version

Summary of OsREG647 (All List)

OrganismOryza sativa  
IDOsREG647  
SequenceGGGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count4056  

Entry Sequences (4056 entries)

<
LocusGene modelSequenceDescription
Os01g0103600006-072-A01GTGGTGGGCCCCCACNONE 
AK059848GTGGTGGGCCCCCACEmopamil-binding family protein. 
AK102848GTGGTGGGCCCCCACNONE 
J033036P20GTGGTGGGCCCCCACNONE 
J065171N21GTGGTGGGCCCCCACNONE 
J065209M02GTGGTGGGCCCCCACNONE 
J075067A03GTGGTGGGCCCCCACNONE 
J075110C09GTGGTGGGCCCCCACNONE 
Os01g0138900AK058378TGTGGGGCCCAGTAMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0150000006-053-H07CCCGTGGGCCCCACACNONE 
006-081-C11CCCGTGGGCCCCACACNONE 
009-050-D04CCCGTGGGCCCCACACNONE 
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18CCCGTGGGCCCCACACNONE 
J023112H22CCCGTGGGCCCCACACNONE 
J065048P05CCCGTGGGCCCCACACNONE 
J100068N20CCCGTGGGCCCCACACNONE 
J100073A02CCCGTGGGCCCCACACNONE 
Os01g0157600AK106766GGGGCCCACAAnkyrin repeat containing protein. 
Os01g0179000015-092-B11CAGGTGGGCCCCACCTransferase family protein. 
J033107B12CAGGTGGGCCCCACCNONE 
Os01g0185300011-055-A05CGTGTGGGGCCCACGTGNONE 
015-007-B11CGTGTGGGGCCCACGTGNONE 
015-062-F05CGTGTGGGGCCCACGTGNONE 
015-078-C11CGTGTGGGGCCCACGTGNONE 
016-068-F07CGTGTGGGGCCCACGTGNONE 
016-074-F08CGTGTGGGGCCCACGTGNONE 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK098922CGTGTGGGGCCCACGTGNONE 
J013000G12CGTGTGGGGCCCACGTGNONE 
J013001P14CGTGTGGGGCCCACGTGNONE 
J013002O23CGTGTGGGGCCCACGTGNONE 
J013096L23CGTGTGGGGCCCACGTGNONE 
J013097F24CGTGTGGGGCCCACGTGNONE 
J013120N24CGTGTGGGGCCCACGTGNONE 
J023007C15CGTGTGGGGCCCACGTGNONE 
J023119O12CGTGTGGGGCCCACGTGNONE 
J033039O11CGTGTGGGGCCCACGTGNONE 
J033043L11CGTGTGGGGCCCACGTGNONE 
J033061A07CGTGTGGGGCCCACGTGNONE 
J033076M13CGTGTGGGGCCCACGTGNONE 
J033082B04CGTGTGGGGCCCACGTGNONE 
J033143H15CGTGTGGGGCCCACGTGNONE 
J043013A02CGTGTGGGGCCCACGTGNONE 
J043036N21CGTGTGGGGCCCACGTGNONE 
J065013M09CGTGTGGGGCCCACGTGNONE 
J065082E22CGTGTGGGGCCCACGTGNONE 
J065093G01CGTGTGGGGCCCACGTGNONE 
J065120L06CGTGTGGGGCCCACGTGNONE 
J065135D03CGTGTGGGGCCCACGTGNONE 
J065197C10CGTGTGGGGCCCACGTGNONE 
J100024J10CGTGTGGGGCCCACGTGNONE 
J100042M22CGTGTGGGGCCCACGTGNONE 
J100077E12CGTGTGGGGCCCACGTGNONE 
J100084P03CGTGTGGGGCCCACGTGNONE 
Os01g0186900013-032-B12CGCGTGGGCCCCNONE 
013-069-C11CGCGTGGGCCCCNONE 
AK105323CGCGTGGGCCCCNONE 
AK105331CGCGTGGGCCCCConserved hypothetical protein. 
AK106168CGCGTGGGCCCCNONE 
J065023I10CGCGTGGGCCCCNONE 
J065182I03CGCGTGGGCCCCNONE 
J075116O22CGCGTGGGCCCCNONE 
J090082G13CGCGTGGGCCCCNONE 
J100060H12CGCGTGGGCCCCNONE 
Os01g0191800AK061360GGGGCCCATACNONE 
Os01g0198100AK119908TGTGGGCCCCConserved hypothetical protein. 
Os01g0218700J065010O15TGGGGCCCAGTNONE 
Os01g0246500AK058984GGGGCCCACCTGTCSimilar to Minus dominance protein. 
Os01g0250900AK065179TGTGGGCCCCACGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
J013002D15TGTGGGCCCCACGNONE 
J013037K03TGTGGGCCCCACGNONE 
J013091F03TGTGGGCCCCACGNONE 
J013127B14TGTGGGCCCCACGNONE 
Os01g0257400AK073920GGTGGGGCCCACCTGZinc finger, CCCH-type domain containing protein. 
Os01g0266500009-027-D05CCATGGGCCCCACTTGTCAGTGACACNONE 
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein. 
Os01g0270100006-096-H09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-009-C10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-054-E06GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
014-085-F09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK073275GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK104155GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
J033025K21GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075065H10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075143G10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J100059J02GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
Os01g0273300Os01g0273300CTGGGGCCCACCCBSD domain containing protein. 
Os01g0273800AK109645CAGGTGGGCCCCAFAD dependent oxidoreductase family protein. 
Os01g0276700011-014-A12GGGTGGGCCCCACCTGTCAGTNONE 
012-092-G12GGGTGGGCCCCACCTGTCAGTNONE 
AK103164GGGTGGGCCCCACCTGTCAGTNONE 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09GGGTGGGCCCCACCTGTCAGTNONE 
J023084I02GGGTGGGCCCCACCTGTCAGTNONE 
J033027F20GGGTGGGCCCCACCTGTCAGTNONE 
J033029M06GGGTGGGCCCCACCTGTCAGTNONE 
J033039K13GGGTGGGCCCCACCTGTCAGTNONE 
J033057C24GGGTGGGCCCCACCTGTCAGTNONE 
J033058G20GGGTGGGCCCCACCTGTCAGTNONE 
J033060A14GGGTGGGCCCCACCTGTCAGTNONE 
J033061M21GGGTGGGCCCCACCTGTCAGTNONE 
J033068M10GGGTGGGCCCCACCTGTCAGTNONE 
J033074K16GGGTGGGCCCCACCTGTCAGTNONE 
J033076C11GGGTGGGCCCCACCTGTCAGTNONE 
J033093O13GGGTGGGCCCCACCTGTCAGTNONE 
J033119H20GGGTGGGCCCCACCTGTCAGTNONE 
J033121D22GGGTGGGCCCCACCTGTCAGTNONE 
J033129N11GGGTGGGCCCCACCTGTCAGTNONE 
J033131E12GGGTGGGCCCCACCTGTCAGTNONE 
J033150L07GGGTGGGCCCCACCTGTCAGTNONE 
J053024N17GGGTGGGCCCCACCTGTCAGTNONE 
J053034G19GGGTGGGCCCCACCTGTCAGTNONE 
J053035E18GGGTGGGCCCCACCTGTCAGTNONE 
J053046M01GGGTGGGCCCCACCTGTCAGTNONE 
J053047P04GGGTGGGCCCCACCTGTCAGTNONE 
J053048B06GGGTGGGCCCCACCTGTCAGTNONE 
J053050M22GGGTGGGCCCCACCTGTCAGTNONE 
J053053E09GGGTGGGCCCCACCTGTCAGTNONE 
J053053I07GGGTGGGCCCCACCTGTCAGTNONE 
J053059K03GGGTGGGCCCCACCTGTCAGTNONE 
J053059P12GGGTGGGCCCCACCTGTCAGTNONE 
J053060C12GGGTGGGCCCCACCTGTCAGTNONE 
J053060H24GGGTGGGCCCCACCTGTCAGTNONE 
J053064D19GGGTGGGCCCCACCTGTCAGTNONE 
J053066L15GGGTGGGCCCCACCTGTCAGTNONE 
J053073I02GGGTGGGCCCCACCTGTCAGTNONE 
J053083E15GGGTGGGCCCCACCTGTCAGTNONE 
J053094D05GGGTGGGCCCCACCTGTCAGTNONE 
J053094P18GGGTGGGCCCCACCTGTCAGTNONE 
J053095C15GGGTGGGCCCCACCTGTCAGTNONE 
J053095C21GGGTGGGCCCCACCTGTCAGTNONE 
J053099N16GGGTGGGCCCCACCTGTCAGTNONE 
J090025O19GGGTGGGCCCCACCTGTCAGTNONE 
J090049N22GGGTGGGCCCCACCTGTCAGTNONE 
J090050F17GGGTGGGCCCCACCTGTCAGTNONE 
Os01g0277700006-081-F10AGGTGGGCCCCACCNONE 
014-013-D02AGGTGGGCCCCACCNONE 
AK061133AGGTGGGCCCCACCConserved hypothetical protein. 
AK099198AGGTGGGCCCCACCNONE 
J023115B14AGGTGGGCCCCACCNONE 
J065017F22AGGTGGGCCCCACCNONE 
J065090C03AGGTGGGCCCCACCNONE 
J065165H07AGGTGGGCCCCACCNONE 
Os01g0323600J023095C13GGGTGGGCCCCACTCCNONE 
Os01g0327500AK107756TGTGGGGCCCACTConserved hypothetical protein. 
Os01g0331900013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE 
AK064784GTGTGGGGCCCACGTGGGTCCCANONE 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE 
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE 
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
AK069619GGGGCCCACCCGProtein of unknown function DUF789 family protein. 
Os01g0530400016-019-E07AAATGGGCCCCAGNONE 
AK103724AAATGGGCCCCAGNONE 
AK106476AAATGGGCCCCAGGlutaredoxin-related protein family protein. 
J023108F14AAATGGGCCCCAGNONE 
J033138C10AAATGGGCCCCAGNONE 
Os01g0541900AK069784GGGTGGGCCCCACACGProtein kinase-like domain containing protein. 
J013033M01GGGTGGGCCCCACACGNONE 
J013159H24GGGTGGGCCCCACACGNONE 
J023008E13GGGTGGGCCCCACACGNONE 
J023030I11GGGTGGGCCCCACACGNONE 
J065137G08GGGTGGGCCCCACACGNONE 
J065139H16GGGTGGGCCCCACACGNONE 
J065154K13GGGTGGGCCCCACACGNONE 
J075176C02GGGTGGGCCCCACACGNONE 
Os01g0555100AK111255CTTGGGCCCCASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os01g0558600006-120-G12GGGTGGGCCCCACGNONE 
J013100N20GGGTGGGCCCCACGNONE 
J033043P09GGGTGGGCCCCACGNONE 
J033125M18GGGTGGGCCCCACGNONE 
J053043N11GGGTGGGCCCCACGNONE 
J065008E07GGGTGGGCCCCACGNONE 
J065080O16GGGTGGGCCCCACGNONE 
J075002G24GGGTGGGCCCCACGNONE 
J075123C09GGGTGGGCCCCACGNONE 
S66160GGGTGGGCCCCACGRas-related protein RIC1. 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0581300AK066182GGGGCCCAACSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015GGGGCCCAACNONE 
Os01g0587000AK067605GGGGCCCACTSimilar to Vacuolar ATP synthase subunit d (EC 3.6.3.14) (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
Os01g0590200011-100-E06GTTGGGCCGGGGCCCATTANONE 
012-005-A05GTTGGGCCGGGGCCCATTANONE 
AK063416GTTGGGCCGGGGCCCATTAConserved hypothetical protein. 
AK099235GTTGGGCCGGGGCCCATTANONE 
AK105022GTTGGGCCGGGGCCCATTANONE 
J065030D21GTTGGGCCGGGGCCCATTANONE 
J065031C10GTTGGGCCGGGGCCCATTANONE 
J065105A22GTTGGGCCGGGGCCCATTANONE 
J065173M19GTTGGGCCGGGGCCCATTANONE 
J075188F15GTTGGGCCGGGGCCCATTANONE 
J090050C15GTTGGGCCGGGGCCCATTANONE 
J100058K07GTTGGGCCGGGGCCCATTANONE 
Os01g0596700AK107371AAATGGGCCCCAFBD domain containing protein. 
Os01g0654500013-057-E05CAAGTGGGCCCCACGNONE 
AF155333CAAGTGGGCCCCACGNONE 
AK061752CAAGTGGGCCCCACGSimilar to NADP-isocitrate dehydrogenase. 
D21069CAAGTGGGCCCCACGNONE 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
Os01g0685900AK064024AATGGGCCCCACCTGTCAGTNONE 
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein. 
Os01g0694800015-093-H11GTGGGACCCACGTGGGCCCCACANONE 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os01g0706000006-098-D12TGTGGGCCCCACANONE 
AK059936TGTGGGCCCCACASimilar to RNA polymerase II transcriptional coactivator KELP. 
AK070545TGTGGGCCCCACANONE 
AK104192TGTGGGCCCCACANONE 
J023055M24TGTGGGCCCCACANONE 
J033102J04TGTGGGCCCCACANONE 
J065050P18TGTGGGCCCCACANONE 
J065076D07TGTGGGCCCCACANONE 
J065078O14TGTGGGCCCCACANONE 
J065104L13TGTGGGCCCCACANONE 
J065115J23TGTGGGCCCCACANONE 
J065143P08TGTGGGCCCCACANONE 
J065178N17TGTGGGCCCCACANONE 
J065179H14TGTGGGCCCCACANONE 
J065187J06TGTGGGCCCCACANONE 
J075047B18TGTGGGCCCCACANONE 
Os01g0716200AK062106TGTGGGCCCCCGCGIQ calmodulin-binding region domain containing protein. 
AK098920TGTGGGCCCCCGCGNONE 
J013002N06TGTGGGCCCCCGCGNONE 
J013050O19TGTGGGCCCCCGCGNONE 
J013074N19TGTGGGCCCCCGCGNONE 
J013127F17TGTGGGCCCCCGCGNONE 
J013155C17TGTGGGCCCCCGCGNONE 
J013158K07TGTGGGCCCCCGCGNONE 
J053086D01TGTGGGCCCCCGCGNONE 
Os01g0737900012-087-D12TTGTGGGCCCCNONE 
AK072600TTGTGGGCCCCProtein prenyltransferase domain containing protein. 
J023006E12TTGTGGGCCCCNONE 
J023130A18TTGTGGGCCCCNONE 
J023134O05TTGTGGGCCCCNONE 
Os01g0748600AK104674GGGGCCCAGCNONE 
Os01g0749400AK064990ACGTGGGCCCCNONE 
AK064990GGGGCCCATCTCTGTCAGTGGNONE 
AK067731ACGTGGGCCCCHAD-superfamily hydrolase subfamily IIB protein. 
AK067731GGGGCCCATCTCTGTCAGTGGHAD-superfamily hydrolase subfamily IIB protein. 
AK103775ACGTGGGCCCCNONE 
AK103775GGGGCCCATCTCTGTCAGTGGNONE 
J023001B06ACGTGGGCCCCNONE 
J023001B06GGGGCCCATCTCTGTCAGTGGNONE 
Os01g0766400AK073493GTGGTGGGCCCCConserved hypothetical protein. 
Os01g0767100AK109493GGGGCCCACCTSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0767600AK070672GGGGCCCACGGGConserved hypothetical protein. 
AK070672GGTGGGGCCCACGGConserved hypothetical protein. 
J013131M12GGGGCCCACGGGNONE 
J013131M12GGTGGGGCCCACGGNONE 
J023027B15GGGGCCCACGGGNONE 
J023027B15GGTGGGGCCCACGGNONE 
J023059I06GGGGCCCACGGGNONE 
J023059I06GGTGGGGCCCACGGNONE 
J023095L05GGGGCCCACGGGNONE 
J023095L05GGTGGGGCCCACGGNONE 
J033033E20GGGGCCCACGGGNONE 
J033033E20GGTGGGGCCCACGGNONE 
J033105F24GGGGCCCACGGGNONE 
J033105F24GGTGGGGCCCACGGNONE 
J033148N05GGGGCCCACGGGNONE 
J033148N05GGTGGGGCCCACGGNONE 
J065060H14GGGGCCCACGGGNONE 
J065060H14GGTGGGGCCCACGGNONE 
J090093E17GGGGCCCACGGGNONE 
J090093E17GGTGGGGCCCACGGNONE 
Os01g0778700AK064933GGTGGGGCCCACCAConserved hypothetical protein. 
Os01g0805800006-057-H04GGGGCCCACGCGTCATCCACCNONE 
006-106-H01GGGGCCCACGCGTCATCCACCNONE 
AK059963GGGGCCCACGCGTCATCCACCNONE 
AK103408GGGGCCCACGCGTCATCCACCRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0812200003-009-E06GGTGGGGCCCACCTNONE 
AK072651GGTGGGGCCCACCTCyclin-like F-box domain containing protein. 
AK104334GGTGGGGCCCACCTNONE 
J013030E13GGTGGGGCCCACCTNONE 
J013169M21GGTGGGGCCCACCTNONE 
J023012J16GGTGGGGCCCACCTNONE 
J023103F22GGTGGGGCCCACCTNONE 
J023123A01GGTGGGGCCCACCTNONE 
J023131F07GGTGGGGCCCACCTNONE 
J023146I01GGTGGGGCCCACCTNONE 
J033040K02GGTGGGGCCCACCTNONE 
J033079F06GGTGGGGCCCACCTNONE 
J033105G06GGTGGGGCCCACCTNONE 
J033117E08GGTGGGGCCCACCTNONE 
J043030C01GGTGGGGCCCACCTNONE 
J053043H16GGTGGGGCCCACCTNONE 
J053061H01GGTGGGGCCCACCTNONE 
J065044A03GGTGGGGCCCACCTNONE 
J065068E12GGTGGGGCCCACCTNONE 
J065069D09GGTGGGGCCCACCTNONE 
J065143M19GGTGGGGCCCACCTNONE 
J065193C10GGTGGGGCCCACCTNONE 
J065209D07GGTGGGGCCCACCTNONE 
J090083C17GGTGGGGCCCACCTNONE 
J090086G06GGTGGGGCCCACCTNONE 
J090093I09GGTGGGGCCCACCTNONE 
J100023G21GGTGGGGCCCACCTNONE 
J100025D15GGTGGGGCCCACCTNONE 
J100034B13GGTGGGGCCCACCTNONE 
J100040F10GGTGGGGCCCACCTNONE 
J100051E15GGTGGGGCCCACCTNONE 
J100056L08GGTGGGGCCCACCTNONE 
J100057H04GGTGGGGCCCACCTNONE 
J100085K20GGTGGGGCCCACCTNONE 
J100088G21GGTGGGGCCCACCTNONE 
Os01g0823500016-059-D03GTGGGGGCCCACGCNONE 
AK064237GTGGGGGCCCACGCProtein of unknown function DUF623, plant domain containing protein. 
Os01g0827200AK073922CCTGGGCCCCANONE 
AK120476CCTGGGCCCCAPhox-like domain containing protein. 
Os01g0836400AK073540ACGTGGGCCCCASAC3/GANP family protein. 
J023019D11ACGTGGGCCCCANONE 
J023139O22ACGTGGGCCCCANONE 
J033042J20ACGTGGGCCCCANONE 
J033046M18ACGTGGGCCCCANONE 
J033124J09ACGTGGGCCCCANONE 
J090015E05ACGTGGGCCCCANONE 
J090076J09ACGTGGGCCCCANONE 
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
Os01g0842500011-030-F11CATGGGCCCCNONE 
AK066513CATGGGCCCCSimilar to Laccase (EC 1.10.3.2). 
Os01g0844800AK099801CCACCAACTGGGCCCCACASimilar to Pumilio RBD (Fragment). 
AK102882CCACCAACTGGGCCCCACANONE 
AK103686CCACCAACTGGGCCCCACANONE 
Os01g0844900AK066659GCTGGGCCCCHomeodomain-like containing protein. 
Os01g0846300AK065949CGGGTGGGCCCCSimilar to Protein phosphatase 2C. 
Os01g0860700009-026-D05GGTGGGGCCCACANONE 
AK062402GGTGGGGCCCACAConserved hypothetical protein. 
Os01g0865100016-066-A05AGTGGGCCCCACCNONE 
AK065779AGTGGGCCCCACCNONE 
AK071410AGTGGGCCCCACCSimilar to Uricase (Fragment). 
J013039E23AGTGGGCCCCACCNONE 
J023024I07AGTGGGCCCCACCNONE 
J065160J15AGTGGGCCCCACCNONE 
J090052J17AGTGGGCCCCACCNONE 
Os01g0869000AK067351CGGGTGGGGCCCACCGCCCACGCCCAAACNONE 
AK121602CGGGTGGGGCCCACCGCCCACGCCCAAACProtein of unknown function DUF639 family protein. 
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein. 
AK070678TTTGGGCTGGGGCCCACATGTCAGTGNONE 
Os01g0874700011-001-F02ACGTGGGCCCCACCNONE 
012-048-H01ACGTGGGCCCCACCNONE 
012-094-B02ACGTGGGCCCCACCNONE 
AK073077ACGTGGGCCCCACCNONE 
AK105447ACGTGGGCCCCACCNONE 
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein. 
J100026G07ACGTGGGCCCCACCNONE 
J100030F07ACGTGGGCCCCACCNONE 
J100066J18ACGTGGGCCCCACCNONE 
J100077G12ACGTGGGCCCCACCNONE 
J100081K23ACGTGGGCCCCACCNONE 
Os01g0876500J053026A07GGGGCCCACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17GGGGCCCACACNONE 
Os01g0881800AK109594CCACTGACATGTGGGCCCCACAConserved hypothetical protein. 
J065066N18CCACTGACATGTGGGCCCCACANONE 
Os01g0911700012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
Os01g0918200009-034-H02GGGGCCCACGTNONE 
AK062434GGGGCCCACGTSimilar to Ubiquitin-like protein SMT3. 
AK103092GGGGCCCACGTNONE 
J065093P18GGGGCCCACGTNONE 
J065137C15GGGGCCCACGTNONE 
J065156G01GGGGCCCACGTNONE 
J065206H16GGGGCCCACGTNONE 
J065209D03GGGGCCCACGTNONE 
J075073K05GGGGCCCACGTNONE 
J075099B17GGGGCCCACGTNONE 
J075166N04GGGGCCCACGTNONE 
Os01g0918300009-036-G04GGGGCCCACACNONE 
009-128-H04GGGGCCCACACNONE 
009-189-D06GGGGCCCACACNONE 
AB016030GGGGCCCACACNONE 
AK058869GGGGCCCACACUbiquitin-like protein SMT3. 
AK069668GGGGCCCACACNONE 
J023026B05GGGGCCCACACNONE 
J053042E12GGGGCCCACACNONE 
J053045P19GGGGCCCACACNONE 
J053078C24GGGGCCCACACNONE 
J065038J05GGGGCCCACACNONE 
J065170B12GGGGCCCACACNONE 
J065174C07GGGGCCCACACNONE 
J075002G06GGGGCCCACACNONE 
J075024O07GGGGCCCACACNONE 
J075068H04GGGGCCCACACNONE 
J075071H14GGGGCCCACACNONE 
J075095G03GGGGCCCACACNONE 
J075117O08GGGGCCCACACNONE 
J075118J23GGGGCCCACACNONE 
J075124P18GGGGCCCACACNONE 
J100057D06GGGGCCCACACNONE 
J100063L03GGGGCCCACACNONE 
X99608GGGGCCCACACNONE 
Os01g0923300AK067520GGGGCCCACCCBS domain containing protein. 
Os01g0931300012-055-E05CCTGGGCCCCACANONE 
AK068196CCTGGGCCCCACATafazzin family protein. 
AK099213CCTGGGCCCCACANONE 
Os01g0934300AK072640CCTGGGCCCCACNONE 
J013073H18CCTGGGCCCCACNONE 
J023133P13CCTGGGCCCCACNONE 
J075098G20CCTGGGCCCCACNONE 
Os01g0952600AK067525CAGGTGGGGCCCAGATNONE 
AK070047CAGGTGGGGCCCAGATSimilar to LacZ (Fragment). 
Os01g0965800AK107795AACTGGGCCCCACTCTConserved hypothetical protein. 
Os01g0966400AK103064AGTGGGCCCCACALeucine-rich repeat, SDS22 containing protein. 
J023043O12AGTGGGCCCCACANONE 
J053084D04AGTGGGCCCCACANONE 
J090021L08AGTGGGCCCCACANONE 
Os02g0101500012-006-E03ATTTGGGCCCCNONE 
013-006-A02ATTTGGGCCCCNONE 
013-011-F03ATTTGGGCCCCNONE 
AK067642ATTTGGGCCCCNONE 
AK072105ATTTGGGCCCCSimilar to NADH-dependent hydroxypyruvate reductase (EC 1.1.1.29) (Fragment). 
J013027G04ATTTGGGCCCCNONE 
J013034P10ATTTGGGCCCCNONE 
J013039D15ATTTGGGCCCCNONE 
J013048P14ATTTGGGCCCCNONE 
J013050O03ATTTGGGCCCCNONE 
J013056H19ATTTGGGCCCCNONE 
J013071D11ATTTGGGCCCCNONE 
J013097D17ATTTGGGCCCCNONE 
J013104F13ATTTGGGCCCCNONE 
J013108J23ATTTGGGCCCCNONE 
J013119J12ATTTGGGCCCCNONE 
J013122N16ATTTGGGCCCCNONE 
J013146M24ATTTGGGCCCCNONE 
J013149E16ATTTGGGCCCCNONE 
J013157E04ATTTGGGCCCCNONE 
J023012P06ATTTGGGCCCCNONE 
J023050C21ATTTGGGCCCCNONE 
J023107F18ATTTGGGCCCCNONE 
J023110B19ATTTGGGCCCCNONE 
J023111H01ATTTGGGCCCCNONE 
J023148P04ATTTGGGCCCCNONE 
J043009E13ATTTGGGCCCCNONE 
J043009H22ATTTGGGCCCCNONE 
J065007D17ATTTGGGCCCCNONE 
J065038K16ATTTGGGCCCCNONE 
J065042A01ATTTGGGCCCCNONE 
J065075C20ATTTGGGCCCCNONE 
J065091I04ATTTGGGCCCCNONE 
J065131A03ATTTGGGCCCCNONE 
J075152O18ATTTGGGCCCCNONE 
J075152P17ATTTGGGCCCCNONE 
J080001F06ATTTGGGCCCCNONE 
J080002H09ATTTGGGCCCCNONE 
J080004L23ATTTGGGCCCCNONE 
J080005H18ATTTGGGCCCCNONE 
J080010D22ATTTGGGCCCCNONE 
J080010G17ATTTGGGCCCCNONE 
J080013E07ATTTGGGCCCCNONE 
J080013P18ATTTGGGCCCCNONE 
J080015D22ATTTGGGCCCCNONE 
J080025H24ATTTGGGCCCCNONE 
J080026O03ATTTGGGCCCCNONE 
J080036J01ATTTGGGCCCCNONE 
J080036L03ATTTGGGCCCCNONE 
J080037O13ATTTGGGCCCCNONE 
J080041D10ATTTGGGCCCCNONE 
J080045J04ATTTGGGCCCCNONE 
J080046J06ATTTGGGCCCCNONE 
J080048G16ATTTGGGCCCCNONE 
J080048I21ATTTGGGCCCCNONE 
J080056F16ATTTGGGCCCCNONE 
J080056L16ATTTGGGCCCCNONE 
J080057C02ATTTGGGCCCCNONE 
J080058D03ATTTGGGCCCCNONE 
J080061B19ATTTGGGCCCCNONE 
J080061E16ATTTGGGCCCCNONE 
J080061L22ATTTGGGCCCCNONE 
J080062P08ATTTGGGCCCCNONE 
J080067C01ATTTGGGCCCCNONE 
J080067G13ATTTGGGCCCCNONE 
J080068F20ATTTGGGCCCCNONE 
J080072H15ATTTGGGCCCCNONE 
J080072P12ATTTGGGCCCCNONE 
J080079O21ATTTGGGCCCCNONE 
J080081J15ATTTGGGCCCCNONE 
J080081K02ATTTGGGCCCCNONE 
J080085O11ATTTGGGCCCCNONE 
J080086N15ATTTGGGCCCCNONE 
J080087E22ATTTGGGCCCCNONE 
J080087O15ATTTGGGCCCCNONE 
J080091D07ATTTGGGCCCCNONE 
J080091J02ATTTGGGCCCCNONE 
J080091L21ATTTGGGCCCCNONE 
J080093B13ATTTGGGCCCCNONE 
J100069F01ATTTGGGCCCCNONE 
J100086B08ATTTGGGCCCCNONE 
Os02g0115700AK065094GGGGCCCACATCCACCCatalase isozyme A (EC 1.11.1.6) (CAT-A). 
AK099231GGGGCCCACATCCACCNONE 
AK099923GGGGCCCACATCCACCNONE 
X61626GGGGCCCACATCCACCNONE 
Os02g0120000AK067383AACTGGGCCCCAProtein prenyltransferase domain containing protein. 
AK101590AACTGGGCCCCANONE 
J013100B15AACTGGGCCCCANONE 
Os02g0121000AK099931CGCGTGGGCTTTGTTGGGCCCCSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0123200016-017-F04AGGTGGGCCCCACCTGNONE 
J033057C03AGGTGGGCCCCACCTGNONE 
J033087C11AGGTGGGCCCCACCTGNONE 
J033108J20AGGTGGGCCCCACCTGNONE 
J043015P08AGGTGGGCCCCACCTGNONE 
Os02g0125300006-047-E06CTCGCGCGTGCGTGGGCCCCACCNONE 
006-088-F09CTCGCGCGTGCGTGGGCCCCACCNONE 
006-106-F10CTCGCGCGTGCGTGGGCCCCACCNONE 
AB025926CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061564CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061953CTCGCGCGTGCGTGGGCCCCACCNONE 
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21CTCGCGCGTGCGTGGGCCCCACCNONE 
J023097A08CTCGCGCGTGCGTGGGCCCCACCNONE 
J023133F03CTCGCGCGTGCGTGGGCCCCACCNONE 
J033022C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033073C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033116O09CTCGCGCGTGCGTGGGCCCCACCNONE 
J033120E01CTCGCGCGTGCGTGGGCCCCACCNONE 
J065088M19CTCGCGCGTGCGTGGGCCCCACCNONE 
J065135O04CTCGCGCGTGCGTGGGCCCCACCNONE 
J080304J03CTCGCGCGTGCGTGGGCCCCACCNONE 
J090001K14CTCGCGCGTGCGTGGGCCCCACCNONE 
J090038D04CTCGCGCGTGCGTGGGCCCCACCNONE 
J090045G09CTCGCGCGTGCGTGGGCCCCACCNONE 
J090076E12CTCGCGCGTGCGTGGGCCCCACCNONE 
J090077D21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100018J19CTCGCGCGTGCGTGGGCCCCACCNONE 
J100029M12CTCGCGCGTGCGTGGGCCCCACCNONE 
J100049D07CTCGCGCGTGCGTGGGCCCCACCNONE 
J100067G21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100090D05CTCGCGCGTGCGTGGGCCCCACCNONE 
Os02g0129700AK065610GTGGGGGCCCACCTHypothetical protein. 
J013031M24GTGGGGGCCCACCTNONE 
J075043J08GTGGGGGCCCACCTNONE 
J075142N23GTGGGGGCCCACCTNONE 
Os02g0133800006-092-D12CGTGTGGGCCCCNONE 
006-111-G01CGTGTGGGCCCCNONE 
AK103646CGTGTGGGCCCCNONE 
AK109376CGTGTGGGCCCCProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CGTGTGGGCCCCNONE 
J033135B19CGTGTGGGCCCCNONE 
J065200F01CGTGTGGGCCCCNONE 
J065213J11CGTGTGGGCCCCNONE 
J075031N16CGTGTGGGCCCCNONE 
J075032N17CGTGTGGGCCCCNONE 
J075047P04CGTGTGGGCCCCNONE 
J075063D01CGTGTGGGCCCCNONE 
J075105F23CGTGTGGGCCCCNONE 
J075121E16CGTGTGGGCCCCNONE 
J075176F10CGTGTGGGCCCCNONE 
J075182M16CGTGTGGGCCCCNONE 
J075190E09CGTGTGGGCCCCNONE 
J075191B14CGTGTGGGCCCCNONE 
J100055J24CGTGTGGGCCCCNONE 
J100066H24CGTGTGGGCCCCNONE 
J100073N01CGTGTGGGCCCCNONE 
Os02g0135700AK100570GGTGGGCCCCAGDNA polymerase V family protein. 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
Os02g0148400AK070451GGCCGTGGGGGCCCACTNONE 
AK072039GGCCGTGGGGGCCCACTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10GGCCGTGGGGGCCCACTNONE 
Os02g0165500AK060547TGATGGGCCCCConserved hypothetical protein. 
Os02g0169300006-023-D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
006-062-B01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-049-F11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-057-G02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-092-F04ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-095-H02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-097-B07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
AK070041ATCTGGGCCCCACGCCTCCCGGCCCCACASimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134H23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134J23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023036N24ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023049C06ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077F10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023105N12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033036O12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033064P11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033079F01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033123M22ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033143E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J075013D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
Os02g0177700AK119941CAAGTGGGCCCCACCProtein of unknown function DUF588 family protein. 
Os02g0190900AK111037GTGGGGGCCCAAGPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CTTGGGCCCCCACConserved hypothetical protein. 
J075117E23CTTGGGCCCCCACNONE 
J075117F23CTTGGGCCCCCACNONE 
J075144M12CTTGGGCCCCCACNONE 
J075145H10CTTGGGCCCCCACNONE 
J075186B15CTTGGGCCCCCACNONE 
Os02g0202600AK068376ACTGGGCCCCACCTGNONE 
AK099277ACTGGGCCCCACCTGNONE 
AK101844ACTGGGCCCCACCTGTetratricopeptide-like helical domain containing protein. 
J080001G13ACTGGGCCCCACCTGNONE 
J080011J23ACTGGGCCCCACCTGNONE 
J080015F12ACTGGGCCCCACCTGNONE 
J080017J03ACTGGGCCCCACCTGNONE 
J080030J24ACTGGGCCCCACCTGNONE 
J080038H02ACTGGGCCCCACCTGNONE 
J080041G13ACTGGGCCCCACCTGNONE 
J080044B13ACTGGGCCCCACCTGNONE 
J080044L10ACTGGGCCCCACCTGNONE 
J080046H11ACTGGGCCCCACCTGNONE 
J080057J01ACTGGGCCCCACCTGNONE 
J080062E13ACTGGGCCCCACCTGNONE 
J080062N11ACTGGGCCCCACCTGNONE 
J080063C17ACTGGGCCCCACCTGNONE 
J080064K11ACTGGGCCCCACCTGNONE 
J080064N09ACTGGGCCCCACCTGNONE 
J080067C17ACTGGGCCCCACCTGNONE 
J080067C23ACTGGGCCCCACCTGNONE 
J080069J21ACTGGGCCCCACCTGNONE 
J080070L23ACTGGGCCCCACCTGNONE 
J080085N15ACTGGGCCCCACCTGNONE 
J080094F03ACTGGGCCCCACCTGNONE 
Os02g0208900003-126-D10TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK066171TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK070031TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK121183TGTGGGCCCCACACACCCCAGGCCCCACCAACSimilar to ZIGA2 protein (Fragment). 
J013031N09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J013045O19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023102A14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023145E14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033033E15TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033041H19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033050E09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065191H21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065193C21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J075068F07TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
Os02g0219900004-018-E11CCGTGGGCCCCACCCCCCACACNONE 
AK060915CCGTGGGCCCCACCCCCCACACNONE 
AK099194CCGTGGGCCCCACCCCCCACACNONE 
AK104206CCGTGGGCCCCACCCCCCACACNONE 
AK104393CCGTGGGCCCCACCCCCCACACSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07CCGTGGGCCCCACCCCCCACACNONE 
Os02g0251900AK109286CCGTGGGCCCCACASimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0282600AK070262GTGTGGGCCCCACAConserved hypothetical protein. 
AK070262GTGTGGGGCCCACAConserved hypothetical protein. 
J023041L18GTGTGGGCCCCACANONE 
J023041L18GTGTGGGGCCCACANONE 
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein. 
Os02g0304800Os02g0304800TGGGGCCCACGTGProtein prenyltransferase domain containing protein. 
Os02g0475300AK072737CCCCCGCGTCGTGGGCCCCACCTGNONE 
AK120516CCCCCGCGTCGTGGGCCCCACCTGMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0491300J065205O09GGTGGGGCCCACCTConserved hypothetical protein. 
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
Os02g0513100AK103266CCCGTGGGGGGCCCACASimilar to MtN3 protein precursor. 
Os02g0523800AK072296CTGGGGCCCACTInositol polyphosphate kinase family protein. 
J065081E24CTGGGGCCCACTNONE 
Os02g0530100AK058520GGACCCACTGACGTTGGGCCCCHeavy metal transport/detoxification protein domain containing protein. 
Os02g0534600Os02g0534600TGTGGGGCCCACAConserved hypothetical protein. 
Os02g0548900AK070239TGTGGGCCCCCACHypothetical protein. 
J023045K14TGTGGGCCCCCACNONE 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
Os02g0559300AK100088AGTGGGCCCCACCCCGTCCGANONE 
AK121206AGTGGGCCCCACCCCGTCCGAProtein kinase-like domain containing protein. 
J023003H24AGTGGGCCCCACCCCGTCCGANONE 
J023088A16AGTGGGCCCCACCCCGTCCGANONE 
J023100K01AGTGGGCCCCACCCCGTCCGANONE 
J023127H24AGTGGGCCCCACCCCGTCCGANONE 
Os02g0564000AJ486976GGTGGGGCCCACCTGTCNONE 
AK073086GGTGGGGCCCACCTGTCSimilar to Glutathione S-transferase. 
J065021E14GGTGGGGCCCACCTGTCNONE 
J065139E02GGTGGGGCCCACCTGTCNONE 
J065165G05GGTGGGGCCCACCTGTCNONE 
J065181H16GGTGGGGCCCACCTGTCNONE 
J065217K07GGTGGGGCCCACCTGTCNONE 
J065218L13GGTGGGGCCCACCTGTCNONE 
J100082K21GGTGGGGCCCACCTGTCNONE 
J100084K19GGTGGGGCCCACCTGTCNONE 
Os02g0564100006-072-A11GACAGGTGGGCCCCACCNONE 
AK073526GACAGGTGGGCCCCACCSimilar to EL3 protein. 
AK105951GACAGGTGGGCCCCACCNONE 
J100045C15GACAGGTGGGCCCCACCNONE 
Os02g0578800009-044-A06CCGTGGGCCCCACANONE 
009-044-A06TGTGGGGCCCACTNONE 
AK070066CCGTGGGCCCCACAProtein of unknown function DUF962 family protein. 
AK070066TGTGGGGCCCACTProtein of unknown function DUF962 family protein. 
Os02g0582600006-041-F11GGGGCCCAACANONE 
AK059791GGGGCCCAACANONE 
AK102380GGGGCCCAACAHeavy metal transport/detoxification protein domain containing protein. 
J033092A09GGGGCCCAACANONE 
Os02g0589400009-182-H08GGGACCCACCTGGGGCCCACCAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
009-199-B01GGGACCCACCTGGGGCCCACCANONE 
011-015-G12GGGACCCACCTGGGGCCCACCANONE 
J023113C24GGGACCCACCTGGGGCCCACCANONE 
Os02g0601800AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
Os02g0625500011-025-C06AGTGGGCCCCNONE 
AB050624AGTGGGCCCCNONE 
AK059188AGTGGGCCCCNONE 
AK059771AGTGGGCCCCNONE 
AK101791AGTGGGCCCCSimilar to Adenosine kinase-like protein (Fragment). 
AY224510AGTGGGCCCCNONE 
J013152H02AGTGGGCCCCNONE 
J023012P09AGTGGGCCCCNONE 
J023127D16AGTGGGCCCCNONE 
J033024G01AGTGGGCCCCNONE 
J033025L19AGTGGGCCCCNONE 
J033080M04AGTGGGCCCCNONE 
J033101A08AGTGGGCCCCNONE 
J033121L12AGTGGGCCCCNONE 
J043017N15AGTGGGCCCCNONE 
J065207J01AGTGGGCCCCNONE 
J090049G12AGTGGGCCCCNONE 
J100036A07AGTGGGCCCCNONE 
J100076C04AGTGGGCCCCNONE 
J100080N22AGTGGGCCCCNONE 
Os02g0649300014-043-A05GGTGGGGCCCACGCGTNONE 
AK063685GGTGGGGCCCACGCGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0651500AK066333TGGGGCCCAAGNONE 
AK121865TGGGGCCCAAGHypothetical protein. 
J090038J11TGGGGCCCAAGNONE 
Os02g0673600009-071-C12TCCGGCCCATGAGGGGCCCAATANONE 
J023037G24TCCGGCCCATGAGGGGCCCAATANONE 
J023038E07TCCGGCCCATGAGGGGCCCAATAORMDL family protein. 
J023142L24TCCGGCCCATGAGGGGCCCAATANONE 
J033115B14TCCGGCCCATGAGGGGCCCAATANONE 
J075004B15TCCGGCCCATGAGGGGCCCAATANONE 
J075067J21TCCGGCCCATGAGGGGCCCAATANONE 
J075072K07TCCGGCCCATGAGGGGCCCAATANONE 
J075147H21TCCGGCCCATGAGGGGCCCAATANONE 
J075154F03TCCGGCCCATGAGGGGCCCAATANONE 
Os02g0677700AK119947TGTGGGCCCCACANONE 
Os02g0686700AK111294CGTGGGGCCCACCTProtein of unknown function DUF581 family protein. 
Os02g0698100009-089-H10TGTGGGCCCCACGNONE 
AK060614TGTGGGCCCCACGGalactose oxidase, central domain containing protein. 
J090039P20TGTGGGCCCCACGNONE 
Os02g0709200AK058999GTCGCGCGCGTGGGCCCCSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase). 
AK099074GTCGCGCGCGTGGGCCCCNONE 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0725100AK071759TTGTGGGCCCCNONE 
Os02g0731700AK072346AATTGGGCCCCASimilar to CONSTANS-like 1 protein. 
AK120314AATTGGGCCCCANONE 
Os02g0733500AK108506TTGTGGGCCCCParvalbumin family protein. 
Os02g0741100AK068712GGTGGGGCCCACASimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK071144GGTGGGGCCCACANONE 
J065056A02GGTGGGGCCCACANONE 
J065212F10GGTGGGGCCCACANONE 
J080005J10GGTGGGGCCCACANONE 
J080013A11GGTGGGGCCCACANONE 
J080015E01GGTGGGGCCCACANONE 
J080022G23GGTGGGGCCCACANONE 
J080025C13GGTGGGGCCCACANONE 
J080026P14GGTGGGGCCCACANONE 
J080027D22GGTGGGGCCCACANONE 
J080027G13GGTGGGGCCCACANONE 
J080027L23GGTGGGGCCCACANONE 
J080027N23GGTGGGGCCCACANONE 
J080028F21GGTGGGGCCCACANONE 
J080028J18GGTGGGGCCCACANONE 
J080028P22GGTGGGGCCCACANONE 
J080038P04GGTGGGGCCCACANONE 
J080042M11GGTGGGGCCCACANONE 
J080043B19GGTGGGGCCCACANONE 
J080045J23GGTGGGGCCCACANONE 
J080047B06GGTGGGGCCCACANONE 
J080052F04GGTGGGGCCCACANONE 
J080057F01GGTGGGGCCCACANONE 
J080057G03GGTGGGGCCCACANONE 
J080060H12GGTGGGGCCCACANONE 
J080061L12GGTGGGGCCCACANONE 
J080062J17GGTGGGGCCCACANONE 
J080062M22GGTGGGGCCCACANONE 
J080072C01GGTGGGGCCCACANONE 
J080075F01GGTGGGGCCCACANONE 
J080076A09GGTGGGGCCCACANONE 
J080076I01GGTGGGGCCCACANONE 
J080077D01GGTGGGGCCCACANONE 
J080077F19GGTGGGGCCCACANONE 
J080079L19GGTGGGGCCCACANONE 
J080088B03GGTGGGGCCCACANONE 
J080090J15GGTGGGGCCCACANONE 
J080092J21GGTGGGGCCCACANONE 
J080095J12GGTGGGGCCCACANONE 
J090012C05GGTGGGGCCCACANONE 
J090039K19GGTGGGGCCCACANONE 
J090078L12GGTGGGGCCCACANONE 
Os02g0744700AF395537GACACGTGGGCCCCACACNONE 
AF395537GGTGGGGCCCACTTGNONE 
AJ308110GACACGTGGGCCCCACACNONE 
AJ308110GGTGGGGCCCACTTGNONE 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
AK066446GGTGGGGCCCACTTGSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0761600AK120494GGTGGGCCCCConserved hypothetical protein. 
Os02g0771700011-075-D10GTTGGGCCCCNONE 
011-086-E10GTTGGGCCCCNONE 
AK058571GTTGGGCCCCGlycoside hydrolase, family 17 protein. 
AK102185GTTGGGCCCCNONE 
J023001D03GTTGGGCCCCNONE 
J023041N11GTTGGGCCCCNONE 
J033086N13GTTGGGCCCCNONE 
J033106K14GTTGGGCCCCNONE 
J033125P22GTTGGGCCCCNONE 
Os02g0778200AK065948TCTGGGCCCCACCAminoacyl-tRNA synthetase, class I family protein. 
Os02g0780500AK072784GGGGCCCAGANONE 
AK121143GGGGCCCAGAConserved hypothetical protein. 
J023075M13GGGGCCCAGANONE 
J023077P14GGGGCCCAGANONE 
J023123C16GGGGCCCAGANONE 
J023142P06GGGGCCCAGANONE 
Os02g0782700005-009-B03CTGACAGGTGGGCCCCACCACNONE 
006-065-C12CTGACAGGTGGGCCCCACCACNONE 
011-016-A10CTGACAGGTGGGCCCCACCACNONE 
011-027-G10CTGACAGGTGGGCCCCACCACNONE 
011-078-C10CTGACAGGTGGGCCCCACCACNONE 
012-039-F02CTGACAGGTGGGCCCCACCACNONE 
012-059-F07CTGACAGGTGGGCCCCACCACNONE 
012-088-B06CTGACAGGTGGGCCCCACCACNONE 
012-088-C06CTGACAGGTGGGCCCCACCACNONE 
012-090-F01CTGACAGGTGGGCCCCACCACNONE 
015-002-C09CTGACAGGTGGGCCCCACCACNONE 
015-004-C04CTGACAGGTGGGCCCCACCACNONE 
015-024-F11CTGACAGGTGGGCCCCACCACNONE 
015-038-C01CTGACAGGTGGGCCCCACCACNONE 
015-053-H02CTGACAGGTGGGCCCCACCACNONE 
015-057-G04CTGACAGGTGGGCCCCACCACNONE 
016-010-H02CTGACAGGTGGGCCCCACCACNONE 
016-018-C07CTGACAGGTGGGCCCCACCACNONE 
016-048-B11CTGACAGGTGGGCCCCACCACNONE 
016-062-D03CTGACAGGTGGGCCCCACCACNONE 
016-077-H03CTGACAGGTGGGCCCCACCACNONE 
AF193803CTGACAGGTGGGCCCCACCACNONE 
AK064027CTGACAGGTGGGCCCCACCACNONE 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK119643CTGACAGGTGGGCCCCACCACNONE 
AK119885CTGACAGGTGGGCCCCACCACNONE 
J013021I16CTGACAGGTGGGCCCCACCACNONE 
J013049O14CTGACAGGTGGGCCCCACCACNONE 
J013063K17CTGACAGGTGGGCCCCACCACNONE 
J013072M15CTGACAGGTGGGCCCCACCACNONE 
J023027O06CTGACAGGTGGGCCCCACCACNONE 
J023065O13CTGACAGGTGGGCCCCACCACNONE 
J033061L05CTGACAGGTGGGCCCCACCACNONE 
J033071D23CTGACAGGTGGGCCCCACCACNONE 
J033091P12CTGACAGGTGGGCCCCACCACNONE 
J033124J07CTGACAGGTGGGCCCCACCACNONE 
J033144H23CTGACAGGTGGGCCCCACCACNONE 
J033145H23CTGACAGGTGGGCCCCACCACNONE 
J065063N13CTGACAGGTGGGCCCCACCACNONE 
J065186B09CTGACAGGTGGGCCCCACCACNONE 
J075055I18CTGACAGGTGGGCCCCACCACNONE 
J075177O06CTGACAGGTGGGCCCCACCACNONE 
J090008G10CTGACAGGTGGGCCCCACCACNONE 
J090050I24CTGACAGGTGGGCCCCACCACNONE 
J090062F21CTGACAGGTGGGCCCCACCACNONE 
J090071M09CTGACAGGTGGGCCCCACCACNONE 
J090078M03CTGACAGGTGGGCCCCACCACNONE 
J100018N15CTGACAGGTGGGCCCCACCACNONE 
J100035P04CTGACAGGTGGGCCCCACCACNONE 
J100037E03CTGACAGGTGGGCCCCACCACNONE 
J100045D04CTGACAGGTGGGCCCCACCACNONE 
J100062C01CTGACAGGTGGGCCCCACCACNONE 
J100065C13CTGACAGGTGGGCCCCACCACNONE 
J100068N10CTGACAGGTGGGCCCCACCACNONE 
J100074A11CTGACAGGTGGGCCCCACCACNONE 
J100077G20CTGACAGGTGGGCCCCACCACNONE 
Os02g0792600J090091O08CTGACAGGTGGGGCCCACGCNONE 
Os02g0794400AK065845AGATGGGCCCCAInitiation factor 3 family protein. 
J013042M03AGATGGGCCCCANONE 
Os02g0796500AK065276AAATGGGCCCCASimilar to Two-component response regulator ARR11 (Receiver-like protein 3). 
AK099581AAATGGGCCCCANONE 
AK120648AAATGGGCCCCANONE 
Os02g0797600004-004-A08GGGGCCCACCTNONE 
006-050-H07GGGGCCCACCTNONE 
006-092-B02GGGGCCCACCTNONE 
006-100-B08GGGGCCCACCTNONE 
013-037-D09GGGGCCCACCTNONE 
013-068-H02GGGGCCCACCTNONE 
AK060857GGGGCCCACCTNONE 
AK098882GGGGCCCACCTNONE 
AK104474GGGGCCCACCTNONE 
AK120644GGGGCCCACCTConserved hypothetical protein. 
J013001F21GGGGCCCACCTNONE 
J013074D07GGGGCCCACCTNONE 
J013096H23GGGGCCCACCTNONE 
J013098H07GGGGCCCACCTNONE 
J013132L13GGGGCCCACCTNONE 
J013134K05GGGGCCCACCTNONE 
J013155B15GGGGCCCACCTNONE 
J023002L17GGGGCCCACCTNONE 
J023013B08GGGGCCCACCTNONE 
J023087I01GGGGCCCACCTNONE 
J033071O04GGGGCCCACCTNONE 
J065161N23GGGGCCCACCTNONE 
J075055G11GGGGCCCACCTNONE 
J075106J02GGGGCCCACCTNONE 
J080009D06GGGGCCCACCTNONE 
J080009N22GGGGCCCACCTNONE 
J080016L03GGGGCCCACCTNONE 
J080023E17GGGGCCCACCTNONE 
J080027A12GGGGCCCACCTNONE 
J080036M24GGGGCCCACCTNONE 
J080038N07GGGGCCCACCTNONE 
J080041A04GGGGCCCACCTNONE 
J080042K11GGGGCCCACCTNONE 
J080050A04GGGGCCCACCTNONE 
J080053G16GGGGCCCACCTNONE 
J080063D03GGGGCCCACCTNONE 
J080063F07GGGGCCCACCTNONE 
J080067H13GGGGCCCACCTNONE 
J080068F12GGGGCCCACCTNONE 
J080072G17GGGGCCCACCTNONE 
J080072I06GGGGCCCACCTNONE 
J080072J24GGGGCCCACCTNONE 
J080076G09GGGGCCCACCTNONE 
J080085H10GGGGCCCACCTNONE 
J080092I17GGGGCCCACCTNONE 
J080092N20GGGGCCCACCTNONE 
J080093G10GGGGCCCACCTNONE 
J090074C23GGGGCCCACCTNONE 
J090083O18GGGGCCCACCTNONE 
J100046M05GGGGCCCACCTNONE 
J100050N16GGGGCCCACCTNONE 
J100054D07GGGGCCCACCTNONE 
J100054O11GGGGCCCACCTNONE 
J100055F04GGGGCCCACCTNONE 
J100055H22GGGGCCCACCTNONE 
J100063A05GGGGCCCACCTNONE 
J100063I24GGGGCCCACCTNONE 
J100067I12GGGGCCCACCTNONE 
J100074A22GGGGCCCACCTNONE 
J100078B22GGGGCCCACCTNONE 
J100079B03GGGGCCCACCTNONE 
Os02g0803600AK064750ACAGGTGGGCCCCLongin-like domain containing protein. 
AK064750TGTGGGCCCCALongin-like domain containing protein. 
Os02g0817500AK072707GACAGGTGGGCCCCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135GACAGGTGGGCCCCNONE 
U46758GACAGGTGGGCCCCNONE 
Os02g0817600006-085-G03GACAGGTGGGGCCCAGGNONE 
006-085-G03TTGTGGGCCCCACANONE 
AJ748648GACAGGTGGGGCCCAGGNONE 
AJ748648TTGTGGGCCCCACANONE 
AK069892GACAGGTGGGGCCCAGGAUX/IAA protein family protein. 
AK069892TTGTGGGCCCCACAAUX/IAA protein family protein. 
AK104501GACAGGTGGGGCCCAGGNONE 
AK104501TTGTGGGCCCCACANONE 
AK104802GACAGGTGGGGCCCAGGNONE 
AK104802TTGTGGGCCCCACANONE 
J013027H10GACAGGTGGGGCCCAGGNONE 
J013027H10TTGTGGGCCCCACANONE 
J013106L07GACAGGTGGGGCCCAGGNONE 
J013106L07TTGTGGGCCCCACANONE 
J013118N15GACAGGTGGGGCCCAGGNONE 
J013118N15TTGTGGGCCCCACANONE 
J013131H01GACAGGTGGGGCCCAGGNONE 
J013131H01TTGTGGGCCCCACANONE 
J013170C08GACAGGTGGGGCCCAGGNONE 
J013170C08TTGTGGGCCCCACANONE 
J023060C13GACAGGTGGGGCCCAGGNONE 
J023060C13TTGTGGGCCCCACANONE 
J033024K10GACAGGTGGGGCCCAGGNONE 
J033024K10TTGTGGGCCCCACANONE 
J033052I08GACAGGTGGGGCCCAGGNONE 
J033052I08TTGTGGGCCCCACANONE 
J090010H15GACAGGTGGGGCCCAGGNONE 
J090010H15TTGTGGGCCCCACANONE 
J090011J11GACAGGTGGGGCCCAGGNONE 
J090011J11TTGTGGGCCCCACANONE 
J090038P15GACAGGTGGGGCCCAGGNONE 
J090038P15TTGTGGGCCCCACANONE 
J090060B02GACAGGTGGGGCCCAGGNONE 
J090060B02TTGTGGGCCCCACANONE 
J100079J16GACAGGTGGGGCCCAGGNONE 
J100079J16TTGTGGGCCCCACANONE 
Os03g0113700AK103835CTGGGGCCCACCCGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CGGGTGGGCCCCAGProtein prenyltransferase domain containing protein. 
J013047E20CGGGTGGGCCCCAGNONE 
J065026F21CGGGTGGGCCCCAGNONE 
J065047B03CGGGTGGGCCCCAGNONE 
J065054J12CGGGTGGGCCCCAGNONE 
J065079M24CGGGTGGGCCCCAGNONE 
J065093M07CGGGTGGGCCCCAGNONE 
J065153F02CGGGTGGGCCCCAGNONE 
J065155E21CGGGTGGGCCCCAGNONE 
J065179H15CGGGTGGGCCCCAGNONE 
J075019N02CGGGTGGGCCCCAGNONE 
J075089E01CGGGTGGGCCCCAGNONE 
J090066I18CGGGTGGGCCCCAGNONE 
J090087K20CGGGTGGGCCCCAGNONE 
J100079F05CGGGTGGGCCCCAGNONE 
Os03g0113900AK107900GTGTGGGCCCCACCProtein of unknown function DUF584 family protein. 
AK119700GTGTGGGCCCCACCNONE 
Os03g0124300AK069148ACGCGTGGGCCCCACCConserved hypothetical protein. 
AK106076ACGCGTGGGCCCCACCNONE 
J023003G19ACGCGTGGGCCCCACCNONE 
Os03g0130400AK070255TCGTGGGCCCCAdenylate kinase, subfamily protein. 
Os03g0131300015-095-G06CCGTGGGCCCCCACNONE 
015-095-G06GGTCCACGTGGGGGCCCACCCNONE 
AK100656CCGTGGGCCCCCACUbiquitin domain containing protein. 
AK100656GGTCCACGTGGGGGCCCACCCUbiquitin domain containing protein. 
J033140O12CCGTGGGCCCCCACNONE 
J033140O12GGTCCACGTGGGGGCCCACCCNONE 
J065112C14CCGTGGGCCCCCACNONE 
J065112C14GGTCCACGTGGGGGCCCACCCNONE 
J090070D10CCGTGGGCCCCCACNONE 
J090070D10GGTCCACGTGGGGGCCCACCCNONE 
Os03g0151900009-084-F09GTGGGGCCCACTNONE 
AB032761GTGGGGCCCACTNONE 
AK105389GTGGGGCCCACTNONE 
AK121527GTGGGGCCCACTSimilar to Small GTP-binding protein. 
J075028M03GTGGGGCCCACTNONE 
J075031H15GTGGGGCCCACTNONE 
J075045L24GTGGGGCCCACTNONE 
J075055K14GTGGGGCCCACTNONE 
J075100O08GTGGGGCCCACTNONE 
J075112B20GTGGGGCCCACTNONE 
J075188D21GTGGGGCCCACTNONE 
Os03g0154300J065112A07AGGTGGGCCCCACGAAConserved hypothetical protein. 
J065192P15AGGTGGGCCCCACGAANONE 
Os03g0156500011-075-F02CGCGGGGGGGTGGGCCCCACACNONE 
012-077-G10CGCGGGGGGGTGGGCCCCACACNONE 
AK103466CGCGGGGGGGTGGGCCCCACACLupus La protein family protein. 
J013088H17CGCGGGGGGGTGGGCCCCACACNONE 
J013135G21CGCGGGGGGGTGGGCCCCACACNONE 
J033050E10CGCGGGGGGGTGGGCCCCACACNONE 
J033050J01CGCGGGGGGGTGGGCCCCACACNONE 
J033129N23CGCGGGGGGGTGGGCCCCACACNONE 
J065085L16CGCGGGGGGGTGGGCCCCACACNONE 
J065101B19CGCGGGGGGGTGGGCCCCACACNONE 
J065167N03CGCGGGGGGGTGGGCCCCACACNONE 
J090009O21CGCGGGGGGGTGGGCCCCACACNONE 
J090049D11CGCGGGGGGGTGGGCCCCACACNONE 
J100017F23CGCGGGGGGGTGGGCCCCACACNONE 
J100040E12CGCGGGGGGGTGGGCCCCACACNONE 
J100055O18CGCGGGGGGGTGGGCCCCACACNONE 
J100061K08CGCGGGGGGGTGGGCCCCACACNONE 
J100072M05CGCGGGGGGGTGGGCCCCACACNONE 
J100077B08CGCGGGGGGGTGGGCCCCACACNONE 
J100086G03CGCGGGGGGGTGGGCCCCACACNONE 
Os03g0161200AK066932GTGGTGGGCCCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0169600004-013-C11CCGTGGGCCCCACCACNONE 
011-035-C04CCGTGGGCCCCACCACNONE 
AK060900CCGTGGGCCCCACCACNONE 
AK099490CCGTGGGCCCCACCACZinc finger, Dof-type family protein. 
AK104523CCGTGGGCCCCACCACNONE 
AY224429CCGTGGGCCCCACCACNONE 
J013026L11CCGTGGGCCCCACCACNONE 
J013026N04CCGTGGGCCCCACCACNONE 
J013030D16CCGTGGGCCCCACCACNONE 
J013049P17CCGTGGGCCCCACCACNONE 
J013099D17CCGTGGGCCCCACCACNONE 
J013114M09CCGTGGGCCCCACCACNONE 
J013124F12CCGTGGGCCCCACCACNONE 
J013131J05CCGTGGGCCCCACCACNONE 
J023025M09CCGTGGGCCCCACCACNONE 
J090042J08CCGTGGGCCCCACCACNONE 
J090094F11CCGTGGGCCCCACCACNONE 
J100051I17CCGTGGGCCCCACCACNONE 
Os03g0169800AK068278GGTGGGCCCCACCTGTHNH nuclease domain containing protein. 
Os03g0175600AK059981GTTGGGCCCCACSimilar to Nit protein 2 (CUA002). 
Os03g0180100AK108326TCGTGGGCCCCACCCCACCACProtein of unknown function DUF1677, plant family protein. 
Os03g0183300003-107-A07CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-113-H10CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-118-G01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-028-A09CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-047-D01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-052-D04CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-087-H06CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-089-B03CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-092-D08CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-093-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-029-H07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-067-B05CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-091-F04CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-101-C10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-113-A06CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-140-E12CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-145-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-196-F02CCCCCGCGTGGGCCCCACCCACCTGNONE 
011-054-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-074-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-076-E11CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-006-C07CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-085-G11CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-049-C04CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-062-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
016-063-E02CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK058349CCCCCGCGTGGGCCCCACCCACCTGHypothetical protein. 
AK105922CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK106163CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK119553CCCCCGCGTGGGCCCCACCCACCTGNONE 
AY831395CCCCCGCGTGGGCCCCACCCACCTGNONE 
Os03g0184100AK067400GGTGGGGCCCAGCHypothetical protein. 
J013030J24GGTGGGGCCCAGCNONE 
J013037M23GGTGGGGCCCAGCNONE 
J013106B15GGTGGGGCCCAGCNONE 
J013130H10GGTGGGGCCCAGCNONE 
J013152B03GGTGGGGCCCAGCNONE 
J013157J24GGTGGGGCCCAGCNONE 
J013157K04GGTGGGGCCCAGCNONE 
J033093A19GGTGGGGCCCAGCNONE 
J033106E24GGTGGGGCCCAGCNONE 
J090043G12GGTGGGGCCCAGCNONE 
Os03g0186800AK100356GGGGCCCAGTModifier of rudimentary, Modr family protein. 
Os03g0188200AK058578GGTGGGGCCCACTZinc finger, RING-type domain containing protein. 
Os03g0201600AK067825GGTGGGGCCCACCTGTCNONE 
Os03g0206400AK066494CCTGGGCCCCACConserved hypothetical protein. 
AK107011CCTGGGCCCCACNONE 
J065162G04CCTGGGCCCCACNONE 
Os03g0213600AK100407TGTGGGGCCCACCConserved hypothetical protein. 
Os03g0244700011-100-F11GGGGCCCACTNONE 
015-065-B06GGGGCCCACTNONE 
AK100399GGGGCCCACTNONE 
AK100620GGGGCCCACTArmadillo-like helical domain containing protein. 
J023086N09GGGGCCCACTNONE 
J100032P14GGGGCCCACTNONE 
Os03g0251500AK101151CAGGTGGGGGCCCACANONE 
AK119298CAGGTGGGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0255200AK058212CAGGTGGGGCCCACTCCNONE 
AK071625CAGGTGGGGCCCACTCCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0266000AK068775AACTGGGCCCCOvarian tumour, otubain domain containing protein. 
AK104949AACTGGGCCCCNONE 
J075149K24AACTGGGCCCCNONE 
J075184C19AACTGGGCCCCNONE 
Os03g0266100AK058507GGGGCCCATCGLIM, zinc-binding domain containing protein. 
J033099G10GGGGCCCATCGNONE 
J065196N19GGGGCCCATCGNONE 
Os03g0266300006-027-H06TGTGGGCCCCANONE 
013-051-G08TGTGGGCCCCANONE 
014-002-C05TGTGGGCCCCANONE 
014-002-H02TGTGGGCCCCANONE 
014-005-A09TGTGGGCCCCANONE 
014-008-D02TGTGGGCCCCANONE 
014-008-G06TGTGGGCCCCANONE 
014-009-C12TGTGGGCCCCANONE 
014-010-A07TGTGGGCCCCANONE 
014-012-H03TGTGGGCCCCANONE 
014-013-E03TGTGGGCCCCANONE 
014-014-D03TGTGGGCCCCANONE 
014-028-C09TGTGGGCCCCANONE 
014-037-G05TGTGGGCCCCANONE 
014-038-E04TGTGGGCCCCANONE 
014-041-F08TGTGGGCCCCANONE 
014-049-E11TGTGGGCCCCANONE 
014-050-A05TGTGGGCCCCANONE 
014-053-F10TGTGGGCCCCANONE 
014-054-C04TGTGGGCCCCANONE 
014-056-A01TGTGGGCCCCANONE 
014-060-A08TGTGGGCCCCANONE 
014-072-C09TGTGGGCCCCANONE 
014-072-D02TGTGGGCCCCANONE 
014-077-G08TGTGGGCCCCANONE 
014-080-C10TGTGGGCCCCANONE 
014-098-E01TGTGGGCCCCANONE 
014-100-C02TGTGGGCCCCANONE 
014-100-E03TGTGGGCCCCANONE 
014-100-E10TGTGGGCCCCANONE 
015-061-D06TGTGGGCCCCANONE 
016-033-H10TGTGGGCCCCANONE 
AB110191TGTGGGCCCCANONE 
AF467729TGTGGGCCCCANONE 
AK073671TGTGGGCCCCANONE 
AK104129TGTGGGCCCCAClass I low-molecular-weight heat shock protein 17.9. 
AK119239TGTGGGCCCCANONE 
AK119616TGTGGGCCCCANONE 
AK119664TGTGGGCCCCANONE 
AK119675TGTGGGCCCCANONE 
D21285TGTGGGCCCCANONE 
J033051H23TGTGGGCCCCANONE 
J065036L24TGTGGGCCCCANONE 
J065045J20TGTGGGCCCCANONE 
J065104C03TGTGGGCCCCANONE 
J065109J20TGTGGGCCCCANONE 
J065116F24TGTGGGCCCCANONE 
J065146F06TGTGGGCCCCANONE 
J065146P18TGTGGGCCCCANONE 
J065167A09TGTGGGCCCCANONE 
J065183K12TGTGGGCCCCANONE 
J075019J15TGTGGGCCCCANONE 
J075112F10TGTGGGCCCCANONE 
J075150H04TGTGGGCCCCANONE 
J075159N20TGTGGGCCCCANONE 
J075164P19TGTGGGCCCCANONE 
J075185O05TGTGGGCCCCANONE 
J100030A19TGTGGGCCCCANONE 
J100044E07TGTGGGCCCCANONE 
Os03g0279400AK101851CCATGGGCCCCACCTGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCATGGGCCCCACCTGNONE 
J023079P21CCATGGGCCCCACCTGNONE 
J023120G14CCATGGGCCCCACCTGNONE 
J090042F16CCATGGGCCCCACCTGNONE 
Os03g0294200AK069285CCCGTGGGCCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0297100006-113-D12ATTTGGGCCCCACANONE 
AK061276ATTTGGGCCCCACASimilar to 40S ribosomal protein S7. 
J033119B03ATTTGGGCCCCACANONE 
J065205G10ATTTGGGCCCCACANONE 
J080069C17ATTTGGGCCCCACANONE 
J100069E15ATTTGGGCCCCACANONE 
J100081D07ATTTGGGCCCCACANONE 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
011-005-H01GGGGCCCACCTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
AK069222GGGGCCCACCTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J023014L15GGGGCCCACCTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12GGGGCCCACCTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16GGGGCCCACCTNONE 
Os03g0305400009-198-D04GGTGGGGCCCACCTGTCNONE 
013-012-C06GGTGGGGCCCACCTGTCNONE 
014-034-D01GGTGGGGCCCACCTGTCNONE 
AK071397GGTGGGGCCCACCTGTCUniversal stress protein (Usp) family protein. 
J023012O22GGTGGGGCCCACCTGTCNONE 
J023097A13GGTGGGGCCCACCTGTCNONE 
J023107P16GGTGGGGCCCACCTGTCNONE 
J023113C14GGTGGGGCCCACCTGTCNONE 
Os03g0306900AK073626CACGTGGGGTCGTGGGCCCCAGTENA/THI-4 protein domain containing protein. 
J033050J24CACGTGGGGTCGTGGGCCCCAGNONE 
J075180K24CACGTGGGGTCGTGGGCCCCAGNONE 
Os03g0307000J065032I03CTGGGGCCCACGACCCCACGTGHypothetical protein. 
J065110H17CTGGGGCCCACGACCCCACGTGNONE 
J065156H13CTGGGGCCCACGACCCCACGTGNONE 
J065175P03CTGGGGCCCACGACCCCACGTGNONE 
J075007D24CTGGGGCCCACGACCCCACGTGNONE 
J100040M24CTGGGGCCCACGACCCCACGTGNONE 
Os03g0312500AK106657CCCACGTGGGCCCCASimilar to Inhibitor of apoptosis-like protein. 
AK109328CCCACGTGGGCCCCANONE 
Os03g0327800J023133J12GGGGCCCACCCCCGCGNONE 
J065118C24GGGGCCCACCCCCGCGNONE 
J065136O13GGGGCCCACCCCCGCGNo apical meristem (NAM) protein domain containing protein. 
J065184M03GGGGCCCACCCCCGCGNONE 
J075105K14GGGGCCCACCCCCGCGNONE 
J075115E14GGGGCCCACCCCCGCGNONE 
J075166M18GGGGCCCACCCCCGCGNONE 
J075178F01GGGGCCCACCCCCGCGNONE 
J090008O14GGGGCCCACCCCCGCGNONE 
J090075F12GGGGCCCACCCCCGCGNONE 
J100019F12GGGGCCCACCCCCGCGNONE 
J100074P18GGGGCCCACCCCCGCGNONE 
J100075D15GGGGCCCACCCCCGCGNONE 
Os03g0335300AK098846GGTGGGGCCCACCCNONE 
AK098891GGTGGGGCCCACCCNONE 
AK111509GGTGGGGCCCACCCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847GGTGGGGCCCACCCNONE 
AK121413GGTGGGGCCCACCCNONE 
Os03g0337600AF119232CAAGTGGGCCCCACCNONE 
AK070859CAAGTGGGCCCCACCSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18CAAGTGGGCCCCACCNONE 
J013147M17CAAGTGGGCCCCACCNONE 
J065083M01CAAGTGGGCCCCACCNONE 
J065199H24CAAGTGGGCCCCACCNONE 
Os03g0340500012-007-F10TGTGGGGCCCACGGGTCAGTGGNONE 
AK099406TGTGGGGCCCACGGGTCAGTGGNONE 
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13TGTGGGGCCCACGGGTCAGTGGNONE 
J013063E02TGTGGGGCCCACGGGTCAGTGGNONE 
J013063I02TGTGGGGCCCACGGGTCAGTGGNONE 
J013157O07TGTGGGGCCCACGGGTCAGTGGNONE 
J023131N05TGTGGGGCCCACGGGTCAGTGGNONE 
J033033P05TGTGGGGCCCACGGGTCAGTGGNONE 
J033040N16TGTGGGGCCCACGGGTCAGTGGNONE 
J033044M19TGTGGGGCCCACGGGTCAGTGGNONE 
J033086F24TGTGGGGCCCACGGGTCAGTGGNONE 
J033097H01TGTGGGGCCCACGGGTCAGTGGNONE 
J033106C22TGTGGGGCCCACGGGTCAGTGGNONE 
J033128M13TGTGGGGCCCACGGGTCAGTGGNONE 
J033133I15TGTGGGGCCCACGGGTCAGTGGNONE 
J043027A21TGTGGGGCCCACGGGTCAGTGGNONE 
J090028A09TGTGGGGCCCACGGGTCAGTGGNONE 
J090053D06TGTGGGGCCCACGGGTCAGTGGNONE 
J090083O17TGTGGGGCCCACGGGTCAGTGGNONE 
J090099H10TGTGGGGCCCACGGGTCAGTGGNONE 
J100036M05TGTGGGGCCCACGGGTCAGTGGNONE 
Os03g0342900006-032-D01CCCGTGGGCCCCACNONE 
006-033-E10CCCGTGGGCCCCACNONE 
006-051-G06CCCGTGGGCCCCACNONE 
006-053-E05CCCGTGGGCCCCACNONE 
006-056-B05CCCGTGGGCCCCACNONE 
006-058-F04CCCGTGGGCCCCACNONE 
006-059-E05CCCGTGGGCCCCACNONE 
006-060-F10CCCGTGGGCCCCACNONE 
006-104-D12CCCGTGGGCCCCACNONE 
009-129-C12CCCGTGGGCCCCACNONE 
AK060136CCCGTGGGCCCCACNONE 
AK060980CCCGTGGGCCCCACNONE 
AK064815CCCGTGGGCCCCACDormancyauxin associated family protein. 
AK104244CCCGTGGGCCCCACNONE 
AK104391CCCGTGGGCCCCACNONE 
AK104590CCCGTGGGCCCCACNONE 
AK104744CCCGTGGGCCCCACNONE 
AK106100CCCGTGGGCCCCACNONE 
J013000E10CCCGTGGGCCCCACNONE 
J075027O22CCCGTGGGCCCCACNONE 
J075052J03CCCGTGGGCCCCACNONE 
J075066E15CCCGTGGGCCCCACNONE 
J075095C17CCCGTGGGCCCCACNONE 
J075118N05CCCGTGGGCCCCACNONE 
J075187K22CCCGTGGGCCCCACNONE 
J090026L04CCCGTGGGCCCCACNONE 
J090059G16CCCGTGGGCCCCACNONE 
J100055P20CCCGTGGGCCCCACNONE 
J100062A10CCCGTGGGCCCCACNONE 
J100068G20CCCGTGGGCCCCACNONE 
Os03g0352800009-030-G08TGTGGGGCCCACANONE 
AK059673TGTGGGGCCCACASimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17TGTGGGGCCCACANONE 
J075050N19TGTGGGGCCCACANONE 
J075104J18TGTGGGGCCCACANONE 
J075142K05TGTGGGGCCCACANONE 
J100050I19TGTGGGGCCCACANONE 
J100057N04TGTGGGGCCCACANONE 
Os03g0370000AK100033CCTGGGCCCCACCACSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
AK100033GGTGGGGCCCACCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0373300AK107897TCGTGGGCCCCACGTCTCProtein of unknown function DUF1110 family protein. 
Os03g0411000AK072079GGGGCCCAAAApoptosis inhibitory 5 family protein. 
AK120207GGGGCCCAAANONE 
J013038J18GGGGCCCAAANONE 
J013063P09GGGGCCCAAANONE 
J013118N09GGGGCCCAAANONE 
J033022P08GGGGCCCAAANONE 
J033043E22GGGGCCCAAANONE 
J033094K23GGGGCCCAAANONE 
J033118J19GGGGCCCAAANONE 
J043010M20GGGGCCCAAANONE 
J065006E09GGGGCCCAAANONE 
J065011M01GGGGCCCAAANONE 
J065044F22GGGGCCCAAANONE 
J065131F15GGGGCCCAAANONE 
J065147G04GGGGCCCAAANONE 
J065154C20GGGGCCCAAANONE 
J065158H17GGGGCCCAAANONE 
J090011G09GGGGCCCAAANONE 
J090030I09GGGGCCCAAANONE 
Os03g0411800009-042-G11AGATGGGCCCCCACGTNONE 
AK121551AGATGGGCCCCCACGTSimilar to Metal transport protein. 
AY302059AGATGGGCCCCCACGTNONE 
J013095L05AGATGGGCCCCCACGTNONE 
J033033B06AGATGGGCCCCCACGTNONE 
J033118G11AGATGGGCCCCCACGTNONE 
Os03g0561249J065016H04CCTGGGCCCCConserved hypothetical protein. 
Os03g0570300AK069396GGGGCCCAGGTranslation protein SH3-like domain containing protein. 
J013036G06GGGGCCCAGGNONE 
J023014K13GGGGCCCAGGNONE 
Os03g0581600J065037H09GGTCCACGTGGGCCCCACACNONE 
J065183O12GGTCCACGTGGGCCCCACACNONE 
Os03g0586300AK100442CAAGTGGGCCCCReticulon family protein. 
AK100442CAGGTGGGCCCCReticulon family protein. 
J023031G06CAAGTGGGCCCCNONE 
J023031G06CAGGTGGGCCCCNONE 
J023089N19CAAGTGGGCCCCNONE 
J023089N19CAGGTGGGCCCCNONE 
J023099N13CAAGTGGGCCCCNONE 
J023099N13CAGGTGGGCCCCNONE 
J065026N17CAAGTGGGCCCCNONE 
J065026N17CAGGTGGGCCCCNONE 
J065045N16CAAGTGGGCCCCNONE 
J065045N16CAGGTGGGCCCCNONE 
J065163L12CAAGTGGGCCCCNONE 
J065163L12CAGGTGGGCCCCNONE 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0633900AK059181ACGTGGGCCCCACASingle-strand binding protein family protein. 
AK068169ACGTGGGCCCCACANONE 
Os03g0643300AK099445AGTGGGCCCCACCACSimilar to AER123Wp. 
AK108010AGTGGGCCCCACCACNONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0669200J013037D23CAGGTGGGCCCCACANONE 
J023026K09CAGGTGGGCCCCACANONE 
J075008E21CAGGTGGGCCCCACANONE 
J075061B21CAGGTGGGCCCCACANONE 
J075151B13CAGGTGGGCCCCACANONE 
J075195L02CAGGTGGGCCCCACANONE 
J090061B07CAGGTGGGCCCCACANONE 
Os03g0670200011-069-G05TGTGGGCCCCACCGATCCGNONE 
AK069553TGTGGGCCCCACCGATCCGSimilar to YJR013Wp (Fragment). 
J023020O11TGTGGGCCCCACCGATCCGNONE 
J023114J22TGTGGGCCCCACCGATCCGNONE 
J100084F17TGTGGGCCCCACCGATCCGNONE 
J100087A11TGTGGGCCCCACCGATCCGNONE 
Os03g0684400AK100086AACTGGGCCCCACCMg2+ transporter protein, CorA-like family protein. 
Os03g0701000J075172J23CTGGCCCATGGGCCCCNONE 
Os03g0712200AK073205GTGGTGGGGCCCAACZinc finger, RanBP2-type domain containing protein. 
AK098968GTGGTGGGGCCCAACNONE 
Os03g0713100J013039M09CCCACTCCCTGGGGCCCACCTGNONE 
J023007K01CCCACTCCCTGGGGCCCACCTGNONE 
J023073H01CCCACTCCCTGGGGCCCACCTGNONE 
J023087M20CCCACTCCCTGGGGCCCACCTGNONE 
J023142E01CCCACTCCCTGGGGCCCACCTGNONE 
J033048E03CCCACTCCCTGGGGCCCACCTGNONE 
J033048F03CCCACTCCCTGGGGCCCACCTGSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11CCCACTCCCTGGGGCCCACCTGNONE 
J033074M20CCCACTCCCTGGGGCCCACCTGNONE 
J033084M11CCCACTCCCTGGGGCCCACCTGNONE 
J033091I23CCCACTCCCTGGGGCCCACCTGNONE 
J033100C08CCCACTCCCTGGGGCCCACCTGNONE 
J033123K19CCCACTCCCTGGGGCCCACCTGNONE 
J090006P21CCCACTCCCTGGGGCCCACCTGNONE 
J090045O16CCCACTCCCTGGGGCCCACCTGNONE 
J100087M13CCCACTCCCTGGGGCCCACCTGNONE 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
Os03g0741400AK121838CTGGGGCCCACTSimilar to SUSIBA2. 
J100032E12CTGGGGCCCACTNONE 
Os03g0745600014-030-E09CCTGGGCCCCACANONE 
J053057E07CCTGGGCCCCACANONE 
J075044L08CCTGGGCCCCACANONE 
J075069C24CCTGGGCCCCACANONE 
J075127J02CCTGGGCCCCACAProtein of unknown function UPF0005 family protein. 
J075180G21CCTGGGCCCCACANONE 
J075189M22CCTGGGCCCCACANONE 
J075192P11CCTGGGCCCCACANONE 
Os03g0758500016-015-D02CACGTGGGCCCCNONE 
AK059403CACGTGGGCCCCNONE 
AK102002CACGTGGGCCCCPlastocyanin-like domain containing protein. 
J033079N03CACGTGGGCCCCNONE 
J065012M05CACGTGGGCCCCNONE 
J065045H19CACGTGGGCCCCNONE 
J065050J08CACGTGGGCCCCNONE 
J075189D02CACGTGGGCCCCNONE 
J090018L03CACGTGGGCCCCNONE 
J100043O22CACGTGGGCCCCNONE 
J100088G17CACGTGGGCCCCNONE 
Os03g0758800AJ252135GCCGTTGGGTGGGCCCCACGTNONE 
AJ312906GCCGTTGGGTGGGCCCCACGTNONE 
AK060387GCCGTTGGGTGGGCCCCACGTSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592GCCGTTGGGTGGGCCCCACGTNONE 
J023109G09GCCGTTGGGTGGGCCCCACGTNONE 
J033038B14GCCGTTGGGTGGGCCCCACGTNONE 
J043013C09GCCGTTGGGTGGGCCCCACGTNONE 
J053096E21GCCGTTGGGTGGGCCCCACGTNONE 
J065026B08GCCGTTGGGTGGGCCCCACGTNONE 
J065062B16GCCGTTGGGTGGGCCCCACGTNONE 
J065066E03GCCGTTGGGTGGGCCCCACGTNONE 
J065091J12GCCGTTGGGTGGGCCCCACGTNONE 
J065164A06GCCGTTGGGTGGGCCCCACGTNONE 
J075014I20GCCGTTGGGTGGGCCCCACGTNONE 
J075117N07GCCGTTGGGTGGGCCCCACGTNONE 
J075142M03GCCGTTGGGTGGGCCCCACGTNONE 
J075175D04GCCGTTGGGTGGGCCCCACGTNONE 
J075188M01GCCGTTGGGTGGGCCCCACGTNONE 
J075199I20GCCGTTGGGTGGGCCCCACGTNONE 
J090010J12GCCGTTGGGTGGGCCCCACGTNONE 
J090025O16GCCGTTGGGTGGGCCCCACGTNONE 
J090041H05GCCGTTGGGTGGGCCCCACGTNONE 
J090078P07GCCGTTGGGTGGGCCCCACGTNONE 
J100031K10GCCGTTGGGTGGGCCCCACGTNONE 
J100055F23GCCGTTGGGTGGGCCCCACGTNONE 
J100064G05GCCGTTGGGTGGGCCCCACGTNONE 
J100080C24GCCGTTGGGTGGGCCCCACGTNONE 
J100080O07GCCGTTGGGTGGGCCCCACGTNONE 
J100090F01GCCGTTGGGTGGGCCCCACGTNONE 
Os03g0773300AK058587CTTGGGCCCCNONE 
Os03g0780600AK120180CAGGTGGGCCCCNONE 
AK120180CCCGTGGGCCCCACGTNONE 
D13224CAGGTGGGCCCCTubulin beta-1 chain (Beta-1 tubulin). 
D13224CCCGTGGGCCCCACGTTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18CAGGTGGGCCCCNONE 
J013033M18CCCGTGGGCCCCACGTNONE 
J033022G05CAGGTGGGCCCCNONE 
J033022G05CCCGTGGGCCCCACGTNONE 
J033028A16CAGGTGGGCCCCNONE 
J033028A16CCCGTGGGCCCCACGTNONE 
J033050M08CAGGTGGGCCCCNONE 
J033050M08CCCGTGGGCCCCACGTNONE 
J090053F04CAGGTGGGCCCCNONE 
J090053F04CCCGTGGGCCCCACGTNONE 
J090064E19CAGGTGGGCCCCNONE 
J090064E19CCCGTGGGCCCCACGTNONE 
J090083J24CAGGTGGGCCCCNONE 
J090083J24CCCGTGGGCCCCACGTNONE 
J100024I23CAGGTGGGCCCCNONE 
J100024I23CCCGTGGGCCCCACGTNONE 
Os03g0784500AK109744ACAGGTGGGGCCCACAANONE 
AK109744GGTGGGCCCCACCACNONE 
Os03g0788800AK071670CAGGTGGGCCCCZinc finger, RING-type domain containing protein. 
AK071670GTGGGGCCCACGCZinc finger, RING-type domain containing protein. 
J013090J22CAGGTGGGCCCCNONE 
J013090J22GTGGGGCCCACGCNONE 
J023050M06CAGGTGGGCCCCNONE 
J023050M06GTGGGGCCCACGCNONE 
J023073A12CAGGTGGGCCCCNONE 
J023073A12GTGGGGCCCACGCNONE 
J023075P21CAGGTGGGCCCCNONE 
J023075P21GTGGGGCCCACGCNONE 
J023106F04CAGGTGGGCCCCNONE 
J023106F04GTGGGGCCCACGCNONE 
J075181H19CAGGTGGGCCCCNONE 
J075181H19GTGGGGCCCACGCNONE 
J090009C24CAGGTGGGCCCCNONE 
J090009C24GTGGGGCCCACGCNONE 
J100027L24CAGGTGGGCCCCNONE 
J100027L24GTGGGGCCCACGCNONE 
J100055F06CAGGTGGGCCCCNONE 
J100055F06GTGGGGCCCACGCNONE 
J100081C22CAGGTGGGCCCCNONE 
J100081C22GTGGGGCCCACGCNONE 
J100084I21CAGGTGGGCCCCNONE 
J100084I21GTGGGGCCCACGCNONE 
Os03g0791800013-037-A12GGTTGGGCCCCNONE 
AB079798GGTTGGGCCCCNONE 
AK067703GGTTGGGCCCCRad6 (Ubiquitin carrier protein). 
AK120251GGTTGGGCCCCNONE 
J013045G10GGTTGGGCCCCNONE 
J023102B18GGTTGGGCCCCNONE 
J065020J23GGTTGGGCCCCNONE 
J065127I21GGTTGGGCCCCNONE 
J065151E11GGTTGGGCCCCNONE 
J075076B05GGTTGGGCCCCNONE 
J075116C15GGTTGGGCCCCNONE 
J075136A07GGTTGGGCCCCNONE 
J100029G21GGTTGGGCCCCNONE 
J100030K01GGTTGGGCCCCNONE 
J100041J02GGTTGGGCCCCNONE 
J100049C22GGTTGGGCCCCNONE 
J100057G17GGTTGGGCCCCNONE 
J100086L12GGTTGGGCCCCNONE 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
J033125G24GTGGGACCCACGTGGGCCCCACANONE 
J065132N21GTGGGACCCACGTGGGCCCCACANONE 
Os03g0796600003-113-D10TCGTGGGCCCCACCNONE 
011-076-B12TCGTGGGCCCCACCNONE 
AK105257TCGTGGGCCCCACCProtein of unknown function DUF506, plant family protein. 
J075105C03TCGTGGGCCCCACCNONE 
J080036O17TCGTGGGCCCCACCNONE 
J080064E16TCGTGGGCCCCACCNONE 
J080069E03TCGTGGGCCCCACCNONE 
J080079E23TCGTGGGCCCCACCNONE 
J090036H20TCGTGGGCCCCACCNONE 
J100029L10TCGTGGGCCCCACCNONE 
J100055G09TCGTGGGCCCCACCNONE 
Os03g0796800J065024O22CACGTGGGCCCCATCCAConserved hypothetical protein. 
Os03g0808100AK069196CAGGTGGGCCCCACCSimilar to Cellulose synthase-5. 
J013059D03CAGGTGGGCCCCACCNONE 
J013099J05CAGGTGGGCCCCACCNONE 
J013106M06CAGGTGGGCCCCACCNONE 
J013151H03CAGGTGGGCCCCACCNONE 
J023003G18CAGGTGGGCCCCACCNONE 
J023038M11CAGGTGGGCCCCACCNONE 
J023056M17CAGGTGGGCCCCACCNONE 
J023105F22CAGGTGGGCCCCACCNONE 
J033023F17CAGGTGGGCCCCACCNONE 
J033028J21CAGGTGGGCCCCACCNONE 
J033131J19CAGGTGGGCCCCACCNONE 
J033132E06CAGGTGGGCCCCACCNONE 
J090007L14CAGGTGGGCCCCACCNONE 
J090011H02CAGGTGGGCCCCACCNONE 
J090026D20CAGGTGGGCCCCACCNONE 
J090029H09CAGGTGGGCCCCACCNONE 
J090033B18CAGGTGGGCCCCACCNONE 
J090039J02CAGGTGGGCCCCACCNONE 
J090050D17CAGGTGGGCCCCACCNONE 
J090050I15CAGGTGGGCCCCACCNONE 
J090063G20CAGGTGGGCCCCACCNONE 
J090064J21CAGGTGGGCCCCACCNONE 
J090071E19CAGGTGGGCCCCACCNONE 
J090075F10CAGGTGGGCCCCACCNONE 
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein. 
Os03g0811600009-134-B07TGTGGGCCCCACATGTCAGTGNONE 
AK071076TGTGGGCCCCACATGTCAGTGSimilar to Peptidyl prolyl isomerase H. 
J023078H22TGTGGGCCCCACATGTCAGTGNONE 
Os03g0811800AK063320ATATGGGCCCCARibosomal protein L36 family protein. 
J065094F18ATATGGGCCCCANONE 
J090029B04ATATGGGCCCCANONE 
Os03g0832600AK120137GGTGGGCCCCACASimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0836200009-165-F07GGGTGGGCCCCACCTGNONE 
015-092-G01GGGTGGGCCCCACCTGNONE 
AK058443GGGTGGGCCCCACCTGNONE 
AK067084GGGTGGGCCCCACCTGSimilar to RNA-binding protein RZ-1. 
AK101225GGGTGGGCCCCACCTGNONE 
J013092A03GGGTGGGCCCCACCTGNONE 
J013095N17GGGTGGGCCCCACCTGNONE 
J013147J18GGGTGGGCCCCACCTGNONE 
J023019O10GGGTGGGCCCCACCTGNONE 
J023065N18GGGTGGGCCCCACCTGNONE 
J033113E18GGGTGGGCCCCACCTGNONE 
J033133E03GGGTGGGCCCCACCTGNONE 
J065059J15GGGTGGGCCCCACCTGNONE 
J065075O11GGGTGGGCCCCACCTGNONE 
J065119I07GGGTGGGCCCCACCTGNONE 
J065171J03GGGTGGGCCCCACCTGNONE 
J090016D21GGGTGGGCCCCACCTGNONE 
J090081O03GGGTGGGCCCCACCTGNONE 
J100040G18GGGTGGGCCCCACCTGNONE 
J100040L10GGGTGGGCCCCACCTGNONE 
J100055H13GGGTGGGCCCCACCTGNONE 
J100059I22GGGTGGGCCCCACCTGNONE 
J100078A08GGGTGGGCCCCACCTGNONE 
Os03g0844000AK059033GGGGCCCAGCNONE 
AK065633GGGGCCCAGCProtein prenyltransferase domain containing protein. 
J013031L22GGGGCCCAGCNONE 
J065099H18GGGGCCCAGCNONE 
Os03g0844100AK067164TAATGGGCCCCACGTCTCSimilar to Pti1 kinase-like protein. 
Os03g0850100AK101126ACGTGGGGCCCACCTGNLI interacting factor domain containing protein. 
Os04g0127800AK105313GGACGGCCATGGGCCCCACCTGConserved hypothetical protein. 
Os04g0244800009-066-G06CGTGTGGGCCCCANONE 
011-024-D02CGTGTGGGCCCCANONE 
AK121488CGTGTGGGCCCCAHeavy metal transport/detoxification protein domain containing protein. 
J023095P14CGTGTGGGCCCCANONE 
J023150J09CGTGTGGGCCCCANONE 
J053097G24CGTGTGGGCCCCANONE 
J065001K24CGTGTGGGCCCCANONE 
J065009O13CGTGTGGGCCCCANONE 
J065076M12CGTGTGGGCCCCANONE 
J065081I15CGTGTGGGCCCCANONE 
J065105E10CGTGTGGGCCCCANONE 
J065106G04CGTGTGGGCCCCANONE 
J065123I12CGTGTGGGCCCCANONE 
J065137H16CGTGTGGGCCCCANONE 
J065151I11CGTGTGGGCCCCANONE 
J065164H06CGTGTGGGCCCCANONE 
J065173J07CGTGTGGGCCCCANONE 
J065196F02CGTGTGGGCCCCANONE 
J065198I17CGTGTGGGCCCCANONE 
J065206I11CGTGTGGGCCCCANONE 
J065216J02CGTGTGGGCCCCANONE 
J075076D10CGTGTGGGCCCCANONE 
J075098F06CGTGTGGGCCCCANONE 
J075115A20CGTGTGGGCCCCANONE 
J075184H05CGTGTGGGCCCCANONE 
J075193E17CGTGTGGGCCCCANONE 
J090014L09CGTGTGGGCCCCANONE 
J090015H16CGTGTGGGCCCCANONE 
J090024M04CGTGTGGGCCCCANONE 
J090062K08CGTGTGGGCCCCANONE 
J090082I08CGTGTGGGCCCCANONE 
Os04g0266400AK065632GTGGTGGGCCCCACCACNONE 
AK068202GTGGTGGGCCCCACCACSimilar to AHM2 (Fragment). 
AK072046GTGGTGGGCCCCACCACNONE 
AK105688GTGGTGGGCCCCACCACNONE 
Os04g0266900011-064-A07CTGGGGCCCACCNONE 
AK069447CTGGGGCCCACCBacterial transketolase family protein. 
J023019B19CTGGGGCCCACCNONE 
Os04g0282400AK120187GCTGGGCCCCACCSimilar to FPF1 protein-like (RAA1). 
J013034O10GCTGGGCCCCACCNONE 
J013071G20GCTGGGCCCCACCNONE 
Os04g0321700003-103-G02AGTGGGCCCCACCNONE 
AK068732AGTGGGCCCCACCSimilar to Serine carboxypeptidase I precursor (EC 3.4.16.5) (Carboxypeptidase C). 
AK099397AGTGGGCCCCACCNONE 
Os04g0382300AK071912AGTGGGCCCCACGNONE 
AK101795AGTGGGCCCCACGSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0387600009-148-E01CCCGTGGGGCCCACGCNONE 
009-148-E01GTGGGGGCCCACTCTNONE 
009-155-A11CCCGTGGGGCCCACGCNONE 
009-155-A11GTGGGGGCCCACTCTNONE 
009-175-F04CCCGTGGGGCCCACGCNONE 
009-175-F04GTGGGGGCCCACTCTNONE 
AK063862CCCGTGGGGCCCACGCConserved hypothetical protein. 
AK063862GTGGGGGCCCACTCTConserved hypothetical protein. 
J065035F12CCCGTGGGGCCCACGCNONE 
J065035F12GTGGGGGCCCACTCTNONE 
J065162C13CCCGTGGGGCCCACGCNONE 
J065162C13GTGGGGGCCCACTCTNONE 
J065169L19CCCGTGGGGCCCACGCNONE 
J065169L19GTGGGGGCCCACTCTNONE 
Os04g0390000AK067777CACGCCACTGACATCTGGGCCCCACCNONE 
AK067777TGTGGGCCCCCACNONE 
AK068713CACGCCACTGACATCTGGGCCCCACCNONE 
AK068713TGTGGGCCCCCACNONE 
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
AK098921TGTGGGCCCCCACSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0399300AK105282ATATGGGCCCCACACSimilar to Nudix hydrolase 13, mitochondrial precursor (EC 3.6.1.-) (AtNUDT13). 
Os04g0408900009-183-E05TGTGGGGCCCACANONE 
AK058627TGTGGGGCCCACASimilar to DNA-binding protein S1FA. 
J023014N01TGTGGGGCCCACANONE 
J023088K23TGTGGGGCCCACANONE 
J065086B17TGTGGGGCCCACANONE 
J065095F08TGTGGGGCCCACANONE 
J065119N11TGTGGGGCCCACANONE 
J100032H17TGTGGGGCCCACANONE 
Os04g0412900AK073418ATATGGGCCCCACASec23/Sec24 trunk region domain containing protein. 
AK073418TGTGGGCCCCACCACSec23/Sec24 trunk region domain containing protein. 
J033027C24ATATGGGCCCCACANONE 
J033027C24TGTGGGCCCCACCACNONE 
J033044C16ATATGGGCCCCACANONE 
J033044C16TGTGGGCCCCACCACNONE 
J090023G03ATATGGGCCCCACANONE 
J090023G03TGTGGGCCCCACCACNONE 
J090082C21ATATGGGCCCCACANONE 
J090082C21TGTGGGCCCCACCACNONE 
Os04g0432600AK058925CTGGGGCCCAAGConserved hypothetical protein. 
AK103967CTGGGGCCCAAGNONE 
AK121724CTGGGGCCCAAGNONE 
J033081P13CTGGGGCCCAAGNONE 
J033128L11CTGGGGCCCAAGNONE 
J065038G19CTGGGGCCCAAGNONE 
J065129A21CTGGGGCCCAAGNONE 
J065131P11CTGGGGCCCAAGNONE 
J065166I03CTGGGGCCCAAGNONE 
J065181L05CTGGGGCCCAAGNONE 
J100018I15CTGGGGCCCAAGNONE 
J100019H22CTGGGGCCCAAGNONE 
J100037O10CTGGGGCCCAAGNONE 
Os04g0456700009-080-F10CAGGTGGGCCCCACCCGNONE 
009-143-C10CAGGTGGGCCCCACCCGNONE 
AK065178CAGGTGGGCCCCACCCGSimilar to TMV induced protein 1-2. 
J013002D12CAGGTGGGCCCCACCCGNONE 
J065027N14CAGGTGGGCCCCACCCGNONE 
J065139E16CAGGTGGGCCCCACCCGNONE 
J065165D09CAGGTGGGCCCCACCCGNONE 
J065179D14CAGGTGGGCCCCACCCGNONE 
J065198C03CAGGTGGGCCCCACCCGNONE 
J065198L22CAGGTGGGCCCCACCCGNONE 
J075139M08CAGGTGGGCCCCACCCGNONE 
J075150D14CAGGTGGGCCCCACCCGNONE 
J075172F01CAGGTGGGCCCCACCCGNONE 
J075197F03CAGGTGGGCCCCACCCGNONE 
J090059E16CAGGTGGGCCCCACCCGNONE 
J100063J01CAGGTGGGCCCCACCCGNONE 
J100085F13CAGGTGGGCCCCACCCGNONE 
J100088O10CAGGTGGGCCCCACCCGNONE 
Os04g0462500006-073-E08TGTGGGCCCCACCNONE 
AK062065TGTGGGCCCCACCNONE 
AK071311TGTGGGCCCCACCSimilar to 14-3-3-like protein GF14-6. 
AK071822TGTGGGCCCCACCNONE 
AK099243TGTGGGCCCCACCNONE 
AK101938TGTGGGCCCCACCNONE 
J013056F02TGTGGGCCCCACCNONE 
J023020E08TGTGGGCCCCACCNONE 
J023085B16TGTGGGCCCCACCNONE 
J023117D08TGTGGGCCCCACCNONE 
J023133K12TGTGGGCCCCACCNONE 
J033025G04TGTGGGCCCCACCNONE 
J033052A15TGTGGGCCCCACCNONE 
J033074G16TGTGGGCCCCACCNONE 
J033090A16TGTGGGCCCCACCNONE 
J033122A07TGTGGGCCCCACCNONE 
J033133G09TGTGGGCCCCACCNONE 
J065002F16TGTGGGCCCCACCNONE 
J065030M09TGTGGGCCCCACCNONE 
J065056B11TGTGGGCCCCACCNONE 
J065115I10TGTGGGCCCCACCNONE 
J065120O09TGTGGGCCCCACCNONE 
J065124G21TGTGGGCCCCACCNONE 
J075031C14TGTGGGCCCCACCNONE 
J075040H07TGTGGGCCCCACCNONE 
J075047F04TGTGGGCCCCACCNONE 
J075065F14TGTGGGCCCCACCNONE 
J075066G20TGTGGGCCCCACCNONE 
J075105D01TGTGGGCCCCACCNONE 
J075147B04TGTGGGCCCCACCNONE 
J075149A12TGTGGGCCCCACCNONE 
J075172D07TGTGGGCCCCACCNONE 
J075190J11TGTGGGCCCCACCNONE 
J090038H18TGTGGGCCCCACCNONE 
J090087G05TGTGGGCCCCACCNONE 
J100025A10TGTGGGCCCCACCNONE 
J100025O10TGTGGGCCCCACCNONE 
J100027D02TGTGGGCCCCACCNONE 
J100027P06TGTGGGCCCCACCNONE 
J100032K04TGTGGGCCCCACCNONE 
J100056D21TGTGGGCCCCACCNONE 
J100060J08TGTGGGCCCCACCNONE 
J100063N19TGTGGGCCCCACCNONE 
J100064C14TGTGGGCCCCACCNONE 
J100064K18TGTGGGCCCCACCNONE 
J100070L21TGTGGGCCCCACCNONE 
J100072M17TGTGGGCCCCACCNONE 
J100074F21TGTGGGCCCCACCNONE 
J100087E05TGTGGGCCCCACCNONE 
U65956TGTGGGCCCCACCNONE 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0480900AK109889AGTTGGGCTTTGGGCCCCAGlycoside hydrolase, family 5 protein. 
Os04g0506300AK063591TCGTGGGCCCCACCCGTMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08TCGTGGGCCCCACCCGNONE 
Os04g0509600012-081-D04GGTGGGCCCCNONE 
AF001505GGTGGGCCCCNONE 
AK073718GGTGGGCCCCSimilar to Ammonium transporter Amt1;2 (Fragment). 
AK105667GGTGGGCCCCNONE 
AY569614GGTGGGCCCCNONE 
J033060L01GGTGGGCCCCNONE 
Os04g0512500AK107826TGGTGGGCCCCACCConserved hypothetical protein. 
J100049D17TGGTGGGCCCCACCNONE 
J100080K12TGGTGGGCCCCACCNONE 
Os04g0529400J013039I24CCTGGGCCCCCGCGNONE 
J013055M04CCTGGGCCCCCGCGNONE 
J023050E21CCTGGGCCCCCGCGNONE 
J033060K22CCTGGGCCCCCGCGNONE 
J075026D13CCTGGGCCCCCGCGNONE 
J075033M03CCTGGGCCCCCGCGNONE 
J075138F11CCTGGGCCCCCGCGNONE 
J090022B15CCTGGGCCCCCGCGNONE 
Os04g0547600AK109141GGGGCCCAAGPathogenesis-related transcriptional factor and ERF domain containing protein. 
AY339379GGGGCCCAAGNONE 
J065112J12GGGGCCCAAGNONE 
Os04g0559400AK106376AGATGGGCCCCACCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0574100006-087-B01GGATGGGCCCCGCGTCGCNONE 
AK061150GGATGGGCCCCGCGTCGCNONE 
AK069178GGATGGGCCCCGCGTCGCExostosin-like family protein. 
AK121041GGATGGGCCCCGCGTCGCNONE 
J023008D04GGATGGGCCCCGCGTCGCNONE 
J023052A13GGATGGGCCCCGCGTCGCNONE 
J065046P18GGATGGGCCCCGCGTCGCNONE 
J065105D10GGATGGGCCCCGCGTCGCNONE 
Os04g0580700AF095646GCTGGGCCCCNONE 
AK070540GCTGGGCCCCNONE 
AY551918GCTGGGCCCCMADS box transcription factor MADS17. 
J023057B01GCTGGGCCCCNONE 
Os04g0585100012-055-B08GTGGGGCCCACCNONE 
AK105286GTGGGGCCCACCZinc finger, DHHC-type domain containing protein. 
Os04g0591000006-090-E02ATTGGGCCCCANONE 
AK072902ATTGGGCCCCARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065061E23ATTGGGCCCCANONE 
Os04g0606800009-159-H11GTGGGGCCCACAAGTCAGTGGNONE 
AK072824GTGGGGCCCACAAGTCAGTGGConserved hypothetical protein. 
J033070J06GTGGGGCCCACAAGTCAGTGGNONE 
J033119D03GTGGGGCCCACAAGTCAGTGGNONE 
J100043F05GTGGGGCCCACAAGTCAGTGGNONE 
J100050A01GTGGGGCCCACAAGTCAGTGGNONE 
Os04g0608300AK111353AGGTGGGCCCCACACGalactokinase family protein. 
Os04g0617050J065197A20GCTGGGCCCCACNONE 
J065197A20TGTGGGGCCCATGNONE 
J090067K01GCTGGGCCCCACAuxin responsive SAUR protein family protein. 
J090067K01TGTGGGGCCCATGAuxin responsive SAUR protein family protein. 
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase). 
J013126M17AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J013131A08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J023133N08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
Os04g0652900AK071125GTGGGGCCCACGGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03GTGGGGCCCACGGNONE 
J075142E01GTGGGGCCCACGGNONE 
Os04g0653100014-075-B07GGGGCCCACCCNONE 
016-077-E05GGGGCCCACCCNONE 
AK067094GGGGCCCACCCProtein of unknown function UPF0136, Transmembrane family protein. 
AK111420GGGGCCCACCCNONE 
J013098P05GGGGCCCACCCNONE 
J075001K22GGGGCCCACCCNONE 
J075198O04GGGGCCCACCCNONE 
Os04g0661300AK070723CCCACGGGGCCCACACConserved hypothetical protein. 
AK103942CCCACGGGGCCCACACNONE 
Os04g0669600AK110767GGGGCCCAGGCCCAAAAPhospholipase/Carboxylesterase family protein. 
J065195K10GGGGCCCAGGCCCAAAANONE 
Os04g0673300006-055-C10CGTGTGGGTGTGGGCCCCACCCGNONE 
AK059734CGTGTGGGTGTGGGCCCCACCCGSimilar to ZmRR2 protein (Response regulator 2). 
J065006D12CGTGTGGGTGTGGGCCCCACCCGNONE 
J065218N11CGTGTGGGTGTGGGCCCCACCCGNONE 
Os04g0674600AK069645TGTGGGGCCCAGAOligopeptide transporter OPT superfamily protein. 
Os04g0678200006-037-E05GGGGCCCACGCGTNONE 
006-059-G04GGGGCCCACGCGTNONE 
006-097-A11GGGGCCCACGCGTNONE 
006-098-D11GGGGCCCACGCGTNONE 
009-154-H11GGGGCCCACGCGTNONE 
AK106193GGGGCCCACGCGTProtein of unknown function DUF1218 family protein. 
J013064K07GGGGCCCACGCGTNONE 
Os04g0679800AK060662CCGTGGGCCCCACGSimilar to RNA-binding protein-like protein. 
AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein. 
AK060662GACAGGTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK099987CCGTGGGCCCCACGNONE 
AK099987CTTGGGCCCCACCTGTCAGTNONE 
AK099987GACAGGTGGGCCCCACCNONE 
J013130B11CCGTGGGCCCCACGNONE 
J013130B11CTTGGGCCCCACCTGTCAGTNONE 
J013130B11GACAGGTGGGCCCCACCNONE 
J065049C17CCGTGGGCCCCACGNONE 
J065049C17CTTGGGCCCCACCTGTCAGTNONE 
J065049C17GACAGGTGGGCCCCACCNONE 
J075191N12CCGTGGGCCCCACGNONE 
J075191N12CTTGGGCCCCACCTGTCAGTNONE 
J075191N12GACAGGTGGGCCCCACCNONE 
J075191P12CCGTGGGCCCCACGNONE 
J075191P12CTTGGGCCCCACCTGTCAGTNONE 
J075191P12GACAGGTGGGCCCCACCNONE 
J100031C07CCGTGGGCCCCACGNONE 
J100031C07CTTGGGCCCCACCTGTCAGTNONE 
J100031C07GACAGGTGGGCCCCACCNONE 
Os05g0101400009-126-G06ATATGGGCCCCNONE 
AK067481ATATGGGCCCCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
J065124O10ATATGGGCCCCNONE 
J065186D05ATATGGGCCCCNONE 
J065193A14ATATGGGCCCCNONE 
J075082A02ATATGGGCCCCNONE 
J075100F11ATATGGGCCCCNONE 
J075111O16ATATGGGCCCCNONE 
J075172I24ATATGGGCCCCNONE 
Os05g0102500009-183-E08GGGGCCCACCCNONE 
AK063894GGGGCCCACCCNONE 
AK073341GGGGCCCACCCConserved hypothetical protein. 
J023022C11GGGGCCCACCCNONE 
J065095B14GGGGCCCACCCNONE 
J065130O12GGGGCCCACCCNONE 
J065142P07GGGGCCCACCCNONE 
J065155L18GGGGCCCACCCNONE 
Os05g0103100AK103317GGGGCCCATGTTranslocon-associated beta family protein. 
J033125H15GGGGCCCATGTNONE 
J065021L01GGGGCCCATGTNONE 
J065029M01GGGGCCCATGTNONE 
J065089F17GGGGCCCATGTNONE 
J065112N04GGGGCCCATGTNONE 
J065163L03GGGGCCCATGTNONE 
J065175B04GGGGCCCATGTNONE 
J065192E02GGGGCCCATGTNONE 
J075046C20GGGGCCCATGTNONE 
J075192A01GGGGCCCATGTNONE 
J100018H13GGGGCCCATGTNONE 
J100067K20GGGGCCCATGTNONE 
J100080N03GGGGCCCATGTNONE 
Os05g0110900AK073169AGTGGGCCCCACASimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os05g0111200009-033-A06CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
AK101693CGGACGGCGCGGGTGGGTGGGCCCCACASimilar to Amino acid selective channel protein. 
J065006E13CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075001D12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075005J18CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075009L08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075012M21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075019K17CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075020D07CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075041D11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075051C03CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075060C05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075079N09CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075094B04CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075108E08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075115G05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075147L21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075161G12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168J11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168L11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075174F22CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
Os05g0112101J065141G20TGGGGCCCAGTEpsin, N-terminal domain containing protein. 
Os05g0113000AK067079TGTGGGCCCCACCTGAmino acid-binding ACT domain containing protein. 
Os05g0116100006-049-G01CCTGGGCCCCACANONE 
006-064-F09CCTGGGCCCCACANONE 
006-082-A03CCTGGGCCCCACANONE 
006-092-G06CCTGGGCCCCACANONE 
006-102-F09CCTGGGCCCCACANONE 
AB037970CCTGGGCCCCACANONE 
AK061836CCTGGGCCCCACANONE 
AK070895CCTGGGCCCCACADehydroascorbate reductase. 
AY074786CCTGGGCCCCACANONE 
J013022K21CCTGGGCCCCACANONE 
J013154A03CCTGGGCCCCACANONE 
J023074C02CCTGGGCCCCACANONE 
J023091I19CCTGGGCCCCACANONE 
J023135M05CCTGGGCCCCACANONE 
J065027L11CCTGGGCCCCACANONE 
J065065A08CCTGGGCCCCACANONE 
J065120A08CCTGGGCCCCACANONE 
J065174A05CCTGGGCCCCACANONE 
J065184O22CCTGGGCCCCACANONE 
J065191D07CCTGGGCCCCACANONE 
J065209D04CCTGGGCCCCACANONE 
J075014F11CCTGGGCCCCACANONE 
J075036D03CCTGGGCCCCACANONE 
J075157D23CCTGGGCCCCACANONE 
J080007F15CCTGGGCCCCACANONE 
J080008N12CCTGGGCCCCACANONE 
J080010F22CCTGGGCCCCACANONE 
J080011C19CCTGGGCCCCACANONE 
J080011F12CCTGGGCCCCACANONE 
J080012E11CCTGGGCCCCACANONE 
J080015B12CCTGGGCCCCACANONE 
J080015O16CCTGGGCCCCACANONE 
J080016G24CCTGGGCCCCACANONE 
J080016K13CCTGGGCCCCACANONE 
J080018A02CCTGGGCCCCACANONE 
J080018H03CCTGGGCCCCACANONE 
J080022M01CCTGGGCCCCACANONE 
J080023D20CCTGGGCCCCACANONE 
J080023I01CCTGGGCCCCACANONE 
J080023J05CCTGGGCCCCACANONE 
J080024A09CCTGGGCCCCACANONE 
J080024I09CCTGGGCCCCACANONE 
J080025A10CCTGGGCCCCACANONE 
J080025G04CCTGGGCCCCACANONE 
J080027D21CCTGGGCCCCACANONE 
J080029M05CCTGGGCCCCACANONE 
J080030J01CCTGGGCCCCACANONE 
J080034D10CCTGGGCCCCACANONE 
J080036F18CCTGGGCCCCACANONE 
J080038N11CCTGGGCCCCACANONE 
J080039B07CCTGGGCCCCACANONE 
J080039E01CCTGGGCCCCACANONE 
J080039K11CCTGGGCCCCACANONE 
J080040B09CCTGGGCCCCACANONE 
J080040G11CCTGGGCCCCACANONE 
J080041H08CCTGGGCCCCACANONE 
J080041H19CCTGGGCCCCACANONE 
J080041O20CCTGGGCCCCACANONE 
J080042C15CCTGGGCCCCACANONE 
J080043C16CCTGGGCCCCACANONE 
J080043F18CCTGGGCCCCACANONE 
J080044B17CCTGGGCCCCACANONE 
J080044N10CCTGGGCCCCACANONE 
J080044O07CCTGGGCCCCACANONE 
J080045H15CCTGGGCCCCACANONE 
J080045I03CCTGGGCCCCACANONE 
J080046A05CCTGGGCCCCACANONE 
J080048I06CCTGGGCCCCACANONE 
J080049L04CCTGGGCCCCACANONE 
J080049M09CCTGGGCCCCACANONE 
J080050G11CCTGGGCCCCACANONE 
J080051G20CCTGGGCCCCACANONE 
J080053C09CCTGGGCCCCACANONE 
J080053I05CCTGGGCCCCACANONE 
J080053P18CCTGGGCCCCACANONE 
J080054K10CCTGGGCCCCACANONE 
J080054P14CCTGGGCCCCACANONE 
J080057L05CCTGGGCCCCACANONE 
J080062K11CCTGGGCCCCACANONE 
J080063C19CCTGGGCCCCACANONE 
J080065B03CCTGGGCCCCACANONE 
J080066E15CCTGGGCCCCACANONE 
J080066H05CCTGGGCCCCACANONE 
J080066I05CCTGGGCCCCACANONE 
J080068O11CCTGGGCCCCACANONE 
J080070L22CCTGGGCCCCACANONE 
J080071I12CCTGGGCCCCACANONE 
J080071N20CCTGGGCCCCACANONE 
J080072D10CCTGGGCCCCACANONE 
J080072I10CCTGGGCCCCACANONE 
J080074G03CCTGGGCCCCACANONE 
J080076E23CCTGGGCCCCACANONE 
J080076N03CCTGGGCCCCACANONE 
J080077N23CCTGGGCCCCACANONE 
J080084B13CCTGGGCCCCACANONE 
J080084F07CCTGGGCCCCACANONE 
J080085J15CCTGGGCCCCACANONE 
J080085P20CCTGGGCCCCACANONE 
J080090F21CCTGGGCCCCACANONE 
J080093H16CCTGGGCCCCACANONE 
J080093J01CCTGGGCCCCACANONE 
J080093L04CCTGGGCCCCACANONE 
J080097E24CCTGGGCCCCACANONE 
J090012G04CCTGGGCCCCACANONE 
J090054K05CCTGGGCCCCACANONE 
Os05g0119000AK069359GCGTGGGCCCCACCConserved hypothetical protein 245 family protein. 
J065020A09GCGTGGGCCCCACCNONE 
J065043F11GCGTGGGCCCCACCNONE 
J065182D16GCGTGGGCCCCACCNONE 
J065211L04GCGTGGGCCCCACCNONE 
Os05g0119300004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
004-011-B09GCTGGGCCCCACGCGNONE 
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-063-A03GCTGGGCCCCACGCGNONE 
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-077-E12GCTGGGCCCCACGCGNONE 
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-079-E12GCTGGGCCCCACGCGNONE 
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-100-B11GCTGGGCCCCACGCGNONE 
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-109-A12GCTGGGCCCCACGCGNONE 
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-123-C07GCTGGGCCCCACGCGNONE 
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-163-D09GCTGGGCCCCACGCGNONE 
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-170-D11GCTGGGCCCCACGCGNONE 
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-173-C01GCTGGGCCCCACGCGNONE 
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-192-E01GCTGGGCCCCACGCGNONE 
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
011-048-G01GCTGGGCCCCACGCGNONE 
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK060883GCTGGGCCCCACGCGNONE 
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK068289GCTGGGCCCCACGCGNONE 
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK071554GCTGGGCCCCACGCGNONE 
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein. 
AK099495GCTGGGCCCCACGCGXYPPX repeat containing protein. 
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AY348312GCTGGGCCCCACGCGNONE 
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013037L16GCTGGGCCCCACGCGNONE 
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013088P04GCTGGGCCCCACGCGNONE 
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013099D14GCTGGGCCCCACGCGNONE 
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013146E19GCTGGGCCCCACGCGNONE 
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013147E18GCTGGGCCCCACGCGNONE 
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023104E19GCTGGGCCCCACGCGNONE 
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023128O20GCTGGGCCCCACGCGNONE 
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023132D16GCTGGGCCCCACGCGNONE 
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023143E13GCTGGGCCCCACGCGNONE 
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033028F15GCTGGGCCCCACGCGNONE 
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033133D24GCTGGGCCCCACGCGNONE 
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J053091M07GCTGGGCCCCACGCGNONE 
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075029L15GCTGGGCCCCACGCGNONE 
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075097M12GCTGGGCCCCACGCGNONE 
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075103J11GCTGGGCCCCACGCGNONE 
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075138J10GCTGGGCCCCACGCGNONE 
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075172K18GCTGGGCCCCACGCGNONE 
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080001C15GCTGGGCCCCACGCGNONE 
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080002M13GCTGGGCCCCACGCGNONE 
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080009K01GCTGGGCCCCACGCGNONE 
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080010N01GCTGGGCCCCACGCGNONE 
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080011D23GCTGGGCCCCACGCGNONE 
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013C13GCTGGGCCCCACGCGNONE 
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013M16GCTGGGCCCCACGCGNONE 
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080018J02GCTGGGCCCCACGCGNONE 
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020F03GCTGGGCCCCACGCGNONE 
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020G05GCTGGGCCCCACGCGNONE 
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080021D05GCTGGGCCCCACGCGNONE 
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080030A19GCTGGGCCCCACGCGNONE 
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080031A16GCTGGGCCCCACGCGNONE 
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080033J23GCTGGGCCCCACGCGNONE 
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080035H07GCTGGGCCCCACGCGNONE 
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080039M24GCTGGGCCCCACGCGNONE 
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080042B16GCTGGGCCCCACGCGNONE 
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080043B03GCTGGGCCCCACGCGNONE 
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045G01GCTGGGCCCCACGCGNONE 
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045K17GCTGGGCCCCACGCGNONE 
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047A09GCTGGGCCCCACGCGNONE 
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047I22GCTGGGCCCCACGCGNONE 
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080048M14GCTGGGCCCCACGCGNONE 
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080049J02GCTGGGCCCCACGCGNONE 
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052C15GCTGGGCCCCACGCGNONE 
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052E11GCTGGGCCCCACGCGNONE 
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052M22GCTGGGCCCCACGCGNONE 
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080056O21GCTGGGCCCCACGCGNONE 
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059J04GCTGGGCCCCACGCGNONE 
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059O17GCTGGGCCCCACGCGNONE 
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080064N04GCTGGGCCCCACGCGNONE 
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066A03GCTGGGCCCCACGCGNONE 
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066I22GCTGGGCCCCACGCGNONE 
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069C13GCTGGGCCCCACGCGNONE 
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069J03GCTGGGCCCCACGCGNONE 
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069N04GCTGGGCCCCACGCGNONE 
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071A01GCTGGGCCCCACGCGNONE 
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071C03GCTGGGCCCCACGCGNONE 
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071J02GCTGGGCCCCACGCGNONE 
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080080D17GCTGGGCCCCACGCGNONE 
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080084O06GCTGGGCCCCACGCGNONE 
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080085O20GCTGGGCCCCACGCGNONE 
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080086H15GCTGGGCCCCACGCGNONE 
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080094K06GCTGGGCCCCACGCGNONE 
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095C05GCTGGGCCCCACGCGNONE 
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095G04GCTGGGCCCCACGCGNONE 
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F03GCTGGGCCCCACGCGNONE 
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F20GCTGGGCCCCACGCGNONE 
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090004H05GCTGGGCCCCACGCGNONE 
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090012P10GCTGGGCCCCACGCGNONE 
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090021B09GCTGGGCCCCACGCGNONE 
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090034M08GCTGGGCCCCACGCGNONE 
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090046G21GCTGGGCCCCACGCGNONE 
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055K24GCTGGGCCCCACGCGNONE 
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055L05GCTGGGCCCCACGCGNONE 
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090057H17GCTGGGCCCCACGCGNONE 
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090082K21GCTGGGCCCCACGCGNONE 
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022A07GCTGGGCCCCACGCGNONE 
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022M02GCTGGGCCCCACGCGNONE 
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100069K11GCTGGGCCCCACGCGNONE 
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100086C24GCTGGGCCCCACGCGNONE 
Os05g0137400AK065206CCACTGACATGTGGGCCCCACCTGSimilar to Aspartic protease precursor. 
D12777CCACTGACATGTGGGCCCCACCTGNONE 
J013002F13CCACTGACATGTGGGCCCCACCTGNONE 
J013029I15CCACTGACATGTGGGCCCCACCTGNONE 
J013033A10CCACTGACATGTGGGCCCCACCTGNONE 
J013035H24CCACTGACATGTGGGCCCCACCTGNONE 
J013051H21CCACTGACATGTGGGCCCCACCTGNONE 
J013098H05CCACTGACATGTGGGCCCCACCTGNONE 
J023060B04CCACTGACATGTGGGCCCCACCTGNONE 
J023130D23CCACTGACATGTGGGCCCCACCTGNONE 
J033140N08CCACTGACATGTGGGCCCCACCTGNONE 
J053039L22CCACTGACATGTGGGCCCCACCTGNONE 
J080007K21CCACTGACATGTGGGCCCCACCTGNONE 
Os05g0148600003-016-C11CGGGTGGGCCCCACACACACCNONE 
AK066168CGGGTGGGCCCCACACACACCNONE 
AK104336CGGGTGGGCCCCACACACACCSimilar to Na+/H+ antiporter. 
AY360145CGGGTGGGCCCCACACACACCNONE 
J013055J22CGGGTGGGCCCCACACACACCNONE 
J013057M24CGGGTGGGCCCCACACACACCNONE 
J013074N03CGGGTGGGCCCCACACACACCNONE 
J013158A22CGGGTGGGCCCCACACACACCNONE 
J075118H09CGGGTGGGCCCCACACACACCNONE 
Os05g0163700AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0164100AF456329CCCCCGCGTGGGCCCCACCCGNONE 
AF456329CGGGTGGGGCCCACCCGNONE 
AF456329CGTGTGGGCCCCACGNONE 
AK065086CCCCCGCGTGGGCCCCACCCGNONE 
AK065086CGGGTGGGGCCCACCCGNONE 
AK065086CGTGTGGGCCCCACGNONE 
AK072243CCCCCGCGTGGGCCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
AK072243CGGGTGGGGCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
AK072243CGTGTGGGCCCCACGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CCCCCGCGTGGGCCCCACCCGNONE 
J013001L18CGGGTGGGGCCCACCCGNONE 
J013001L18CGTGTGGGCCCCACGNONE 
J013132O12CCCCCGCGTGGGCCCCACCCGNONE 
J013132O12CGGGTGGGGCCCACCCGNONE 
J013132O12CGTGTGGGCCCCACGNONE 
J023003N09CCCCCGCGTGGGCCCCACCCGNONE 
J023003N09CGGGTGGGGCCCACCCGNONE 
J023003N09CGTGTGGGCCCCACGNONE 
Os05g0194550J075140P14GGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os05g0195200015-031-H09TGTGGGCCCCCACNONE 
015-070-C11TGTGGGCCCCCACNONE 
016-063-C11TGTGGGCCCCCACNONE 
AK106392TGTGGGCCCCCACZinc finger, CCCH-type domain containing protein. 
J033051N05TGTGGGCCCCCACNONE 
J065118P05TGTGGGCCCCCACNONE 
J100071H15TGTGGGCCCCCACNONE 
J100078J22TGTGGGCCCCCACNONE 
Os05g0198000J080004C03TGTGGGCCCCACProtein of unknown function DUF247, plant family protein. 
J080004M24TGTGGGCCCCACNONE 
J080004O15TGTGGGCCCCACNONE 
J080006E14TGTGGGCCCCACNONE 
J080006I07TGTGGGCCCCACNONE 
J080007N13TGTGGGCCCCACNONE 
J080009C21TGTGGGCCCCACNONE 
J080009L03TGTGGGCCCCACNONE 
J080010F10TGTGGGCCCCACNONE 
J080015H04TGTGGGCCCCACNONE 
J080015L04TGTGGGCCCCACNONE 
J080018C21TGTGGGCCCCACNONE 
J080022M22TGTGGGCCCCACNONE 
J080027O19TGTGGGCCCCACNONE 
J080030I07TGTGGGCCCCACNONE 
J080037P07TGTGGGCCCCACNONE 
J080044C18TGTGGGCCCCACNONE 
J080049F14TGTGGGCCCCACNONE 
J080050F04TGTGGGCCCCACNONE 
J080052B18TGTGGGCCCCACNONE 
J080081B11TGTGGGCCCCACNONE 
J080083G12TGTGGGCCCCACNONE 
J080086A11TGTGGGCCCCACNONE 
J080087C06TGTGGGCCCCACNONE 
J080088E06TGTGGGCCCCACNONE 
J080091O21TGTGGGCCCCACNONE 
J080094N23TGTGGGCCCCACNONE 
Os05g0213500003-114-G10GGGTGGGCCCCACCACNONE 
AK065280GGGTGGGCCCCACCACConserved hypothetical protein. 
J013002L23GGGTGGGCCCCACCACNONE 
J023056H04GGGTGGGCCCCACCACNONE 
J075051G09GGGTGGGCCCCACCACNONE 
J075139N23GGGTGGGCCCCACCACNONE 
J100031B01GGGTGGGCCCCACCACNONE 
J100075M20GGGTGGGCCCCACCACNONE 
Os05g0217000AK062517GGTGGGGCCCACCProtein of unknown function DUF1070 family protein. 
J075142D02GGTGGGGCCCACCNONE 
Os05g0220600AK073669AGTGGGCCCCCACRhomboid-like protein family protein. 
J033052F18AGTGGGCCCCCACNONE 
J065109N23AGTGGGCCCCCACNONE 
J100037H15AGTGGGCCCCCACNONE 
J100048E14AGTGGGCCCCCACNONE 
Os05g0243200009-073-F12GGGGCCCAAAANONE 
AK061317GGGGCCCAAAASimilar to Ribosomal protein L13. 
J065120F21GGGGCCCAAAANONE 
J065185K05GGGGCCCAAAANONE 
Os05g0320700AK100598TGTGGGCCCCACATCCCCCACACSimilar to Cytochrome P450. 
AK104994TGTGGGCCCCACATCCCCCACACNONE 
Os05g0342100AK111106TGTGGGCCCCACCWound-induced WI12 family protein. 
Os05g0357200014-046-H09GCCCCACGTGGGCCCCACGCCTCNONE 
014-046-H09TCGTGGGCCCCACGGCCNONE 
AK064069GCCCCACGTGGGCCCCACGCCTCNONE 
AK064069TCGTGGGCCCCACGGCCNONE 
AK072064GCCCCACGTGGGCCCCACGCCTCMitochondrial substrate carrier family protein. 
AK072064TCGTGGGCCCCACGGCCMitochondrial substrate carrier family protein. 
J065038M01GCCCCACGTGGGCCCCACGCCTCNONE 
J065038M01TCGTGGGCCCCACGGCCNONE 
J065121C16GCCCCACGTGGGCCCCACGCCTCNONE 
J065121C16TCGTGGGCCCCACGGCCNONE 
J075173E09GCCCCACGTGGGCCCCACGCCTCNONE 
J075173E09TCGTGGGCCCCACGGCCNONE 
J080307A20GCCCCACGTGGGCCCCACGCCTCNONE 
J080307A20TCGTGGGCCCCACGGCCNONE 
J090046B19GCCCCACGTGGGCCCCACGCCTCNONE 
J090046B19TCGTGGGCCCCACGGCCNONE 
J100033N12GCCCCACGTGGGCCCCACGCCTCNONE 
J100033N12TCGTGGGCCCCACGGCCNONE 
J100036G01GCCCCACGTGGGCCCCACGCCTCNONE 
J100036G01TCGTGGGCCCCACGGCCNONE 
J100057B19GCCCCACGTGGGCCCCACGCCTCNONE 
J100057B19TCGTGGGCCCCACGGCCNONE 
Os05g0358000006-083-G07CCCGTGGGCCCCACCNONE 
AK061141CCCGTGGGCCCCACCNONE 
AK070900CCCGTGGGCCCCACCNONE 
AK101263CCCGTGGGCCCCACCDrought induced 19 family protein. 
J023098C13CCCGTGGGCCCCACCNONE 
J033032J06CCCGTGGGCCCCACCNONE 
J065014A09CCCGTGGGCCCCACCNONE 
J065121L01CCCGTGGGCCCCACCNONE 
J065130K19CCCGTGGGCCCCACCNONE 
J065208B21CCCGTGGGCCCCACCNONE 
J075080G14CCCGTGGGCCCCACCNONE 
J075135L01CCCGTGGGCCCCACCNONE 
J075180J15CCCGTGGGCCCCACCNONE 
Os05g0380900AK067214CAGGTGGGCCCCACCTGTCAGSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK099962CAGGTGGGCCCCACCTGTCAGNONE 
J065083M07CAGGTGGGCCCCACCTGTCAGNONE 
Os05g0386900AK071425GCTGGGCCCCACCCGNONE 
AK073634GCTGGGCCCCACCCGReticulon family protein. 
Os05g0392801J090025K15GTGGGACCCACGTGGGCCCCACGTConserved hypothetical protein. 
J090053E06GTGGGACCCACGTGGGCCCCACGTNONE 
Os05g0397300009-051-E02GGGGCCCACGGCCNONE 
009-051-E02TTCGTGGGGCCCACGANONE 
009-060-E03GGGGCCCACGGCCNONE 
009-060-E03TTCGTGGGGCCCACGANONE 
009-075-B01GGGGCCCACGGCCNONE 
009-075-B01TTCGTGGGGCCCACGANONE 
009-082-B11GGGGCCCACGGCCNONE 
009-082-B11TTCGTGGGGCCCACGANONE 
009-136-D05GGGGCCCACGGCCNONE 
009-136-D05TTCGTGGGGCCCACGANONE 
AK062621GGGGCCCACGGCCNONE 
AK062621TTCGTGGGGCCCACGANONE 
AK066003GGGGCCCACGGCCNONE 
AK066003TTCGTGGGGCCCACGANONE 
AK070832GGGGCCCACGGCCConserved hypothetical protein. 
AK070832TTCGTGGGGCCCACGAConserved hypothetical protein. 
J023066C05GGGGCCCACGGCCNONE 
J023066C05TTCGTGGGGCCCACGANONE 
Os05g0406100AK070068GGGGCCCACCACNONE 
J023041D03GGGGCCCACCACNONE 
Os05g0407500AK074026GTGGGGGCCCACCTEsterase/lipase/thioesterase domain containing protein. 
Os05g0411300014-098-D05ACGTGGGCCCCACGTGTCNONE 
015-093-F04ACGTGGGCCCCACGTGTCNONE 
AK071931ACGTGGGCCCCACGTGTCConserved hypothetical protein. 
AK073142ACGTGGGCCCCACGTGTCNONE 
Os05g0415400AK107330CAGGTGGGGCCCAACTSimilar to OsNAC6 protein. 
AK119651CAGGTGGGGCCCAACTNONE 
Os05g0423500015-048-C11AGGTGGGCCCCACCTGTCNONE 
AK066000AGGTGGGCCCCACCTGTCProtein kinase-like domain containing protein. 
J013049L02AGGTGGGCCCCACCTGTCNONE 
Os05g0429700AK069203TCGTGGGCCCCACCACNONE 
AK103559TCGTGGGCCCCACCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0454400AK107942GCGTGGGCCCCACAConserved hypothetical protein. 
Os05g0460000011-074-F09GGGGCCCACCAACGCGTCCNONE 
J023002L01GGGGCCCACCAACGCGTCCNONE 
J023060I12GGGGCCCACCAACGCGTCCNONE 
J023060O12GGGGCCCACCAACGCGTCCNONE 
J023106P08GGGGCCCACCAACGCGTCCNONE 
J023141D17GGGGCCCACCAACGCGTCCNONE 
J023150E11GGGGCCCACCAACGCGTCCSimilar to 70 kDa heat shock cognate protein 1. 
J033030A20GGGGCCCACCAACGCGTCCNONE 
J033039H14GGGGCCCACCAACGCGTCCNONE 
J033101B11GGGGCCCACCAACGCGTCCNONE 
J033101B12GGGGCCCACCAACGCGTCCNONE 
J033114A09GGGGCCCACCAACGCGTCCNONE 
J090037G06GGGGCCCACCAACGCGTCCNONE 
J090048G13GGGGCCCACCAACGCGTCCNONE 
J090090F15GGGGCCCACCAACGCGTCCNONE 
Os05g0461300AK111917AATTGGGCCCCACTCCSimilar to RAB8C. 
AK111946AATTGGGCCCCACTCCNONE 
AK111972AATTGGGCCCCACTCCNONE 
AK112021AATTGGGCCCCACTCCNONE 
J033135H16AATTGGGCCCCACTCCNONE 
J043036O11AATTGGGCCCCACTCCNONE 
Os05g0463400AK100354CCGTGGGCCCCACAPWWP domain containing protein. 
J013022B18CCGTGGGCCCCACANONE 
J023083G23CCGTGGGCCCCACANONE 
Os05g0473300AK102559TGTGGGCCCCACGCCTCNONE 
AK103822TGTGGGCCCCACGCCTCNONE 
AK109855TGTGGGCCCCACGCCTCSimilar to Ethylene response factor 1. 
Os05g0487600AK100817TGTGGGGCCCACGTGNONE 
AK103104TGTGGGGCCCACGTGNONE 
J043027P10TGTGGGGCCCACGTGNONE 
J065183N17TGTGGGGCCCACGTGNONE 
Os05g0494100AK068320GGTGGGGCCCACAAHistone-fold domain containing protein. 
Os05g0509400AK108053CAAGTGGGCCCCACASimilar to DNA binding protein-like. 
Os05g0519700014-100-B04TCGTGGGCCCCACANONE 
AF332981TCGTGGGCCCCACANONE 
AK100903TCGTGGGCCCCACANONE 
AK105433TCGTGGGCCCCACAHeat shock protein 101. 
Os05g0529300AK102648AGTGGGCCCCACGSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06CGTGGGGCCCACTNONE 
AK063846CGTGGGGCCCACTConserved hypothetical protein. 
AK122038CGTGGGGCCCACTNONE 
J033113C01CGTGGGGCCCACTNONE 
Os05g0533600AK067577GGTGGGGCCCAGASimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560GGTGGGGCCCAGANONE 
AY373258GGTGGGGCCCAGANONE 
Os05g0543700AK071113GGTGGGGCCCAGCCSimilar to Chaperone protein dnaJ. 
AK103912GGTGGGGCCCAGCCNONE 
Os05g0553400AK108452CTGGGGCCCAACCSimilar to Myb-related transcription factor-like protein (MYB transcription factor). 
Os05g0557200AK062090CGTGTGGGGCCCACGCGNONE 
AK102111CGTGTGGGGCCCACGCGArmadillo-like helical domain containing protein. 
J013047E13CGTGTGGGGCCCACGCGNONE 
J013089P04CGTGTGGGGCCCACGCGNONE 
J013130H17CGTGTGGGGCCCACGCGNONE 
J013132C20CGTGTGGGGCCCACGCGNONE 
J023001E06CGTGTGGGGCCCACGCGNONE 
J023108C09CGTGTGGGGCCCACGCGNONE 
J023125C12CGTGTGGGGCCCACGCGNONE 
J033023O10CGTGTGGGGCCCACGCGNONE 
J033033K16CGTGTGGGGCCCACGCGNONE 
J033064C11CGTGTGGGGCCCACGCGNONE 
J033071P07CGTGTGGGGCCCACGCGNONE 
J033072H14CGTGTGGGGCCCACGCGNONE 
J033084F06CGTGTGGGGCCCACGCGNONE 
J033084H11CGTGTGGGGCCCACGCGNONE 
J033097C05CGTGTGGGGCCCACGCGNONE 
J043009E20CGTGTGGGGCCCACGCGNONE 
J053035M10CGTGTGGGGCCCACGCGNONE 
J053043J22CGTGTGGGGCCCACGCGNONE 
J053082K10CGTGTGGGGCCCACGCGNONE 
J053094N13CGTGTGGGGCCCACGCGNONE 
Os05g0568600009-024-B09GGTGGGGCCCACCTGTCNONE 
AK063781GGTGGGGCCCACCTGTCProtein of unknown function DUF1645 family protein. 
J080049H14GGTGGGGCCCACCTGTCNONE 
J080062M08GGTGGGGCCCACCTGTCNONE 
J080064I07GGTGGGGCCCACCTGTCNONE 
J080068A12GGTGGGGCCCACCTGTCNONE 
J080086J10GGTGGGGCCCACCTGTCNONE 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os05g0583400AK101992TGTGGGGCCCACGTGGGTCCCACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit). 
Os05g0585900AK062575GACAGGTGGGCCCCMitochondrial substrate carrier family protein. 
AK098854GACAGGTGGGCCCCNONE 
J013000H16GACAGGTGGGCCCCNONE 
J033118D07GACAGGTGGGCCCCNONE 
Os05g0595300011-076-H02GGGGCCCACACGCCACNONE 
012-009-E07GGGGCCCACACGCCACNONE 
012-096-B01GGGGCCCACACGCCACNONE 
AK059614GGGGCCCACACGCCACNONE 
AK121601GGGGCCCACACGCCACSimilar to CONSTANS-like protein. 
J033040P21GGGGCCCACACGCCACNONE 
Os06g0105900AK072638ACTGGGCCCCACACConserved hypothetical protein. 
Os06g0115200J100029D05CCACTGACATGTGGGCCCCACGNONE 
J100029D05TGTGGGGCCCACACNONE 
J100048P05CCACTGACATGTGGGCCCCACGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
J100048P05TGTGGGGCCCACACQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0124900009-128-B12GGGGCCCATGNONE 
009-186-H09GGGGCCCATGNONE 
AK062901GGGGCCCATGConserved hypothetical protein. 
J013056D13GGGGCCCATGNONE 
J013056D17GGGGCCCATGNONE 
J013066A13GGGGCCCATGNONE 
J013066C03GGGGCCCATGNONE 
J013066F01GGGGCCCATGNONE 
J023078D03GGGGCCCATGNONE 
J033113N02GGGGCCCATGNONE 
J065019F09GGGGCCCATGNONE 
J065048C21GGGGCCCATGNONE 
J065077L13GGGGCCCATGNONE 
J065082J09GGGGCCCATGNONE 
J065113H16GGGGCCCATGNONE 
J065147A20GGGGCCCATGNONE 
J065180A13GGGGCCCATGNONE 
J065198M18GGGGCCCATGNONE 
J065207K19GGGGCCCATGNONE 
J075109H13GGGGCCCATGNONE 
Os06g0136900AK107405TGGTGGGCCCCACTCCProtein of unknown function DUF296 domain containing protein. 
Os06g0143000AB014056GGGGCCCAACTNONE 
AK062073GGGGCCCAACTNONE 
AK071301GGGGCCCAACTIron-superoxide dismutase (EC 1.15.1.1). 
J013043A16GGGGCCCAACTNONE 
J023001M11GGGGCCCAACTNONE 
J023087L08GGGGCCCAACTNONE 
J023145K23GGGGCCCAACTNONE 
J033123L01GGGGCCCAACTNONE 
J065127O08GGGGCCCAACTNONE 
Os06g0144000AK068998TTTTGGGCCCCAGBRCT domain containing protein. 
J023001F16TTTTGGGCCCCAGNONE 
Os06g0153200AK072625GCCCCCACCGGGTGGGGCCCACCCCCACCACNONE 
AK106752GCCCCCACCGGGTGGGGCCCACCCCCACCACProtein of unknown function DUF250 domain containing protein. 
Os06g0199300J065045H01GTGGTGGGCCCCACCCGNONE 
J075177C22GTGGTGGGCCCCACCCGNONE 
J080068H06GTGGTGGGCCCCACCCGNONE 
J090048F01GTGGTGGGCCCCACCCGNONE 
J100066F17GTGGTGGGCCCCACCCGNONE 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0220800AK059876CCATGGGCCCCNONE 
AY739306CCATGGGCCCCThioredoxin domain 2 containing protein. 
J075093C09CCATGGGCCCCNONE 
J100026J18CCATGGGCCCCNONE 
J100041O16CCATGGGCCCCNONE 
J100089K16CCATGGGCCCCNONE 
Os06g0241200AK100783TGTGGGCCCCACATGTCAGTGGGTCCCAHypothetical protein. 
Os06g0257200J053059P05GCGGCCCAAATAAATGGGCCCCNONE 
J053059P05TGGGGCCCAACNONE 
J075006K03GCGGCCCAAATAAATGGGCCCCNONE 
J075006K03TGGGGCCCAACNONE 
J075067F07GCGGCCCAAATAAATGGGCCCCNONE 
J075067F07TGGGGCCCAACNONE 
J075068F14GCGGCCCAAATAAATGGGCCCCNONE 
J075068F14TGGGGCCCAACNONE 
J075068H14GCGGCCCAAATAAATGGGCCCCNONE 
J075068H14TGGGGCCCAACNONE 
J075098N06GCGGCCCAAATAAATGGGCCCCNONE 
J075098N06TGGGGCCCAACNONE 
J075099F08GCGGCCCAAATAAATGGGCCCCNONE 
J075099F08TGGGGCCCAACNONE 
J075154G24GCGGCCCAAATAAATGGGCCCCNONE 
J075154G24TGGGGCCCAACNONE 
J075195H09GCGGCCCAAATAAATGGGCCCCNONE 
J075195H09TGGGGCCCAACNONE 
Os06g0268700AK120783GGGGCCCATTPeptidase A1, pepsin family protein. 
Os06g0270900011-086-B03CAAGTGGGCCCCACANONE 
012-051-A02CAAGTGGGCCCCACANONE 
016-033-F07CAAGTGGGCCCCACANONE 
AB044537CAAGTGGGCCCCACANONE 
AF162665CAAGTGGGCCCCACANONE 
AK073079CAAGTGGGCCCCACASimilar to RF2 (EC 1.2.1.3) (T cytoplasm male sterility restorer factor 2). 
AK099248CAAGTGGGCCCCACANONE 
AK120296CAAGTGGGCCCCACANONE 
J013151K07CAAGTGGGCCCCACANONE 
J013156A10CAAGTGGGCCCCACANONE 
J023014D24CAAGTGGGCCCCACANONE 
J023148F09CAAGTGGGCCCCACANONE 
J033113C09CAAGTGGGCCCCACANONE 
J065138H22CAAGTGGGCCCCACANONE 
J090037C14CAAGTGGGCCCCACANONE 
J090053A17CAAGTGGGCCCCACANONE 
J090066L02CAAGTGGGCCCCACANONE 
J100017N17CAAGTGGGCCCCACANONE 
J100040I08CAAGTGGGCCCCACANONE 
Os06g0308300AK059211TGGGGCCCACACGNONE 
AK101549TGGGGCCCACACGNONE 
AK102553TGGGGCCCACACGSimilar to 65kD microtubule associated protein. 
J090014G18TGGGGCCCACACGNONE 
J090082B01TGGGGCCCACACGNONE 
Os06g0552300011-011-G12GCCACGTGGGCCCCACCNONE 
AK101229GCCACGTGGGCCCCACCBZR1, transcriptional repressor family protein. 
J023061O03GCCACGTGGGCCCCACCNONE 
J033031H19GCCACGTGGGCCCCACCNONE 
J075103K14GCCACGTGGGCCCCACCNONE 
J075108I16GCCACGTGGGCCCCACCNONE 
J075194I23GCCACGTGGGCCCCACCNONE 
J090008K01GCCACGTGGGCCCCACCNONE 
J100062P15GCCACGTGGGCCCCACCNONE 
Os06g0557100AK111851CGTGGGGCCCACACProtein kinase-like domain containing protein. 
AK119892CGTGGGGCCCACACNONE 
J023150C23CGTGGGGCCCACACNONE 
J033108M17CGTGGGGCCCACACNONE 
J065062L01CGTGGGGCCCACACNONE 
J065161G20CGTGGGGCCCACACNONE 
J090062G13CGTGGGGCCCACACNONE 
J090087H11CGTGGGGCCCACACNONE 
J100055H23CGTGGGGCCCACACNONE 
J100063G05CGTGGGGCCCACACNONE 
Os06g0573600AK102756AGTGGGCCCCACACGTCTCSimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase). 
J023001F23AGTGGGCCCCACACGTCTCNONE 
J033107B05AGTGGGCCCCACACGTCTCNONE 
J090078G02AGTGGGCCCCACACGTCTCNONE 
J090099E09AGTGGGCCCCACACGTCTCNONE 
Os06g0587300AK069419CACTGACATGTGGGCCCCACAConserved hypothetical protein. 
AK121885CACTGACATGTGGGCCCCACANONE 
Os06g0589500AK073322CCCGTGGGCCCCConserved hypothetical protein. 
J033030G15CCCGTGGGCCCCNONE 
J033148N18CCCGTGGGCCCCNONE 
Os06g0591200009-125-G07GGGGCCCAATTNONE 
009-177-A08GGGGCCCAATTNONE 
AK062563GGGGCCCAATTConserved hypothetical protein. 
AK120112GGGGCCCAATTNONE 
J013025D20GGGGCCCAATTNONE 
J100018M02GGGGCCCAATTNONE 
J100021J11GGGGCCCAATTNONE 
J100024D08GGGGCCCAATTNONE 
J100044L11GGGGCCCAATTNONE 
J100077A22GGGGCCCAATTNONE 
J100090B19GGGGCCCAATTNONE 
Os06g0597000006-049-F03GGTGGGCCCCACCNONE 
006-113-H01GGTGGGCCCCACCNONE 
AK061037GGTGGGCCCCACCNONE 
AK069376GGTGGGCCCCACCSimilar to Auxin responsive protein IAA-Re. 
J023012K19GGTGGGCCCCACCNONE 
Os06g0603400AK060002GGGGCCCAAACNONE 
AK102325GGGGCCCAAACNONE 
AK106905GGGGCCCAAACSimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
J090039I22GGGGCCCAAACNONE 
J100022N15GGGGCCCAAACNONE 
J100023E09GGGGCCCAAACNONE 
J100052D21GGGGCCCAAACNONE 
Os06g0609600AK072533CCTGGGCCCCACCTGEF-Hand type domain containing protein. 
AK099872CCTGGGCCCCACCTGNONE 
BT014680CCTGGGCCCCACCTGNONE 
J023008M02CCTGGGCCCCACCTGNONE 
J023127M12CCTGGGCCCCACCTGNONE 
J065049L24CCTGGGCCCCACCTGNONE 
J065102K24CCTGGGCCCCACCTGNONE 
J065205O14CCTGGGCCCCACCTGNONE 
J075127F01CCTGGGCCCCACCTGNONE 
J080033F07CCTGGGCCCCACCTGNONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0622700AK107021CGCGTGGGCCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05CGCGTGGGCCCCACCACNONE 
J065100L18CGCGTGGGCCCCACCACNONE 
J065129N15CGCGTGGGCCCCACCACNONE 
J065152M08CGCGTGGGCCCCACCACNONE 
J065198M12CGCGTGGGCCCCACCACNONE 
J090077J22CGCGTGGGCCCCACCACNONE 
J100024G23CGCGTGGGCCCCACCACNONE 
J100027L01CGCGTGGGCCCCACCACNONE 
J100047C06CGCGTGGGCCCCACCACNONE 
J100055D01CGCGTGGGCCCCACCACNONE 
J100067M05CGCGTGGGCCCCACCACNONE 
J100077M16CGCGTGGGCCCCACCACNONE 
J100078M22CGCGTGGGCCCCACCACNONE 
Os06g0648500AK106895CGGGTGGGGCCCACGGConserved hypothetical protein. 
Os06g0666400AK108002GGGGCCCACCCACCACVQ domain containing protein. 
J065043C22GGGGCCCACCCACCACNONE 
J065120O19GGGGCCCACCCACCACNONE 
J075197D23GGGGCCCACCCACCACNONE 
J100030E22GGGGCCCACCCACCACNONE 
J100031I22GGGGCCCACCCACCACNONE 
J100072I12GGGGCCCACCCACCACNONE 
Os06g0694100011-036-G03ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein. 
AK073594ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J033051C12ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J065102I24ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
Os06g0695900011-023-F07ACTGGGCCCCACCNONE 
J023143A16ACTGGGCCCCACCZinc finger, RING-type domain containing protein. 
Os06g0704700AK120907GGGGCCCAGCNmrA-like family protein. 
AY224493GGGGCCCAGCNONE 
Os06g0727400AK069558CACTGACAGGTGGGCCCCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os07g0100500J033026C11GGGGCCCACGTGGCNONE 
Os07g0101500AK059667ATCTGGGCCCCACNONE 
AK071749ATCTGGGCCCCACSimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07ATCTGGGCCCCACNONE 
J065050F03ATCTGGGCCCCACNONE 
J090015C05ATCTGGGCCCCACNONE 
J090045C11ATCTGGGCCCCACNONE 
Os07g0123300AK108490GGGGCCCACCTGConserved hypothetical protein. 
J065197L01GGGGCCCACCTGNONE 
J065206N07GGGGCCCACCTGNONE 
J080011N05GGGGCCCACCTGNONE 
J080021N11GGGGCCCACCTGNONE 
J080025M24GGGGCCCACCTGNONE 
J080031E13GGGGCCCACCTGNONE 
J080047B07GGGGCCCACCTGNONE 
J080061L03GGGGCCCACCTGNONE 
J080062C18GGGGCCCACCTGNONE 
J080063E20GGGGCCCACCTGNONE 
J080063O12GGGGCCCACCTGNONE 
J080070D20GGGGCCCACCTGNONE 
J080074J17GGGGCCCACCTGNONE 
J080076K17GGGGCCCACCTGNONE 
J080079K21GGGGCCCACCTGNONE 
J080080D02GGGGCCCACCTGNONE 
J080088E12GGGGCCCACCTGNONE 
J080092I18GGGGCCCACCTGNONE 
Os07g0133500015-010-H05GGGGCCCACANONE 
AB110179GGGGCCCACANONE 
AK106244GGGGCCCACAProtein of unknown function DUF1005 family protein. 
J090075I21GGGGCCCACANONE 
Os07g0139400AB096864CGCGTGGGCCCCACTCCNONE 
AB096864TGTGGGGCCCAGCNONE 
AK065558CGCGTGGGCCCCACTCCUDP-glucose 4-epimerase family protein. 
AK065558TGTGGGGCCCAGCUDP-glucose 4-epimerase family protein. 
AK099140CGCGTGGGCCCCACTCCNONE 
AK099140TGTGGGGCCCAGCNONE 
AK099183CGCGTGGGCCCCACTCCNONE 
AK099183TGTGGGGCCCAGCNONE 
J013033B01CGCGTGGGCCCCACTCCNONE 
J013033B01TGTGGGGCCCAGCNONE 
J013157B14CGCGTGGGCCCCACTCCNONE 
J013157B14TGTGGGGCCCAGCNONE 
J023052E04CGCGTGGGCCCCACTCCNONE 
J023052E04TGTGGGGCCCAGCNONE 
J023086K05CGCGTGGGCCCCACTCCNONE 
J023086K05TGTGGGGCCCAGCNONE 
J023099C15CGCGTGGGCCCCACTCCNONE 
J023099C15TGTGGGGCCCAGCNONE 
J033025C08CGCGTGGGCCCCACTCCNONE 
J033025C08TGTGGGGCCCAGCNONE 
J033072I24CGCGTGGGCCCCACTCCNONE 
J033072I24TGTGGGGCCCAGCNONE 
J043020I04CGCGTGGGCCCCACTCCNONE 
J043020I04TGTGGGGCCCAGCNONE 
J090039I21CGCGTGGGCCCCACTCCNONE 
J090039I21TGTGGGGCCCAGCNONE 
J090078P20CGCGTGGGCCCCACTCCNONE 
J090078P20TGTGGGGCCCAGCNONE 
J090084C18CGCGTGGGCCCCACTCCNONE 
J090084C18TGTGGGGCCCAGCNONE 
J100024F07CGCGTGGGCCCCACTCCNONE 
J100024F07TGTGGGGCCCAGCNONE 
J100054D22CGCGTGGGCCCCACTCCNONE 
J100054D22TGTGGGGCCCAGCNONE 
J100062O08CGCGTGGGCCCCACTCCNONE 
J100062O08TGTGGGGCCCAGCNONE 
Os07g0146600J075074M15GGGGCCCATGGGCCAGAConserved hypothetical protein. 
J075120F11GGGGCCCATGGGCCAGANONE 
J075170L13GGGGCCCATGGGCCAGANONE 
J080302A21GGGGCCCATGGGCCAGANONE 
J080304J04GGGGCCCATGGGCCAGANONE 
J080308I12GGGGCCCATGGGCCAGANONE 
J080312F11GGGGCCCATGGGCCAGANONE 
J080315M22GGGGCCCATGGGCCAGANONE 
Os07g0152800AK065458GGTGGGCCCCACCTGConserved hypothetical protein. 
J013022G05GGTGGGCCCCACCTGNONE 
J013023D18GGTGGGCCCCACCTGNONE 
J013048J16GGTGGGCCCCACCTGNONE 
J013055I03GGTGGGCCCCACCTGNONE 
J013057F12GGTGGGCCCCACCTGNONE 
J023109A22GGTGGGCCCCACCTGNONE 
J023148E09GGTGGGCCCCACCTGNONE 
J033069G17GGTGGGCCCCACCTGNONE 
J033092I18GGTGGGCCCCACCTGNONE 
J033093C02GGTGGGCCCCACCTGNONE 
J033141M17GGTGGGCCCCACCTGNONE 
J043016M18GGTGGGCCCCACCTGNONE 
J090016D12GGTGGGCCCCACCTGNONE 
J090071B10GGTGGGCCCCACCTGNONE 
J090098K07GGTGGGCCCCACCTGNONE 
J100035K14GGTGGGCCCCACCTGNONE 
Os07g0153400AK069618GTGGGGGCCCACCCCyclin-like F-box domain containing protein. 
J013023C22GTGGGGGCCCACCCNONE 
J013034M12GTGGGGGCCCACCCNONE 
J013048B10GTGGGGGCCCACCCNONE 
J013052P04GTGGGGGCCCACCCNONE 
J013091E22GTGGGGGCCCACCCNONE 
J013096D02GTGGGGGCCCACCCNONE 
J013098A08GTGGGGGCCCACCCNONE 
J013106B13GTGGGGGCCCACCCNONE 
J013109C09GTGGGGGCCCACCCNONE 
J013121H14GTGGGGGCCCACCCNONE 
J023002G10GTGGGGGCCCACCCNONE 
J023019I24GTGGGGGCCCACCCNONE 
J023025H16GTGGGGGCCCACCCNONE 
J023037K24GTGGGGGCCCACCCNONE 
J023041J02GTGGGGGCCCACCCNONE 
J023056G02GTGGGGGCCCACCCNONE 
J023073H18GTGGGGGCCCACCCNONE 
J023082F08GTGGGGGCCCACCCNONE 
J023104J01GTGGGGGCCCACCCNONE 
J023105F21GTGGGGGCCCACCCNONE 
J033038A08GTGGGGGCCCACCCNONE 
J033040I21GTGGGGGCCCACCCNONE 
J033111M19GTGGGGGCCCACCCNONE 
J043010N11GTGGGGGCCCACCCNONE 
J075018B18GTGGGGGCCCACCCNONE 
J075043E08GTGGGGGCCCACCCNONE 
J075045H12GTGGGGGCCCACCCNONE 
J075048P08GTGGGGGCCCACCCNONE 
J075056M23GTGGGGGCCCACCCNONE 
J075061J22GTGGGGGCCCACCCNONE 
J075085K04GTGGGGGCCCACCCNONE 
J075118N16GTGGGGGCCCACCCNONE 
J075120O11GTGGGGGCCCACCCNONE 
J075133J08GTGGGGGCCCACCCNONE 
J075186O13GTGGGGGCCCACCCNONE 
J100047B15GTGGGGGCCCACCCNONE 
Os07g0154900009-142-E09GGGGCCCACGTGGGCCCCACGTGTCNONE 
AK062969GGGGCCCACGTGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein). 
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
Os07g0168600AK068262TGTGGGCCCCACSimilar to 3-glucanase. 
AK105668TGTGGGCCCCACNONE 
Os07g0169600006-027-F04GGGGCCCACTTGNONE 
006-027-F04TGTGGGGCCCACTNONE 
006-043-C10GGGGCCCACTTGNONE 
006-043-C10TGTGGGGCCCACTNONE 
006-070-A04GGGGCCCACTTGNONE 
006-070-A04TGTGGGGCCCACTNONE 
006-081-F03GGGGCCCACTTGNONE 
006-081-F03TGTGGGGCCCACTNONE 
006-104-F02GGGGCCCACTTGNONE 
006-104-F02TGTGGGGCCCACTNONE 
012-006-D12GGGGCCCACTTGNONE 
012-006-D12TGTGGGGCCCACTNONE 
AK060318GGGGCCCACTTGNONE 
AK060318TGTGGGGCCCACTNONE 
AK121818GGGGCCCACTTG2OG-Fe(II) oxygenase domain containing protein. 
AK121818TGTGGGGCCCACT2OG-Fe(II) oxygenase domain containing protein. 
J023065K01GGGGCCCACTTGNONE 
J023065K01TGTGGGGCCCACTNONE 
J023086G17GGGGCCCACTTGNONE 
J023086G17TGTGGGGCCCACTNONE 
J023093G16GGGGCCCACTTGNONE 
J023093G16TGTGGGGCCCACTNONE 
J033024N04GGGGCCCACTTGNONE 
J033024N04TGTGGGGCCCACTNONE 
J033099A15GGGGCCCACTTGNONE 
J033099A15TGTGGGGCCCACTNONE 
J033107B14GGGGCCCACTTGNONE 
J033107B14TGTGGGGCCCACTNONE 
J043026F14GGGGCCCACTTGNONE 
J043026F14TGTGGGGCCCACTNONE 
J065043P20GGGGCCCACTTGNONE 
J065043P20TGTGGGGCCCACTNONE 
J075118L16GGGGCCCACTTGNONE 
J075118L16TGTGGGGCCCACTNONE 
J075162M22GGGGCCCACTTGNONE 
J075162M22TGTGGGGCCCACTNONE 
J080004K13GGGGCCCACTTGNONE 
J080004K13TGTGGGGCCCACTNONE 
J080024D10GGGGCCCACTTGNONE 
J080024D10TGTGGGGCCCACTNONE 
J080037C21GGGGCCCACTTGNONE 
J080037C21TGTGGGGCCCACTNONE 
J080039M17GGGGCCCACTTGNONE 
J080039M17TGTGGGGCCCACTNONE 
J080040A03GGGGCCCACTTGNONE 
J080040A03TGTGGGGCCCACTNONE 
J080044A07GGGGCCCACTTGNONE 
J080044A07TGTGGGGCCCACTNONE 
J080045I07GGGGCCCACTTGNONE 
J080045I07TGTGGGGCCCACTNONE 
J080052L06GGGGCCCACTTGNONE 
J080052L06TGTGGGGCCCACTNONE 
J080053A20GGGGCCCACTTGNONE 
J080053A20TGTGGGGCCCACTNONE 
J080060L15GGGGCCCACTTGNONE 
J080060L15TGTGGGGCCCACTNONE 
J080060N22GGGGCCCACTTGNONE 
J080060N22TGTGGGGCCCACTNONE 
J080062L23GGGGCCCACTTGNONE 
J080062L23TGTGGGGCCCACTNONE 
J080069B19GGGGCCCACTTGNONE 
J080069B19TGTGGGGCCCACTNONE 
J080086K15GGGGCCCACTTGNONE 
J080086K15TGTGGGGCCCACTNONE 
J080089H16GGGGCCCACTTGNONE 
J080089H16TGTGGGGCCCACTNONE 
J080089I23GGGGCCCACTTGNONE 
J080089I23TGTGGGGCCCACTNONE 
J080094P07GGGGCCCACTTGNONE 
J080094P07TGTGGGGCCCACTNONE 
J090032L18GGGGCCCACTTGNONE 
J090032L18TGTGGGGCCCACTNONE 
J100044E09GGGGCCCACTTGNONE 
J100044E09TGTGGGGCCCACTNONE 
J100045O03GGGGCCCACTTGNONE 
J100045O03TGTGGGGCCCACTNONE 
J100066B11GGGGCCCACTTGNONE 
J100066B11TGTGGGGCCCACTNONE 
J100069J24GGGGCCCACTTGNONE 
J100069J24TGTGGGGCCCACTNONE 
Os07g0171200AK071075AGTGGGCCCCACAGalactose-1-phosphate uridyl transferase, class I family protein. 
Os07g0181800AK121080TGTGGGCCCCACTTGTCTGGCCCConserved hypothetical protein. 
J023063D04TGTGGGCCCCACTTGTCTGGCCCNONE 
J033084A07TGTGGGCCCCACTTGTCTGGCCCNONE 
J075013C04TGTGGGCCCCACTTGTCTGGCCCNONE 
J075027H13TGTGGGCCCCACTTGTCTGGCCCNONE 
J075045P19TGTGGGCCCCACTTGTCTGGCCCNONE 
J090042L13TGTGGGCCCCACTTGTCTGGCCCNONE 
J090098E10TGTGGGCCCCACTTGTCTGGCCCNONE 
Os07g0188700011-058-D09CAGGTGGGGCCCACCCNONE 
AK063957CAGGTGGGGCCCACCCNONE 
AK073755CAGGTGGGGCCCACCCSimilar to EXO. 
AK107609CAGGTGGGGCCCACCCNONE 
J033066N03CAGGTGGGGCCCACCCNONE 
Os07g0191700AK066389ACCCGCGCGACGTGGGGCCCACGCSimilar to AT.I.24-9 protein (Fragment). 
AK103768ACCCGCGCGACGTGGGGCCCACGCNONE 
Os07g0240300AK072205AGGTGGGCCCCACGTGConserved hypothetical protein. 
AK098977AGGTGGGCCCCACGTGNONE 
Os07g0241500AK107239CACGTCACCGACACGTGGGGCCCACCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J065065I20CACGTCACCGACACGTGGGGCCCACCCNONE 
J065158P15CACGTCACCGACACGTGGGGCCCACCCNONE 
J065167J16CACGTCACCGACACGTGGGGCCCACCCNONE 
J065183I01CACGTCACCGACACGTGGGGCCCACCCNONE 
J065187L18CACGTCACCGACACGTGGGGCCCACCCNONE 
J065205J10CACGTCACCGACACGTGGGGCCCACCCNONE 
Os07g0262950J033120B02CCTGGGCCCCConserved hypothetical protein. 
J075040G05CCTGGGCCCCNONE 
J075160F23CCTGGGCCCCNONE 
Os07g0274700J065002G18CCCGTGGGCCCCCACCCGCGCNONE 
J065092L19CCCGTGGGCCCCCACCCGCGCNONE 
J065099K11CCCGTGGGCCCCCACCCGCGCNONE 
J065103L08CCCGTGGGCCCCCACCCGCGCNONE 
J065185I19CCCGTGGGCCCCCACCCGCGCNONE 
J075004L22CCCGTGGGCCCCCACCCGCGCNONE 
J075007G03CCCGTGGGCCCCCACCCGCGCNONE 
J075020E09CCCGTGGGCCCCCACCCGCGCNONE 
J075046B02CCCGTGGGCCCCCACCCGCGCNONE 
J075070D08CCCGTGGGCCCCCACCCGCGCNONE 
J075118L24CCCGTGGGCCCCCACCCGCGCNONE 
J075140C15CCCGTGGGCCCCCACCCGCGCNONE 
J075157A21CCCGTGGGCCCCCACCCGCGCNONE 
J075165J01CCCGTGGGCCCCCACCCGCGCNONE 
J075172J18CCCGTGGGCCCCCACCCGCGCNONE 
J075177P10CCCGTGGGCCCCCACCCGCGCNONE 
J100042D15CCCGTGGGCCCCCACCCGCGCNONE 
J100053M21CCCGTGGGCCCCCACCCGCGCNONE 
J100067M12CCCGTGGGCCCCCACCCGCGCNONE 
Os07g0419500J065210A06GCCACGTGGGTGGGCCCCACCCCCACCCGCGCNONE 
Os07g0474300AK108961CTGGGGCCCACAConserved hypothetical protein. 
Os07g0495000015-070-F12CAAGTGGGGCCCACCTNONE 
AK060721CAAGTGGGGCCCACCTNONE 
AK073883CAAGTGGGGCCCACCTCupin, RmlC-type domain containing protein. 
AK119204CAAGTGGGGCCCACCTNONE 
J033071H20CAAGTGGGGCCCACCTNONE 
J090079B04CAAGTGGGGCCCACCTNONE 
Os07g0496700016-057-A12TGGGGCCCACCTGTCNONE 
AK064235TGGGGCCCACCTGTCPhosphate-induced protein 1 conserved region family protein. 
Os07g0498300009-045-C02TCGTGGGCCCCACACNONE 
009-060-A09TCGTGGGCCCCACACNONE 
009-121-C04TCGTGGGCCCCACACNONE 
009-157-G09TCGTGGGCCCCACACNONE 
009-197-B02TCGTGGGCCCCACACNONE 
AK059124TCGTGGGCCCCACACConserved hypothetical protein. 
AK119800TCGTGGGCCCCACACNONE 
J065184M18TCGTGGGCCCCACACNONE 
J075009G21TCGTGGGCCCCACACNONE 
J075013O03TCGTGGGCCCCACACNONE 
J075061C22TCGTGGGCCCCACACNONE 
J075094E12TCGTGGGCCCCACACNONE 
J075148C01TCGTGGGCCCCACACNONE 
Os07g0501900AK067791CACTGACAAGTGGGCCCCANONE 
AK120759CACTGACAAGTGGGCCCCANONE 
Os07g0531600015-098-E11GGGGCCCACCCGNONE 
AK067845GGGGCCCACCCGPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01GGGGCCCACCCGNONE 
J065008E15GGGGCCCACCCGNONE 
J065052K14GGGGCCCACCCGNONE 
J065052L13GGGGCCCACCCGNONE 
J065058M02GGGGCCCACCCGNONE 
J065069M10GGGGCCCACCCGNONE 
J065135A14GGGGCCCACCCGNONE 
J065168O18GGGGCCCACCCGNONE 
J075070D14GGGGCCCACCCGNONE 
J075169B16GGGGCCCACCCGNONE 
Os07g0537300015-019-C12GCTGGGCCCCACCTGTCSimilar to Serine/threonine kinase receptor-like protein. 
J033140L16GCTGGGCCCCACCTGTCNONE 
J043034B12GCTGGGCCCCACCTGTCNONE 
Os07g0545400009-136-E03CGGGTGGGGCCCACCNONE 
013-015-G08CGGGTGGGGCCCACCNONE 
AK059228CGGGTGGGGCCCACCNONE 
J065040D09CGGGTGGGGCCCACCNONE 
J065051C19CGGGTGGGGCCCACCNONE 
J065139B05CGGGTGGGGCCCACCNONE 
J065160E20CGGGTGGGGCCCACCNONE 
J065207I17CGGGTGGGGCCCACCNONE 
J080319M24CGGGTGGGGCCCACCNONE 
Os07g0546100AK058282GGGGCCCACCANONE 
Os07g0556000AK121938CTGACAGGTGGGCCCCACCCyclin-like domain containing protein. 
J065161E07CTGACAGGTGGGCCCCACCNONE 
Os07g0557500AK101830AGAGTGGGCCCCACGTZinc finger, RING-type domain containing protein. 
J013075M04AGAGTGGGCCCCACGTNONE 
J033068I24AGAGTGGGCCCCACGTNONE 
Os07g0558400003-103-C02TGGGGCCCATCCACCNONE 
003-115-G05TGGGGCCCATCCACCNONE 
006-025-B09TGGGGCCCATCCACCNONE 
006-025-G10TGGGGCCCATCCACCNONE 
006-027-E03TGGGGCCCATCCACCNONE 
006-036-C06TGGGGCCCATCCACCNONE 
006-045-B10TGGGGCCCATCCACCNONE 
006-051-H11TGGGGCCCATCCACCNONE 
006-053-H03TGGGGCCCATCCACCNONE 
006-057-B09TGGGGCCCATCCACCNONE 
006-062-C10TGGGGCCCATCCACCNONE 
006-075-B12TGGGGCCCATCCACCNONE 
006-079-F01TGGGGCCCATCCACCNONE 
006-082-D08TGGGGCCCATCCACCNONE 
006-087-F04TGGGGCCCATCCACCNONE 
006-089-E09TGGGGCCCATCCACCNONE 
006-090-C04TGGGGCCCATCCACCNONE 
006-091-H05TGGGGCCCATCCACCNONE 
006-093-E02TGGGGCCCATCCACCNONE 
006-093-E06TGGGGCCCATCCACCNONE 
006-093-H05TGGGGCCCATCCACCNONE 
006-095-C05TGGGGCCCATCCACCNONE 
006-097-B04TGGGGCCCATCCACCNONE 
006-097-C07TGGGGCCCATCCACCNONE 
006-097-D02TGGGGCCCATCCACCNONE 
006-097-H10TGGGGCCCATCCACCNONE 
006-098-C05TGGGGCCCATCCACCNONE 
006-099-H09TGGGGCCCATCCACCNONE 
006-104-B06TGGGGCCCATCCACCNONE 
006-105-B11TGGGGCCCATCCACCNONE 
006-106-E12TGGGGCCCATCCACCNONE 
006-107-B06TGGGGCCCATCCACCNONE 
006-109-A09TGGGGCCCATCCACCNONE 
006-112-D05TGGGGCCCATCCACCNONE 
006-118-C12TGGGGCCCATCCACCNONE 
006-118-E10TGGGGCCCATCCACCNONE 
006-120-D05TGGGGCCCATCCACCNONE 
006-120-E08TGGGGCCCATCCACCNONE 
009-055-D12TGGGGCCCATCCACCNONE 
009-108-E05TGGGGCCCATCCACCNONE 
009-125-H05TGGGGCCCATCCACCNONE 
009-150-A07TGGGGCCCATCCACCNONE 
009-198-C07TGGGGCCCATCCACCNONE 
AF058796TGGGGCCCATCCACCNONE 
AK058293TGGGGCCCATCCACCNONE 
AK098992TGGGGCCCATCCACCNONE 
AK103924TGGGGCCCATCCACCNONE 
AK104309TGGGGCCCATCCACCNONE 
AK104619TGGGGCCCATCCACCNONE 
AK119534TGGGGCCCATCCACCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
J013098H13TGGGGCCCATCCACCNONE 
J043039O11TGGGGCCCATCCACCNONE 
J065176D03TGGGGCCCATCCACCNONE 
J075022K10TGGGGCCCATCCACCNONE 
J075065A02TGGGGCCCATCCACCNONE 
J075077D23TGGGGCCCATCCACCNONE 
J075088P15TGGGGCCCATCCACCNONE 
J075125D24TGGGGCCCATCCACCNONE 
J075125H11TGGGGCCCATCCACCNONE 
J075192H21TGGGGCCCATCCACCNONE 
J090080H18TGGGGCCCATCCACCNONE 
Os07g0568300AK067784TCGTGGGCCCCACCCGCGCNONE 
AK067895TCGTGGGCCCCACCCGCGCSimilar to ZF protein (Fragment). 
J013119M01TCGTGGGCCCCACCCGCGCNONE 
J013120B09TCGTGGGCCCCACCCGCGCNONE 
J013123G12TCGTGGGCCCCACCCGCGCNONE 
J023012C12TCGTGGGCCCCACCCGCGCNONE 
J023020G17TCGTGGGCCCCACCCGCGCNONE 
J023037E23TCGTGGGCCCCACCCGCGCNONE 
J033076I01TCGTGGGCCCCACCCGCGCNONE 
J033108A07TCGTGGGCCCCACCCGCGCNONE 
J033138J02TCGTGGGCCCCACCCGCGCNONE 
J075033L09TCGTGGGCCCCACCCGCGCNONE 
J075049E02TCGTGGGCCCCACCCGCGCNONE 
J075060N23TCGTGGGCCCCACCCGCGCNONE 
J075094H13TCGTGGGCCCCACCCGCGCNONE 
J075179L18TCGTGGGCCCCACCCGCGCNONE 
J080005P09TCGTGGGCCCCACCCGCGCNONE 
J080044J03TCGTGGGCCCCACCCGCGCNONE 
J080062G20TCGTGGGCCCCACCCGCGCNONE 
J080063L23TCGTGGGCCCCACCCGCGCNONE 
J080065B16TCGTGGGCCCCACCCGCGCNONE 
J080071K09TCGTGGGCCCCACCCGCGCNONE 
J080089C23TCGTGGGCCCCACCCGCGCNONE 
J090008P21TCGTGGGCCCCACCCGCGCNONE 
J090046B22TCGTGGGCCCCACCCGCGCNONE 
J090094C19TCGTGGGCCCCACCCGCGCNONE 
J090096B19TCGTGGGCCCCACCCGCGCNONE 
J100060G03TCGTGGGCCCCACCCGCGCNONE 
J100082D16TCGTGGGCCCCACCCGCGCNONE 
Os07g0568900009-083-H02TTATGGGCCCCCACGNONE 
AK062660TTATGGGCCCCCACGConserved hypothetical protein. 
Os07g0569000AK073915CGTGGGGGCCCATAAConserved hypothetical protein. 
Os07g0584500003-129-F05TGGTGGGCCCCCACACNONE 
006-119-H08TGGTGGGCCCCCACACNONE 
011-022-G03TGGTGGGCCCCCACACNONE 
AK067725TGGTGGGCCCCCACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK121109TGGTGGGCCCCCACACNONE 
J013055C05TGGTGGGCCCCCACACNONE 
J013062F12TGGTGGGCCCCCACACNONE 
J013069J22TGGTGGGCCCCCACACNONE 
J013114I11TGGTGGGCCCCCACACNONE 
J023072P12TGGTGGGCCCCCACACNONE 
Os07g0591400Os07g0591400GGTTGGGCCTACGTGGGCCCCCACNONE 
Os07g0591400TGGGGCCCACGTGGGCCCACANONE 
Os07g0596600AK067238CCCGTGGGCCCCACCSimilar to Cdc2MsC protein. 
Os07g0603100AK101352CGCGTGGGGCCCACCANuclear transport factor 2 domain containing protein. 
AK101352GGGGCCCACANuclear transport factor 2 domain containing protein. 
J023077E09CGCGTGGGGCCCACCANONE 
J023077E09GGGGCCCACANONE 
J023081N15CGCGTGGGGCCCACCANONE 
J023081N15GGGGCCCACANONE 
J033022N22CGCGTGGGGCCCACCANONE 
J033022N22GGGGCCCACANONE 
J033024M18CGCGTGGGGCCCACCANONE 
J033024M18GGGGCCCACANONE 
J033034P09CGCGTGGGGCCCACCANONE 
J033034P09GGGGCCCACANONE 
J033046A06CGCGTGGGGCCCACCANONE 
J033046A06GGGGCCCACANONE 
J033051K01CGCGTGGGGCCCACCANONE 
J033051K01GGGGCCCACANONE 
J033081P09CGCGTGGGGCCCACCANONE 
J033081P09GGGGCCCACANONE 
J033091B17CGCGTGGGGCCCACCANONE 
J033091B17GGGGCCCACANONE 
J033092K23CGCGTGGGGCCCACCANONE 
J033092K23GGGGCCCACANONE 
J033132J09CGCGTGGGGCCCACCANONE 
J033132J09GGGGCCCACANONE 
J033144A14CGCGTGGGGCCCACCANONE 
J033144A14GGGGCCCACANONE 
J033145A14CGCGTGGGGCCCACCANONE 
J033145A14GGGGCCCACANONE 
J043021B20CGCGTGGGGCCCACCANONE 
J043021B20GGGGCCCACANONE 
J053024D23CGCGTGGGGCCCACCANONE 
J053024D23GGGGCCCACANONE 
J065212J10CGCGTGGGGCCCACCANONE 
J065212J10GGGGCCCACANONE 
J090055M05CGCGTGGGGCCCACCANONE 
J090055M05GGGGCCCACANONE 
J090065E14CGCGTGGGGCCCACCANONE 
J090065E14GGGGCCCACANONE 
J090092J06CGCGTGGGGCCCACCANONE 
J090092J06GGGGCCCACANONE 
Os07g0604500009-018-C07AGTGGGCCCCACCNONE 
009-018-C07GGGGCCCACTNONE 
009-194-C02AGTGGGCCCCACCNONE 
009-194-C02GGGGCCCACTNONE 
011-023-C06AGTGGGCCCCACCNONE 
011-023-C06GGGGCCCACTNONE 
015-035-B10AGTGGGCCCCACCNONE 
015-035-B10GGGGCCCACTNONE 
AK064312AGTGGGCCCCACCSimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK064312GGGGCCCACTSimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085AGTGGGCCCCACCNONE 
AK069085GGGGCCCACTNONE 
J090050I12AGTGGGCCCCACCNONE 
J090050I12GGGGCCCACTNONE 
J100027C10AGTGGGCCCCACCNONE 
J100027C10GGGGCCCACTNONE 
J100029A05AGTGGGCCCCACCNONE 
J100029A05GGGGCCCACTNONE 
J100031P17AGTGGGCCCCACCNONE 
J100031P17GGGGCCCACTNONE 
J100039E20AGTGGGCCCCACCNONE 
J100039E20GGGGCCCACTNONE 
J100064L15AGTGGGCCCCACCNONE 
J100064L15GGGGCCCACTNONE 
J100066K08AGTGGGCCCCACCNONE 
J100066K08GGGGCCCACTNONE 
Os07g0605200AF091458CCCGTGGGCCCCACCGGGCCNONE 
AF139665CCCGTGGGCCCCACCGGGCCNONE 
AJ011675CCCGTGGGCCCCACCGGGCCNONE 
AK064704CCCGTGGGCCCCACCGGGCCMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15CCCGTGGGCCCCACCGGGCCNONE 
J090034M06CCCGTGGGCCCCACCGGGCCNONE 
J090079L24CCCGTGGGCCCCACCGGGCCNONE 
Os07g0606900011-039-F09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
011-058-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-014-C08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-062-H02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-067-G01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-029-A08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-039-H09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-044-A09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-047-G10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-065-C04GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-067-C10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-078-H10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-084-A06GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-050-F01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-F04GGTGGGCCCCACCTGTCGGTGGGCCGTGGHeavy metal transport/detoxification protein domain containing protein. 
016-062-C02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J065170E01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J075122G11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
Os07g0608400AK109447CGATGGGCCGGGGCCCACCASimilar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)]. 
AK109447GGTGGGCCCCACGCGSimilar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)]. 
Os07g0620200AK099859ACTGACAGGTGGGCCCCHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04ACTGACAGGTGGGCCCCNONE 
Os07g0621201J065152G13ACGTGGGGCCCACAConserved hypothetical protein. 
J065152G13GGGGCCCACAConserved hypothetical protein. 
Os07g0626600Os07g0626600TGTGGGCCCCACGSimilar to Embryogenic callus protein-like. 
Os07g0637300AF323611CCACTGACACCTGGGCCCCACCNONE 
AK069157CCACTGACACCTGGGCCCCACCNONE 
J023007C01CCACTGACACCTGGGCCCCACCNONE 
Os07g0659500AK073537GACACGTGGGCCCCACCNon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0661600006-050-D12CCTGGGCCCCACCNONE 
009-124-B10CCTGGGCCCCACCNONE 
AK061123CCTGGGCCCCACCNONE 
AK066432CCTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK104664CCTGGGCCCCACCNONE 
J013064M13CCTGGGCCCCACCNONE 
J013122O12CCTGGGCCCCACCNONE 
J033044A16CCTGGGCCCCACCNONE 
J033144D14CCTGGGCCCCACCNONE 
J090078P13CCTGGGCCCCACCNONE 
Os07g0679300AK065079CACTGACATGTGGGCCCCACANONE 
AK099229CACTGACATGTGGGCCCCACASimilar to Alpha-galactosidase precursor (EC 3.2.1.22) (Melibiase) (Alpha-D- galactoside galactohydrolase). 
J013033F05CACTGACATGTGGGCCCCACANONE 
J013049N18CACTGACATGTGGGCCCCACANONE 
J013071C14CACTGACATGTGGGCCCCACANONE 
J013088P15CACTGACATGTGGGCCCCACANONE 
J013092D24CACTGACATGTGGGCCCCACANONE 
J013093O14CACTGACATGTGGGCCCCACANONE 
J023095E17CACTGACATGTGGGCCCCACANONE 
J043005E21CACTGACATGTGGGCCCCACANONE 
J043015E06CACTGACATGTGGGCCCCACANONE 
J043027P22CACTGACATGTGGGCCCCACANONE 
J065038B15CACTGACATGTGGGCCCCACANONE 
J065073M21CACTGACATGTGGGCCCCACANONE 
J065165P06CACTGACATGTGGGCCCCACANONE 
J065198I06CACTGACATGTGGGCCCCACANONE 
J075007E08CACTGACATGTGGGCCCCACANONE 
J075038I07CACTGACATGTGGGCCCCACANONE 
J075130L20CACTGACATGTGGGCCCCACANONE 
J090057G17CACTGACATGTGGGCCCCACANONE 
J100029K23CACTGACATGTGGGCCCCACANONE 
J100086O16CACTGACATGTGGGCCCCACANONE 
J100087M02CACTGACATGTGGGCCCCACANONE 
Os08g0110400AK100025AGTGACACATGGGCCCCACCCCACGCGProtein of unknown function DUF266, plant family protein. 
Os08g0113100003-102-G01CAGGTGGGCCCCACCNONE 
011-041-F02CAGGTGGGCCCCACCNONE 
011-063-A09CAGGTGGGCCCCACCNONE 
AB110164CAGGTGGGCCCCACCNONE 
AF429947CAGGTGGGCCCCACCNONE 
AK070120CAGGTGGGCCCCACCSimilar to Fructokinase (Fragment). 
AK099353CAGGTGGGCCCCACCNONE 
J013072L23CAGGTGGGCCCCACCNONE 
J023031J20CAGGTGGGCCCCACCNONE 
J023041C07CAGGTGGGCCCCACCNONE 
J023068B05CAGGTGGGCCCCACCNONE 
J023111H11CAGGTGGGCCCCACCNONE 
J023114G22CAGGTGGGCCCCACCNONE 
J023121E01CAGGTGGGCCCCACCNONE 
J023121G16CAGGTGGGCCCCACCNONE 
J023128D15CAGGTGGGCCCCACCNONE 
J023142I22CAGGTGGGCCCCACCNONE 
J033058M11CAGGTGGGCCCCACCNONE 
J033092F23CAGGTGGGCCCCACCNONE 
J033108M10CAGGTGGGCCCCACCNONE 
J065085D10CAGGTGGGCCCCACCNONE 
J065086I17CAGGTGGGCCCCACCNONE 
J065137I08CAGGTGGGCCCCACCNONE 
J065154L19CAGGTGGGCCCCACCNONE 
J065179C12CAGGTGGGCCCCACCNONE 
J065184K15CAGGTGGGCCCCACCNONE 
J065195G07CAGGTGGGCCCCACCNONE 
J075052K09CAGGTGGGCCCCACCNONE 
J075093D08CAGGTGGGCCCCACCNONE 
J075093L13CAGGTGGGCCCCACCNONE 
J090005F03CAGGTGGGCCCCACCNONE 
J090013F02