J013024M17CCAAGCCCATCAGGCCCACCAACNONE 
J013028H09CCAAGCCCATCAGGCCCACCAACNONE 
J013045N22CCAAGCCCATCAGGCCCACCAACNONE 
J013092K19CCAAGCCCATCAGGCCCACCAACNONE 
J013106L12CCAAGCCCATCAGGCCCACCAACNONE 
J013107A03CCAAGCCCATCAGGCCCACCAACNONE 
J013109E12CCAAGCCCATCAGGCCCACCAACNONE 
J013114N08CCAAGCCCATCAGGCCCACCAACNONE 
J013120J12CCAAGCCCATCAGGCCCACCAACNONE 
J013121E21CCAAGCCCATCAGGCCCACCAACNONE 
J013135P20CCAAGCCCATCAGGCCCACCAACNONE 
J023006J08CCAAGCCCATCAGGCCCACCAACNONE 
J023014L16CCAAGCCCATCAGGCCCACCAACNONE 
J023020N03CCAAGCCCATCAGGCCCACCAACNONE 
J023027M24CCAAGCCCATCAGGCCCACCAACNONE 
J023029D18CCAAGCCCATCAGGCCCACCAACNONE 
J023030A14CCAAGCCCATCAGGCCCACCAACNONE 
J023041G23CCAAGCCCATCAGGCCCACCAACNONE 
J023049H05CCAAGCCCATCAGGCCCACCAACNONE 
J023060I23CCAAGCCCATCAGGCCCACCAACNONE 
J023099D07CCAAGCCCATCAGGCCCACCAACNONE 
J023104A20CCAAGCCCATCAGGCCCACCAACNONE 
J023105F18CCAAGCCCATCAGGCCCACCAACNONE 
J023112D21CCAAGCCCATCAGGCCCACCAACNONE 
J023122M18CCAAGCCCATCAGGCCCACCAACNONE 
J023139J20CCAAGCCCATCAGGCCCACCAACNONE 
J023149L20CCAAGCCCATCAGGCCCACCAACNONE 
J023150G04CCAAGCCCATCAGGCCCACCAACNONE 
J033036G02CCAAGCCCATCAGGCCCACCAACNONE 
J033045P13CCAAGCCCATCAGGCCCACCAACNONE 
J033046A22CCAAGCCCATCAGGCCCACCAACNONE 
J033086H16CCAAGCCCATCAGGCCCACCAACNONE 
J033087D07CCAAGCCCATCAGGCCCACCAACNONE 
J033089M14CCAAGCCCATCAGGCCCACCAACNONE 
J033095F14CCAAGCCCATCAGGCCCACCAACNONE 
J033108M01CCAAGCCCATCAGGCCCACCAACNONE 
J033117A17CCAAGCCCATCAGGCCCACCAACNONE 
J033122F03CCAAGCCCATCAGGCCCACCAACNONE 
J033126A04CCAAGCCCATCAGGCCCACCAACNONE 
J033144D13CCAAGCCCATCAGGCCCACCAACNONE 
J033145D13CCAAGCCCATCAGGCCCACCAACNONE 
J043022M09CCAAGCCCATCAGGCCCACCAACNONE 
J053025I11CCAAGCCCATCAGGCCCACCAACNONE 
J053027K06CCAAGCCCATCAGGCCCACCAACNONE 
J053029D15CCAAGCCCATCAGGCCCACCAACNONE 
J053048I22CCAAGCCCATCAGGCCCACCAACNONE 
J053055I01CCAAGCCCATCAGGCCCACCAACNONE 
J053079P07CCAAGCCCATCAGGCCCACCAACNONE 
J053090J23CCAAGCCCATCAGGCCCACCAACNONE 
J053094C24CCAAGCCCATCAGGCCCACCAACNONE 
J065023F18CCAAGCCCATCAGGCCCACCAACNONE 
J065029I12CCAAGCCCATCAGGCCCACCAACNONE 
J065044B18CCAAGCCCATCAGGCCCACCAACNONE 
J065045C07CCAAGCCCATCAGGCCCACCAACNONE 
J065063K22CCAAGCCCATCAGGCCCACCAACNONE 
J065093D11CCAAGCCCATCAGGCCCACCAACNONE 
J065096P09CCAAGCCCATCAGGCCCACCAACNONE 
J065099N04CCAAGCCCATCAGGCCCACCAACNONE 
J065103K24CCAAGCCCATCAGGCCCACCAACNONE 
J065110H12CCAAGCCCATCAGGCCCACCAACNONE 
J065132F24CCAAGCCCATCAGGCCCACCAACNONE 
J065157K16CCAAGCCCATCAGGCCCACCAACNONE 
J065185D11CCAAGCCCATCAGGCCCACCAACNONE 
J065202E16CCAAGCCCATCAGGCCCACCAACNONE 
J065217D07CCAAGCCCATCAGGCCCACCAACNONE 
J075053I19CCAAGCCCATCAGGCCCACCAACNONE 
J075055L24CCAAGCCCATCAGGCCCACCAACNONE 
J075056H24CCAAGCCCATCAGGCCCACCAACNONE 
J075070D02CCAAGCCCATCAGGCCCACCAACNONE 
J075084O15CCAAGCCCATCAGGCCCACCAACNONE 
J075090F24CCAAGCCCATCAGGCCCACCAACNONE 
J075135E03CCAAGCCCATCAGGCCCACCAACNONE 
J075174A01CCAAGCCCATCAGGCCCACCAACNONE 
J075188F05CCAAGCCCATCAGGCCCACCAACNONE 
J075192C17CCAAGCCCATCAGGCCCACCAACNONE 
J080001B02CCAAGCCCATCAGGCCCACCAACNONE 
J080001C08CCAAGCCCATCAGGCCCACCAACNONE 
J080002D15CCAAGCCCATCAGGCCCACCAACNONE 
J080002I03CCAAGCCCATCAGGCCCACCAACNONE 
J080003E24CCAAGCCCATCAGGCCCACCAACNONE 
J080004M10CCAAGCCCATCAGGCCCACCAACNONE 
J080005C18CCAAGCCCATCAGGCCCACCAACNONE 
J080006A12CCAAGCCCATCAGGCCCACCAACNONE 
J080006F04CCAAGCCCATCAGGCCCACCAACNONE 
J080006M11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J22CCAAGCCCATCAGGCCCACCAACNONE 
J080009F14CCAAGCCCATCAGGCCCACCAACNONE 
J080010B12CCAAGCCCATCAGGCCCACCAACNONE 
J080010G14CCAAGCCCATCAGGCCCACCAACNONE 
J080010N07CCAAGCCCATCAGGCCCACCAACNONE 
J080011D04CCAAGCCCATCAGGCCCACCAACNONE 
J080011G10CCAAGCCCATCAGGCCCACCAACNONE 
J080011O19CCAAGCCCATCAGGCCCACCAACNONE 
J080013K23CCAAGCCCATCAGGCCCACCAACNONE 
J080013M09CCAAGCCCATCAGGCCCACCAACNONE 
J080013N12CCAAGCCCATCAGGCCCACCAACNONE 
J080013O15CCAAGCCCATCAGGCCCACCAACNONE 
J080014C13CCAAGCCCATCAGGCCCACCAACNONE 
J080014D21CCAAGCCCATCAGGCCCACCAACNONE 
J080014F08CCAAGCCCATCAGGCCCACCAACNONE 
J080014N08CCAAGCCCATCAGGCCCACCAACNONE 
J080014P19CCAAGCCCATCAGGCCCACCAACNONE 
J080015L09CCAAGCCCATCAGGCCCACCAACNONE 
J080015P15CCAAGCCCATCAGGCCCACCAACNONE 
J080018P10CCAAGCCCATCAGGCCCACCAACNONE 
J080020C06CCAAGCCCATCAGGCCCACCAACNONE 
J080022C14CCAAGCCCATCAGGCCCACCAACNONE 
J080022E01CCAAGCCCATCAGGCCCACCAACNONE 
J080022P04CCAAGCCCATCAGGCCCACCAACNONE 
J080022P10CCAAGCCCATCAGGCCCACCAACNONE 
J080023B20CCAAGCCCATCAGGCCCACCAACNONE 
J080023G19CCAAGCCCATCAGGCCCACCAACNONE 
J080024N15CCAAGCCCATCAGGCCCACCAACNONE 
J080025E11CCAAGCCCATCAGGCCCACCAACNONE 
J080025G24CCAAGCCCATCAGGCCCACCAACNONE 
J080026B01CCAAGCCCATCAGGCCCACCAACNONE 
J080026B05CCAAGCCCATCAGGCCCACCAACNONE 
J080027L17CCAAGCCCATCAGGCCCACCAACNONE 
J080028K02CCAAGCCCATCAGGCCCACCAACNONE 
J080029L23CCAAGCCCATCAGGCCCACCAACNONE 
J080030D08CCAAGCCCATCAGGCCCACCAACNONE 
J080031C03CCAAGCCCATCAGGCCCACCAACNONE 
J080031K02CCAAGCCCATCAGGCCCACCAACNONE 
J080032C16CCAAGCCCATCAGGCCCACCAACNONE 
J080033F10CCAAGCCCATCAGGCCCACCAACNONE 
J080033G12CCAAGCCCATCAGGCCCACCAACNONE 
J080033K03CCAAGCCCATCAGGCCCACCAACNONE 
J080034B03CCAAGCCCATCAGGCCCACCAACNONE 
J080034N21CCAAGCCCATCAGGCCCACCAACNONE 
J080034O03CCAAGCCCATCAGGCCCACCAACNONE 
J080035G10CCAAGCCCATCAGGCCCACCAACNONE 
J080038E14CCAAGCCCATCAGGCCCACCAACNONE 
J080039A19CCAAGCCCATCAGGCCCACCAACNONE 
J080039G10CCAAGCCCATCAGGCCCACCAACNONE 
J080039J01CCAAGCCCATCAGGCCCACCAACNONE 
J080039J09CCAAGCCCATCAGGCCCACCAACNONE 
J080040F07CCAAGCCCATCAGGCCCACCAACNONE 
J080040H18CCAAGCCCATCAGGCCCACCAACNONE 
J080041E08CCAAGCCCATCAGGCCCACCAACNONE 
J080041E16CCAAGCCCATCAGGCCCACCAACNONE 
J080041L08CCAAGCCCATCAGGCCCACCAACNONE 
J080042A07CCAAGCCCATCAGGCCCACCAACNONE 
J080044E02CCAAGCCCATCAGGCCCACCAACNONE 
J080045K03CCAAGCCCATCAGGCCCACCAACNONE 
J080046O03CCAAGCCCATCAGGCCCACCAACNONE 
J080047F08CCAAGCCCATCAGGCCCACCAACNONE 
J080048H01CCAAGCCCATCAGGCCCACCAACNONE 
J080048I05CCAAGCCCATCAGGCCCACCAACNONE 
J080048N06CCAAGCCCATCAGGCCCACCAACNONE 
J080050A07CCAAGCCCATCAGGCCCACCAACNONE 
J080050B04CCAAGCCCATCAGGCCCACCAACNONE 
J080050E21CCAAGCCCATCAGGCCCACCAACNONE 
J080051J01CCAAGCCCATCAGGCCCACCAACNONE 
J080051K02CCAAGCCCATCAGGCCCACCAACNONE 
J080051L02CCAAGCCCATCAGGCCCACCAACNONE 
J080052C20CCAAGCCCATCAGGCCCACCAACNONE 
J080052I22CCAAGCCCATCAGGCCCACCAACNONE 
J080052J21CCAAGCCCATCAGGCCCACCAACNONE 
J080052K22CCAAGCCCATCAGGCCCACCAACNONE 
J080055A05CCAAGCCCATCAGGCCCACCAACNONE 
J080055I12CCAAGCCCATCAGGCCCACCAACNONE 
J080056A21CCAAGCCCATCAGGCCCACCAACNONE 
J080056N11CCAAGCCCATCAGGCCCACCAACNONE 
J080057D02CCAAGCCCATCAGGCCCACCAACNONE 
J080058H21CCAAGCCCATCAGGCCCACCAACNONE 
J080058P16CCAAGCCCATCAGGCCCACCAACNONE 
J080059M03CCAAGCCCATCAGGCCCACCAACNONE 
J080059N17CCAAGCCCATCAGGCCCACCAACNONE 
J080060F13CCAAGCCCATCAGGCCCACCAACNONE 
J080060H06CCAAGCCCATCAGGCCCACCAACNONE 
J080060J03CCAAGCCCATCAGGCCCACCAACNONE 
J080060O09CCAAGCCCATCAGGCCCACCAACNONE 
J080060P22CCAAGCCCATCAGGCCCACCAACNONE 
J080061F06CCAAGCCCATCAGGCCCACCAACNONE 
J080061H21CCAAGCCCATCAGGCCCACCAACNONE 
J080061O13CCAAGCCCATCAGGCCCACCAACNONE 
J080062J07CCAAGCCCATCAGGCCCACCAACNONE 
J080063A08CCAAGCCCATCAGGCCCACCAACNONE 
J080063F19CCAAGCCCATCAGGCCCACCAACNONE 
J080063O18CCAAGCCCATCAGGCCCACCAACNONE 
J080065D15CCAAGCCCATCAGGCCCACCAACNONE 
J080066E13CCAAGCCCATCAGGCCCACCAACNONE 
J080068L01CCAAGCCCATCAGGCCCACCAACNONE 
J080068P07CCAAGCCCATCAGGCCCACCAACNONE 
J080069I21CCAAGCCCATCAGGCCCACCAACNONE 
J080070M04CCAAGCCCATCAGGCCCACCAACNONE 
J080071E01CCAAGCCCATCAGGCCCACCAACNONE 
J080071J08CCAAGCCCATCAGGCCCACCAACNONE 
J080071M23CCAAGCCCATCAGGCCCACCAACNONE 
J080072A03CCAAGCCCATCAGGCCCACCAACNONE 
J080072G18CCAAGCCCATCAGGCCCACCAACNONE 
J080075A04CCAAGCCCATCAGGCCCACCAACNONE 
J080075E19CCAAGCCCATCAGGCCCACCAACNONE 
J080075P18CCAAGCCCATCAGGCCCACCAACNONE 
J080076N11CCAAGCCCATCAGGCCCACCAACNONE 
J080077A11CCAAGCCCATCAGGCCCACCAACNONE 
J080077D22CCAAGCCCATCAGGCCCACCAACNONE 
J080077H18CCAAGCCCATCAGGCCCACCAACNONE 
J080077L03CCAAGCCCATCAGGCCCACCAACNONE 
J080078D02CCAAGCCCATCAGGCCCACCAACNONE 
J080078L05CCAAGCCCATCAGGCCCACCAACNONE 
J080078N20CCAAGCCCATCAGGCCCACCAACNONE 
J080079I20CCAAGCCCATCAGGCCCACCAACNONE 
J080081D04CCAAGCCCATCAGGCCCACCAACNONE 
J080082A07CCAAGCCCATCAGGCCCACCAACNONE 
J080082E24CCAAGCCCATCAGGCCCACCAACNONE 
J080084A22CCAAGCCCATCAGGCCCACCAACNONE 
J080084E15CCAAGCCCATCAGGCCCACCAACNONE 
J080084G06CCAAGCCCATCAGGCCCACCAACNONE 
J080086A05CCAAGCCCATCAGGCCCACCAACNONE 
J080086F09CCAAGCCCATCAGGCCCACCAACNONE 
J080087B11CCAAGCCCATCAGGCCCACCAACNONE 
J080087H12CCAAGCCCATCAGGCCCACCAACNONE 
J080088I05CCAAGCCCATCAGGCCCACCAACNONE 
J080088N08CCAAGCCCATCAGGCCCACCAACNONE 
J080088P07CCAAGCCCATCAGGCCCACCAACNONE 
J080089A09CCAAGCCCATCAGGCCCACCAACNONE 
J080089D21CCAAGCCCATCAGGCCCACCAACNONE 
J080089F24CCAAGCCCATCAGGCCCACCAACNONE 
J080089H22CCAAGCCCATCAGGCCCACCAACNONE 
J080089I04CCAAGCCCATCAGGCCCACCAACNONE 
J080090D01CCAAGCCCATCAGGCCCACCAACNONE 
J080091F09CCAAGCCCATCAGGCCCACCAACNONE 
J080091G18CCAAGCCCATCAGGCCCACCAACNONE 
J080091L24CCAAGCCCATCAGGCCCACCAACNONE 
J080091M12CCAAGCCCATCAGGCCCACCAACNONE 
J080091N12CCAAGCCCATCAGGCCCACCAACNONE 
J080093A15CCAAGCCCATCAGGCCCACCAACNONE 
J080093C08CCAAGCCCATCAGGCCCACCAACNONE 
J080093I08CCAAGCCCATCAGGCCCACCAACNONE 
J080093P21CCAAGCCCATCAGGCCCACCAACNONE 
J080094E18CCAAGCCCATCAGGCCCACCAACNONE 
J080094F15CCAAGCCCATCAGGCCCACCAACNONE 
J080094J21CCAAGCCCATCAGGCCCACCAACNONE 
J080095A09CCAAGCCCATCAGGCCCACCAACNONE 
J080096G05CCAAGCCCATCAGGCCCACCAACNONE 
J080096K07CCAAGCCCATCAGGCCCACCAACNONE 
J080097M17CCAAGCCCATCAGGCCCACCAACNONE 
J080097P21CCAAGCCCATCAGGCCCACCAACNONE 
J080302B15CCAAGCCCATCAGGCCCACCAACNONE 
J080306J15CCAAGCCCATCAGGCCCACCAACNONE 
J080306O13CCAAGCCCATCAGGCCCACCAACNONE 
J080307C15CCAAGCCCATCAGGCCCACCAACNONE 
J080307I04CCAAGCCCATCAGGCCCACCAACNONE 
J080307L05CCAAGCCCATCAGGCCCACCAACNONE 
J080308F11CCAAGCCCATCAGGCCCACCAACNONE 
J080311C04CCAAGCCCATCAGGCCCACCAACNONE 
J080311I07CCAAGCCCATCAGGCCCACCAACNONE 
J080312C01CCAAGCCCATCAGGCCCACCAACNONE 
J080312O08CCAAGCCCATCAGGCCCACCAACNONE 
J080315F14CCAAGCCCATCAGGCCCACCAACNONE 
J080318K13CCAAGCCCATCAGGCCCACCAACNONE 
J080319A17CCAAGCCCATCAGGCCCACCAACNONE 
J090001I01CCAAGCCCATCAGGCCCACCAACNONE 
J090002O18CCAAGCCCATCAGGCCCACCAACNONE 
J090007A08CCAAGCCCATCAGGCCCACCAACNONE 
J090007F22CCAAGCCCATCAGGCCCACCAACNONE 
J090008D09CCAAGCCCATCAGGCCCACCAACNONE 
J090008L07CCAAGCCCATCAGGCCCACCAACNONE 
J090008O08CCAAGCCCATCAGGCCCACCAACNONE 
J090012N11CCAAGCCCATCAGGCCCACCAACNONE 
J090013M05CCAAGCCCATCAGGCCCACCAACNONE 
J090020E08CCAAGCCCATCAGGCCCACCAACNONE 
J090020O20CCAAGCCCATCAGGCCCACCAACNONE 
J090021I10CCAAGCCCATCAGGCCCACCAACNONE 
J090023D07CCAAGCCCATCAGGCCCACCAACNONE 
J090023K22CCAAGCCCATCAGGCCCACCAACNONE 
J090023O08CCAAGCCCATCAGGCCCACCAACNONE 
J090028D21CCAAGCCCATCAGGCCCACCAACNONE 
J090029H14CCAAGCCCATCAGGCCCACCAACNONE 
J090029L12CCAAGCCCATCAGGCCCACCAACNONE 
J090030C05CCAAGCCCATCAGGCCCACCAACNONE 
J090031D18CCAAGCCCATCAGGCCCACCAACNONE 
J090032G10CCAAGCCCATCAGGCCCACCAACNONE 
J090034J22CCAAGCCCATCAGGCCCACCAACNONE 
J090034K16CCAAGCCCATCAGGCCCACCAACNONE 
J090036D10CCAAGCCCATCAGGCCCACCAACNONE 
J090037N17CCAAGCCCATCAGGCCCACCAACNONE 
J090043P17CCAAGCCCATCAGGCCCACCAACNONE 
J090044L20CCAAGCCCATCAGGCCCACCAACNONE 
J090045N16CCAAGCCCATCAGGCCCACCAACNONE 
J090048K03CCAAGCCCATCAGGCCCACCAACNONE 
J090048K10CCAAGCCCATCAGGCCCACCAACNONE 
J090049O07CCAAGCCCATCAGGCCCACCAACNONE 
J090055H23CCAAGCCCATCAGGCCCACCAACNONE 
J090056G12CCAAGCCCATCAGGCCCACCAACNONE 
J090056G16CCAAGCCCATCAGGCCCACCAACNONE 
J090059B16CCAAGCCCATCAGGCCCACCAACNONE 
J090066H21CCAAGCCCATCAGGCCCACCAACNONE 
J090067D22CCAAGCCCATCAGGCCCACCAACNONE 
J090072M07CCAAGCCCATCAGGCCCACCAACNONE 
J090073J21CCAAGCCCATCAGGCCCACCAACNONE 
J090075A15CCAAGCCCATCAGGCCCACCAACNONE 
J090079J09CCAAGCCCATCAGGCCCACCAACNONE 
J090080L07CCAAGCCCATCAGGCCCACCAACNONE 
J090084A03CCAAGCCCATCAGGCCCACCAACNONE 
J090085B07CCAAGCCCATCAGGCCCACCAACNONE 
J090088H11CCAAGCCCATCAGGCCCACCAACNONE 
J090090J12CCAAGCCCATCAGGCCCACCAACNONE 
J090091I21CCAAGCCCATCAGGCCCACCAACNONE 
J090091L02CCAAGCCCATCAGGCCCACCAACNONE 
J090093G18CCAAGCCCATCAGGCCCACCAACNONE 
J090094D23CCAAGCCCATCAGGCCCACCAACNONE 
J090098L19CCAAGCCCATCAGGCCCACCAACNONE 
J100017I22CCAAGCCCATCAGGCCCACCAACNONE 
J100018F08CCAAGCCCATCAGGCCCACCAACNONE 
J100018G19CCAAGCCCATCAGGCCCACCAACNONE 
J100019B05CCAAGCCCATCAGGCCCACCAACNONE 
J100019J18CCAAGCCCATCAGGCCCACCAACNONE 
J100019L04CCAAGCCCATCAGGCCCACCAACNONE 
J100023M06CCAAGCCCATCAGGCCCACCAACNONE 
J100024J23CCAAGCCCATCAGGCCCACCAACNONE 
J100024P09CCAAGCCCATCAGGCCCACCAACNONE 
J100027I05CCAAGCCCATCAGGCCCACCAACNONE 
J100029G03CCAAGCCCATCAGGCCCACCAACNONE 
J100029K08CCAAGCCCATCAGGCCCACCAACNONE 
J100031J17CCAAGCCCATCAGGCCCACCAACNONE 
J100037L16CCAAGCCCATCAGGCCCACCAACNONE 
J100038C05CCAAGCCCATCAGGCCCACCAACNONE 
J100039D19CCAAGCCCATCAGGCCCACCAACNONE 
J100041L02CCAAGCCCATCAGGCCCACCAACNONE 
J100045B08CCAAGCCCATCAGGCCCACCAACNONE 
J100045B15CCAAGCCCATCAGGCCCACCAACNONE 
J100047G07CCAAGCCCATCAGGCCCACCAACNONE 
J100047P19CCAAGCCCATCAGGCCCACCAACNONE 
J100048I15CCAAGCCCATCAGGCCCACCAACNONE 
J100049M16CCAAGCCCATCAGGCCCACCAACNONE 
J100049P18CCAAGCCCATCAGGCCCACCAACNONE 
J100050E21CCAAGCCCATCAGGCCCACCAACNONE 
J100051N02CCAAGCCCATCAGGCCCACCAACNONE 
J100052M02CCAAGCCCATCAGGCCCACCAACNONE 
J100055M24CCAAGCCCATCAGGCCCACCAACNONE 
J100056K11CCAAGCCCATCAGGCCCACCAACNONE 
J100059F20CCAAGCCCATCAGGCCCACCAACNONE 
J100059J15CCAAGCCCATCAGGCCCACCAACNONE 
J100068C19CCAAGCCCATCAGGCCCACCAACNONE 
J100068G06CCAAGCCCATCAGGCCCACCAACNONE 
J100069N02CCAAGCCCATCAGGCCCACCAACNONE 
J100073N04CCAAGCCCATCAGGCCCACCAACNONE 
J100074B05CCAAGCCCATCAGGCCCACCAACNONE 
J100080P13CCAAGCCCATCAGGCCCACCAACNONE 
J100083P09CCAAGCCCATCAGGCCCACCAACNONE 
J100084B11CCAAGCCCATCAGGCCCACCAACNONE 
J100085B07CCAAGCCCATCAGGCCCACCAACNONE 
J100086O20CCAAGCCCATCAGGCCCACCAACNONE 
J100087B02CCAAGCCCATCAGGCCCACCAACNONE 
J100089B14CCAAGCCCATCAGGCCCACCAACNONE 
Os08g0473600011-035-H09GGGCCTGANONE 
011-052-E06GGGCCTGANONE 
012-004-D02GGGCCTGANONE 
012-006-G11GGGCCTGANONE 
012-025-G01GGGCCTGANONE 
012-026-E10GGGCCTGANONE 
012-034-F07GGGCCTGANONE 
012-038-A04GGGCCTGANONE 
012-043-A07GGGCCTGANONE 
012-050-C12GGGCCTGANONE 
012-060-A06GGGCCTGANONE 
012-062-A07GGGCCTGANONE 
012-066-G07GGGCCTGANONE 
012-067-G12GGGCCTGANONE 
012-075-F02GGGCCTGANONE 
012-082-H06GGGCCTGANONE 
012-088-C08GGGCCTGANONE 
012-088-D06GGGCCTGANONE 
012-089-D12GGGCCTGANONE 
012-091-H05GGGCCTGANONE 
012-092-C06GGGCCTGANONE 
012-093-H01GGGCCTGANONE 
012-100-C09GGGCCTGANONE 
013-033-C02GGGCCTGANONE 
014-042-F10GGGCCTGANONE 
014-050-E03GGGCCTGANONE 
014-075-F10GGGCCTGANONE 
015-004-G11GGGCCTGANONE 
015-005-E07GGGCCTGANONE 
015-005-G08GGGCCTGANONE 
015-013-D03GGGCCTGANONE 
015-013-F04GGGCCTGANONE 
015-017-D03GGGCCTGANONE 
015-048-D02GGGCCTGANONE 
015-049-D02GGGCCTGANONE 
015-092-F03GGGCCTGANONE 
016-019-H02GGGCCTGANONE 
016-027-F03GGGCCTGANONE 
016-096-D06GGGCCTGANONE 
AK064071GGGCCTGANONE 
AK064300GGGCCTGAAlpha-amylase isozyme 3E precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
AK103413GGGCCTGANONE 
AK106526GGGCCTGANONE 
J033030A15GGGCCTGANONE 
J033040E10GGGCCTGANONE 
J033057P15GGGCCTGANONE 
J033127G12GGGCCTGANONE 
J033128G11GGGCCTGANONE 
J053054F05GGGCCTGANONE 
J065006J19GGGCCTGANONE 
J065007M11GGGCCTGANONE 
J065013H10GGGCCTGANONE 
J065015G17GGGCCTGANONE 
J065019C10GGGCCTGANONE 
J065020H22GGGCCTGANONE 
J065022H12GGGCCTGANONE 
J065024C08GGGCCTGANONE 
J065029F11GGGCCTGANONE 
J065036D04GGGCCTGANONE 
J065039F22GGGCCTGANONE 
J065042G09GGGCCTGANONE 
J065045L16GGGCCTGANONE 
J065046M13GGGCCTGANONE 
J065049E18GGGCCTGANONE 
J065052H21GGGCCTGANONE 
J065053G17GGGCCTGANONE 
J065066H10GGGCCTGANONE 
J065069M24GGGCCTGANONE 
J065070P07GGGCCTGANONE 
J065073O06GGGCCTGANONE 
J065078G19GGGCCTGANONE 
J065082P16GGGCCTGANONE 
J065086P15GGGCCTGANONE 
J065093H11GGGCCTGANONE 
J065097A14GGGCCTGANONE 
J065103D19GGGCCTGANONE 
J065105A18GGGCCTGANONE 
J065108N23GGGCCTGANONE 
J065109N14GGGCCTGANONE 
J065121K22GGGCCTGANONE 
J065122C18GGGCCTGANONE 
J065129L03GGGCCTGANONE 
J065130B11GGGCCTGANONE 
J065135P07GGGCCTGANONE 
J065139B03GGGCCTGANONE 
J065144O11GGGCCTGANONE 
J065163I17GGGCCTGANONE 
J065163J15GGGCCTGANONE 
J065177G16GGGCCTGANONE 
J065186D17GGGCCTGANONE 
J065187D02GGGCCTGANONE 
J065188L03GGGCCTGANONE 
J065191L02GGGCCTGANONE 
J065193F09GGGCCTGANONE 
J065197J03GGGCCTGANONE 
J065200F07GGGCCTGANONE 
J065208K11GGGCCTGANONE 
J065211I22GGGCCTGANONE 
J065213O22GGGCCTGANONE 
J065213P22GGGCCTGANONE 
Os08g0550100AB070258CGATGGGCCTGANONE 
AK061287CGATGGGCCTGASimilar to 26S proteasome subunit RPN3a. 
Os09g0129600J065058B14GGGCCTGASite-specific recombinase family protein. 
J065215K24GGGCCTGANONE 
Os09g0133600006-034-E08TCAGGCCCNONE 
AK061477TCAGGCCCPAP fibrillin family protein. 
AK099394TCAGGCCCNONE 
AK104742TCAGGCCCNONE 
AY224474TCAGGCCCNONE 
Os09g0370300AK108199AAATGGGCCTGASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0456800006-028-A04GGGCCTGANONE 
AK061433GGGCCTGASimilar to Heat stress transcription factor Spl7 (Heat shock transcription factor) (Heat shock factor RHSF10). 
AK101182GGGCCTGANONE 
J033029F08GGGCCTGANONE 
J065006I18GGGCCTGANONE 
J065078A03GGGCCTGANONE 
J065079C11GGGCCTGANONE 
J065088F02GGGCCTGANONE 
J065105N17GGGCCTGANONE 
J100044B07GGGCCTGANONE 
J100047C02GGGCCTGANONE 
Os09g0468900AK120990TCGGCCCATCAGGCCCACGTConserved hypothetical protein. 
J013123P13TCGGCCCATCAGGCCCACGTNONE 
J023013I09TCGGCCCATCAGGCCCACGTNONE 
J023023G08TCGGCCCATCAGGCCCACGTNONE 
J023043E08TCGGCCCATCAGGCCCACGTNONE 
J033124D24TCGGCCCATCAGGCCCACGTNONE 
J065047I07TCGGCCCATCAGGCCCACGTNONE 
J065093C16TCGGCCCATCAGGCCCACGTNONE 
J090088O03TCGGCCCATCAGGCCCACGTNONE 
J100032M21TCGGCCCATCAGGCCCACGTNONE 
Os09g0498100015-046-G11TCAGGCCCATCANONE 
AK064108TCAGGCCCATCASimilar to 30S ribosomal protein S16. 
J065040H21TCAGGCCCATCANONE 
J065062F05TCAGGCCCATCANONE 
J065147B17TCAGGCCCATCANONE 
J075098J22TCAGGCCCATCANONE 
Os09g0567000012-071-E09TCAGGCCCATGNONE 
013-099-E05TCAGGCCCATGNONE 
AK065613TCAGGCCCATGConserved hypothetical protein. 
J013026M04TCAGGCCCATGNONE 
J023103F04TCAGGCCCATGNONE 
J033119N04TCAGGCCCATGNONE 
J065011I19TCAGGCCCATGNONE 
J065042A10TCAGGCCCATGNONE 
J100023F16TCAGGCCCATGNONE 
Os09g0568000AK104856GGGCCTGANONE 
AK120601GGGCCTGAConserved hypothetical protein. 
J013030J03GGGCCTGANONE 
J013038J15GGGCCTGANONE 
J013063F08GGGCCTGANONE 
J013149K01GGGCCTGANONE 
J013156F07GGGCCTGANONE 
J013160I10GGGCCTGANONE 
J033089I21GGGCCTGANONE 
J033096C20GGGCCTGANONE 
J053042L22GGGCCTGANONE 
J053045O12GGGCCTGANONE 
J053061F22GGGCCTGANONE 
J065080I21GGGCCTGANONE 
J090017N19GGGCCTGANONE 
J090027P05GGGCCTGANONE 
J090049G16GGGCCTGANONE 
J100036P04GGGCCTGANONE 
Os11g0153600AK065028TTTTGGGCCTGAGTP-binding signal recognition particle SRP54, G-domain containing protein. 
J013001G13TTTTGGGCCTGANONE 
Os11g0157100012-010-F03GGAGTGGGCCTGAAACGGGCCNONE 
J013028H01GGAGTGGGCCTGAAACGGGCCNONE 
J013061L19GGAGTGGGCCTGAAACGGGCCNONE 
J033044L03GGAGTGGGCCTGAAACGGGCCNONE 
J033064P09GGAGTGGGCCTGAAACGGGCCNONE 
J033076A10GGAGTGGGCCTGAAACGGGCCNONE 
J033076K22GGAGTGGGCCTGAAACGGGCCNONE 
J033084J05GGAGTGGGCCTGAAACGGGCCNONE 
J033145A22GGAGTGGGCCTGAAACGGGCCNONE 
J033148L19GGAGTGGGCCTGAAACGGGCCNONE 
J065027P20GGAGTGGGCCTGAAACGGGCCNONE 
J065085D16GGAGTGGGCCTGAAACGGGCCNONE 
J065091L03GGAGTGGGCCTGAAACGGGCCNONE 
J065195C18GGAGTGGGCCTGAAACGGGCCNONE 
J090018N23GGAGTGGGCCTGAAACGGGCCNONE 
J090048A10GGAGTGGGCCTGAAACGGGCCNONE 
J090048M03GGAGTGGGCCTGAAACGGGCCNONE 
J090066L11GGAGTGGGCCTGAAACGGGCCNONE 
J090075G16GGAGTGGGCCTGAAACGGGCCNONE 
J090083G23GGAGTGGGCCTGAAACGGGCCNONE 
J090087E24GGAGTGGGCCTGAAACGGGCCNONE 
J090096H16GGAGTGGGCCTGAAACGGGCCNONE 
Os11g0175500015-087-F02TCAGGCCCATGAAAGCCCATGTNONE 
AK064320TCAGGCCCATGAAAGCCCATGTZinc finger, RING-type domain containing protein. 
AK101592TCAGGCCCATGAAAGCCCATGTNONE 
Os11g0461000AK062672GGGCCTGANONE 
AK072925GGGCCTGAPeptidase S10, serine carboxypeptidase family protein. 
AK106123GGGCCTGANONE 
AK121476GGGCCTGANONE 
J023148C06GGGCCTGANONE 
Os11g0503900006-092-E06TCAGGCCCNONE 
AK061183TCAGGCCCSulfotransferase family protein. 
Os12g0120400AK099904TAATGGGCCTGASimilar to ATPase-like protein. 
J065169A07TAATGGGCCTGANONE 
Os12g0577900015-034-E07TCAGGCCCAACCNONE 
AK106299TCAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os12g0638500AK072720TCAGGCCCConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.