
Summary of OsREG647 (All List)

OrganismOryza sativa  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count4056  

Entry Sequences (4056 entries)

LocusGene modelSequenceDescription
AK059848GTGGTGGGCCCCCACEmopamil-binding family protein. 
Os01g0138900AK058378TGTGGGGCCCAGTAMandelate racemase/muconate lactonizing enzyme family protein. 
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
Os01g0157600AK106766GGGGCCCACAAnkyrin repeat containing protein. 
Os01g0179000015-092-B11CAGGTGGGCCCCACCTransferase family protein. 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK105331CGCGTGGGCCCCConserved hypothetical protein. 
Os01g0198100AK119908TGTGGGCCCCConserved hypothetical protein. 
Os01g0246500AK058984GGGGCCCACCTGTCSimilar to Minus dominance protein. 
Os01g0250900AK065179TGTGGGCCCCACGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os01g0257400AK073920GGTGGGGCCCACCTGZinc finger, CCCH-type domain containing protein. 
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein. 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
Os01g0273300Os01g0273300CTGGGGCCCACCCBSD domain containing protein. 
Os01g0273800AK109645CAGGTGGGCCCCAFAD dependent oxidoreductase family protein. 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC (PK). 
AK061133AGGTGGGCCCCACCConserved hypothetical protein. 
Os01g0327500AK107756TGTGGGGCCCACTConserved hypothetical protein. 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
AK069619GGGGCCCACCCGProtein of unknown function DUF789 family protein. 
AK106476AAATGGGCCCCAGGlutaredoxin-related protein family protein. 
Os01g0541900AK069784GGGTGGGCCCCACACGProtein kinase-like domain containing protein. 
Os01g0555100AK111255CTTGGGCCCCASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
S66160GGGTGGGCCCCACGRas-related protein RIC1. 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0581300AK066182GGGGCCCAACSimilar to Lycopene epsilon-cyclase (Fragment). 
Os01g0587000AK067605GGGGCCCACTSimilar to Vacuolar ATP synthase subunit d (EC (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
AK063416GTTGGGCCGGGGCCCATTAConserved hypothetical protein. 
Os01g0596700AK107371AAATGGGCCCCAFBD domain containing protein. 
AK061752CAAGTGGGCCCCACGSimilar to NADP-isocitrate dehydrogenase. 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein. 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
AK059936TGTGGGCCCCACASimilar to RNA polymerase II transcriptional coactivator KELP. 
Os01g0716200AK062106TGTGGGCCCCCGCGIQ calmodulin-binding region domain containing protein. 
AK072600TTGTGGGCCCCProtein prenyltransferase domain containing protein. 
AK067731ACGTGGGCCCCHAD-superfamily hydrolase subfamily IIB protein. 
AK067731GGGGCCCATCTCTGTCAGTGGHAD-superfamily hydrolase subfamily IIB protein. 
Os01g0766400AK073493GTGGTGGGCCCCConserved hypothetical protein. 
Os01g0767100AK109493GGGGCCCACCTSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0767600AK070672GGGGCCCACGGGConserved hypothetical protein. 
AK070672GGTGGGGCCCACGGConserved hypothetical protein. 
Os01g0778700AK064933GGTGGGGCCCACCAConserved hypothetical protein. 
AK103408GGGGCCCACGCGTCATCCACCRNA polymerase Rpb5, N-terminal domain containing protein. 
AK072651GGTGGGGCCCACCTCyclin-like F-box domain containing protein. 
AK064237GTGGGGGCCCACGCProtein of unknown function DUF623, plant domain containing protein. 
AK120476CCTGGGCCCCAPhox-like domain containing protein. 
Os01g0836400AK073540ACGTGGGCCCCASAC3/GANP family protein. 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
AK066513CATGGGCCCCSimilar to Laccase (EC 
Os01g0844800AK099801CCACCAACTGGGCCCCACASimilar to Pumilio RBD (Fragment). 
Os01g0844900AK066659GCTGGGCCCCHomeodomain-like containing protein. 
Os01g0846300AK065949CGGGTGGGCCCCSimilar to Protein phosphatase 2C. 
AK062402GGTGGGGCCCACAConserved hypothetical protein. 
AK071410AGTGGGCCCCACCSimilar to Uricase (Fragment). 
AK121602CGGGTGGGGCCCACCGCCCACGCCCAAACProtein of unknown function DUF639 family protein. 
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein. 
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein. 
Os01g0876500J053026A07GGGGCCCACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os01g0881800AK109594CCACTGACATGTGGGCCCCACAConserved hypothetical protein. 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
AK062434GGGGCCCACGTSimilar to Ubiquitin-like protein SMT3. 
AK058869GGGGCCCACACUbiquitin-like protein SMT3. 
Os01g0923300AK067520GGGGCCCACCCBS domain containing protein. 
AK068196CCTGGGCCCCACATafazzin family protein. 
AK070047CAGGTGGGGCCCAGATSimilar to LacZ (Fragment). 
Os01g0965800AK107795AACTGGGCCCCACTCTConserved hypothetical protein. 
Os01g0966400AK103064AGTGGGCCCCACALeucine-rich repeat, SDS22 containing protein. 
AK072105ATTTGGGCCCCSimilar to NADH-dependent hydroxypyruvate reductase (EC (Fragment). 
Os02g0115700AK065094GGGGCCCACATCCACCCatalase isozyme A (EC (CAT-A). 
Os02g0120000AK067383AACTGGGCCCCAProtein prenyltransferase domain containing protein. 
Os02g0121000AK099931CGCGTGGGCTTTGTTGGGCCCCSimilar to Glutamyl-tRNA synthetase (EC (Glutamate--tRNA ligase) (GluRS). 
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1). 
Os02g0129700AK065610GTGGGGGCCCACCTHypothetical protein. 
AK109376CGTGTGGGCCCCProteasome subunit alpha type 1 (EC (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
Os02g0135700AK100570GGTGGGCCCCAGDNA polymerase V family protein. 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
AK072039GGCCGTGGGGGCCCACTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
Os02g0165500AK060547TGATGGGCCCCConserved hypothetical protein. 
AK070041ATCTGGGCCCCACGCCTCCCGGCCCCACASimilar to Phosphoglycerate kinase, cytosolic (EC 
Os02g0177700AK119941CAAGTGGGCCCCACCProtein of unknown function DUF588 family protein. 
Os02g0190900AK111037GTGGGGGCCCAAGPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CTTGGGCCCCCACConserved hypothetical protein. 
AK101844ACTGGGCCCCACCTGTetratricopeptide-like helical domain containing protein. 
AK104393CCGTGGGCCCCACCCCCCACACSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
Os02g0251900AK109286CCGTGGGCCCCACASimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0282600AK070262GTGTGGGCCCCACAConserved hypothetical protein. 
AK070262GTGTGGGGCCCACAConserved hypothetical protein. 
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein. 
Os02g0304800Os02g0304800TGGGGCCCACGTGProtein prenyltransferase domain containing protein. 
AK120516CCCCCGCGTCGTGGGCCCCACCTGMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0491300J065205O09GGTGGGGCCCACCTConserved hypothetical protein. 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
Os02g0513100AK103266CCCGTGGGGGGCCCACASimilar to MtN3 protein precursor. 
Os02g0523800AK072296CTGGGGCCCACTInositol polyphosphate kinase family protein. 
Os02g0530100AK058520GGACCCACTGACGTTGGGCCCCHeavy metal transport/detoxification protein domain containing protein. 
Os02g0534600Os02g0534600TGTGGGGCCCACAConserved hypothetical protein. 
Os02g0548900AK070239TGTGGGCCCCCACHypothetical protein. 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
AK121206AGTGGGCCCCACCCCGTCCGAProtein kinase-like domain containing protein. 
AK073086GGTGGGGCCCACCTGTCSimilar to Glutathione S-transferase. 
AK073526GACAGGTGGGCCCCACCSimilar to EL3 protein. 
AK070066CCGTGGGCCCCACAProtein of unknown function DUF962 family protein. 
AK070066TGTGGGGCCCACTProtein of unknown function DUF962 family protein. 
AK102380GGGGCCCAACAHeavy metal transport/detoxification protein domain containing protein. 
Os02g0589400009-182-H08GGGACCCACCTGGGGCCCACCAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK101791AGTGGGCCCCSimilar to Adenosine kinase-like protein (Fragment). 
AK063685GGTGGGGCCCACGCGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
AK121865TGGGGCCCAAGHypothetical protein. 
Os02g0686700AK111294CGTGGGGCCCACCTProtein of unknown function DUF581 family protein. 
AK060614TGTGGGCCCCACGGalactose oxidase, central domain containing protein. 
Os02g0709200AK058999GTCGCGCGCGTGGGCCCCSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC (Imidazole acetol-phosphate transaminase). 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0731700AK072346AATTGGGCCCCASimilar to CONSTANS-like 1 protein. 
Os02g0733500AK108506TTGTGGGCCCCParvalbumin family protein. 
Os02g0741100AK068712GGTGGGGCCCACASimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 
AK066446GGTGGGGCCCACTTGSimilar to Starch synthase isoform zSTSII-2 (EC 
Os02g0761600AK120494GGTGGGCCCCConserved hypothetical protein. 
AK058571GTTGGGCCCCGlycoside hydrolase, family 17 protein. 
Os02g0778200AK065948TCTGGGCCCCACCAminoacyl-tRNA synthetase, class I family protein. 
AK121143GGGGCCCAGAConserved hypothetical protein. 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
Os02g0794400AK065845AGATGGGCCCCAInitiation factor 3 family protein. 
Os02g0796500AK065276AAATGGGCCCCASimilar to Two-component response regulator ARR11 (Receiver-like protein 3). 
AK120644GGGGCCCACCTConserved hypothetical protein. 
Os02g0803600AK064750ACAGGTGGGCCCCLongin-like domain containing protein. 
AK064750TGTGGGCCCCALongin-like domain containing protein. 
Os02g0817500AK072707GACAGGTGGGCCCCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK069892GACAGGTGGGGCCCAGGAUX/IAA protein family protein. 
AK069892TTGTGGGCCCCACAAUX/IAA protein family protein. 
Os03g0113700AK103835CTGGGGCCCACCCGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CGGGTGGGCCCCAGProtein prenyltransferase domain containing protein. 
Os03g0113900AK107900GTGTGGGCCCCACCProtein of unknown function DUF584 family protein. 
Os03g0124300AK069148ACGCGTGGGCCCCACCConserved hypothetical protein. 
Os03g0130400AK070255TCGTGGGCCCCAdenylate kinase, subfamily protein. 
AK100656CCGTGGGCCCCCACUbiquitin domain containing protein. 
AK100656GGTCCACGTGGGGGCCCACCCUbiquitin domain containing protein. 
AK121527GTGGGGCCCACTSimilar to Small GTP-binding protein. 
Os03g0154300J065112A07AGGTGGGCCCCACGAAConserved hypothetical protein. 
AK103466CGCGGGGGGGTGGGCCCCACACLupus La protein family protein. 
Os03g0161200AK066932GTGGTGGGCCCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
AK099490CCGTGGGCCCCACCACZinc finger, Dof-type family protein. 
Os03g0169800AK068278GGTGGGCCCCACCTGTHNH nuclease domain containing protein. 
Os03g0175600AK059981GTTGGGCCCCACSimilar to Nit protein 2 (CUA002). 
Os03g0180100AK108326TCGTGGGCCCCACCCCACCACProtein of unknown function DUF1677, plant family protein. 
Os03g0184100AK067400GGTGGGGCCCAGCHypothetical protein. 
Os03g0186800AK100356GGGGCCCAGTModifier of rudimentary, Modr family protein. 
Os03g0188200AK058578GGTGGGGCCCACTZinc finger, RING-type domain containing protein. 
Os03g0206400AK066494CCTGGGCCCCACConserved hypothetical protein. 
Os03g0213600AK100407TGTGGGGCCCACCConserved hypothetical protein. 
AK100620GGGGCCCACTArmadillo-like helical domain containing protein. 
AK119298CAGGTGGGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
AK071625CAGGTGGGGCCCACTCCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0266000AK068775AACTGGGCCCCOvarian tumour, otubain domain containing protein. 
Os03g0266100AK058507GGGGCCCATCGLIM, zinc-binding domain containing protein. 
AK104129TGTGGGCCCCAClass I low-molecular-weight heat shock protein 17.9. 
Os03g0279400AK101851CCATGGGCCCCACCTGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
Os03g0294200AK069285CCCGTGGGCCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
AK061276ATTTGGGCCCCACASimilar to 40S ribosomal protein S7. 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
AK069222GGGGCCCACCTConserved hypothetical protein. 
AK071397GGTGGGGCCCACCTGTCUniversal stress protein (Usp) family protein. 
Os03g0306900AK073626CACGTGGGGTCGTGGGCCCCAGTENA/THI-4 protein domain containing protein. 
Os03g0307000J065032I03CTGGGGCCCACGACCCCACGTGHypothetical protein. 
Os03g0312500AK106657CCCACGTGGGCCCCASimilar to Inhibitor of apoptosis-like protein. 
J065136O13GGGGCCCACCCCCGCGNo apical meristem (NAM) protein domain containing protein. 
AK111509GGTGGGGCCCACCCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK070859CAAGTGGGCCCCACCSimilar to Uroporphyrinogen decarboxylase (EC (URO-D) (UPD) (Fragment). 
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 
AK064815CCCGTGGGCCCCACDormancyauxin associated family protein. 
AK059673TGTGGGGCCCACASimilar to Acyl carrier protein 1 (EC (EC 
Os03g0370000AK100033CCTGGGCCCCACCACSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 
AK100033GGTGGGGCCCACCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 
Os03g0373300AK107897TCGTGGGCCCCACGTCTCProtein of unknown function DUF1110 family protein. 
Os03g0411000AK072079GGGGCCCAAAApoptosis inhibitory 5 family protein. 
AK121551AGATGGGCCCCCACGTSimilar to Metal transport protein. 
Os03g0561249J065016H04CCTGGGCCCCConserved hypothetical protein. 
Os03g0570300AK069396GGGGCCCAGGTranslation protein SH3-like domain containing protein. 
Os03g0586300AK100442CAAGTGGGCCCCReticulon family protein. 
AK100442CAGGTGGGCCCCReticulon family protein. 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
Os03g0633900AK059181ACGTGGGCCCCACASingle-strand binding protein family protein. 
Os03g0643300AK099445AGTGGGCCCCACCACSimilar to AER123Wp. 
AK069553TGTGGGCCCCACCGATCCGSimilar to YJR013Wp (Fragment). 
Os03g0684400AK100086AACTGGGCCCCACCMg2+ transporter protein, CorA-like family protein. 
Os03g0712200AK073205GTGGTGGGGCCCAACZinc finger, RanBP2-type domain containing protein. 
J033048F03CCCACTCCCTGGGGCCCACCTGSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
Os03g0741400AK121838CTGGGGCCCACTSimilar to SUSIBA2. 
J075127J02CCTGGGCCCCACAProtein of unknown function UPF0005 family protein. 
AK102002CACGTGGGCCCCPlastocyanin-like domain containing protein. 
AK060387GCCGTTGGGTGGGCCCCACGTSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
D13224CAGGTGGGCCCCTubulin beta-1 chain (Beta-1 tubulin). 
D13224CCCGTGGGCCCCACGTTubulin beta-1 chain (Beta-1 tubulin). 
Os03g0788800AK071670CAGGTGGGCCCCZinc finger, RING-type domain containing protein. 
AK071670GTGGGGCCCACGCZinc finger, RING-type domain containing protein. 
AK067703GGTTGGGCCCCRad6 (Ubiquitin carrier protein). 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
AK105257TCGTGGGCCCCACCProtein of unknown function DUF506, plant family protein. 
Os03g0796800J065024O22CACGTGGGCCCCATCCAConserved hypothetical protein. 
Os03g0808100AK069196CAGGTGGGCCCCACCSimilar to Cellulose synthase-5. 
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein. 
AK071076TGTGGGCCCCACATGTCAGTGSimilar to Peptidyl prolyl isomerase H. 
Os03g0811800AK063320ATATGGGCCCCARibosomal protein L36 family protein. 
Os03g0832600AK120137GGTGGGCCCCACASimilar to Galactokinase (EC (Galactose kinase). 
AK067084GGGTGGGCCCCACCTGSimilar to RNA-binding protein RZ-1. 
AK065633GGGGCCCAGCProtein prenyltransferase domain containing protein. 
Os03g0844100AK067164TAATGGGCCCCACGTCTCSimilar to Pti1 kinase-like protein. 
Os03g0850100AK101126ACGTGGGGCCCACCTGNLI interacting factor domain containing protein. 
Os04g0127800AK105313GGACGGCCATGGGCCCCACCTGConserved hypothetical protein. 
AK121488CGTGTGGGCCCCAHeavy metal transport/detoxification protein domain containing protein. 
AK068202GTGGTGGGCCCCACCACSimilar to AHM2 (Fragment). 
AK069447CTGGGGCCCACCBacterial transketolase family protein. 
Os04g0282400AK120187GCTGGGCCCCACCSimilar to FPF1 protein-like (RAA1). 
AK068732AGTGGGCCCCACCSimilar to Serine carboxypeptidase I precursor (EC (Carboxypeptidase C). 
AK101795AGTGGGCCCCACGSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
AK063862CCCGTGGGGCCCACGCConserved hypothetical protein. 
AK063862GTGGGGGCCCACTCTConserved hypothetical protein. 
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
AK098921TGTGGGCCCCCACSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0399300AK105282ATATGGGCCCCACACSimilar to Nudix hydrolase 13, mitochondrial precursor (EC 3.6.1.-) (AtNUDT13). 
AK058627TGTGGGGCCCACASimilar to DNA-binding protein S1FA. 
Os04g0412900AK073418ATATGGGCCCCACASec23/Sec24 trunk region domain containing protein. 
AK073418TGTGGGCCCCACCACSec23/Sec24 trunk region domain containing protein. 
Os04g0432600AK058925CTGGGGCCCAAGConserved hypothetical protein. 
AK065178CAGGTGGGCCCCACCCGSimilar to TMV induced protein 1-2. 
AK071311TGTGGGCCCCACCSimilar to 14-3-3-like protein GF14-6. 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0480900AK109889AGTTGGGCTTTGGGCCCCAGlycoside hydrolase, family 5 protein. 
Os04g0506300AK063591TCGTGGGCCCCACCCGTMS membrane protein/tumour differentially expressed protein family protein. 
AK073718GGTGGGCCCCSimilar to Ammonium transporter Amt1;2 (Fragment). 
Os04g0512500AK107826TGGTGGGCCCCACCConserved hypothetical protein. 
Os04g0547600AK109141GGGGCCCAAGPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0559400AK106376AGATGGGCCCCACCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC (Atbcat-5). 
AK069178GGATGGGCCCCGCGTCGCExostosin-like family protein. 
AY551918GCTGGGCCCCMADS box transcription factor MADS17. 
AK105286GTGGGGCCCACCZinc finger, DHHC-type domain containing protein. 
AK072902ATTGGGCCCCARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK072824GTGGGGCCCACAAGTCAGTGGConserved hypothetical protein. 
Os04g0608300AK111353AGGTGGGCCCCACACGalactokinase family protein. 
J090067K01GCTGGGCCCCACAuxin responsive SAUR protein family protein. 
J090067K01TGTGGGGCCCATGAuxin responsive SAUR protein family protein. 
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase). 
Os04g0652900AK071125GTGGGGCCCACGGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
AK067094GGGGCCCACCCProtein of unknown function UPF0136, Transmembrane family protein. 
Os04g0661300AK070723CCCACGGGGCCCACACConserved hypothetical protein. 
Os04g0669600AK110767GGGGCCCAGGCCCAAAAPhospholipase/Carboxylesterase family protein. 
AK059734CGTGTGGGTGTGGGCCCCACCCGSimilar to ZmRR2 protein (Response regulator 2). 
Os04g0674600AK069645TGTGGGGCCCAGAOligopeptide transporter OPT superfamily protein. 
AK106193GGGGCCCACGCGTProtein of unknown function DUF1218 family protein. 
Os04g0679800AK060662CCGTGGGCCCCACGSimilar to RNA-binding protein-like protein. 
AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein. 
AK060662GACAGGTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK067481ATATGGGCCCCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
AK073341GGGGCCCACCCConserved hypothetical protein. 
Os05g0103100AK103317GGGGCCCATGTTranslocon-associated beta family protein. 
Os05g0110900AK073169AGTGGGCCCCACASimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
AK101693CGGACGGCGCGGGTGGGTGGGCCCCACASimilar to Amino acid selective channel protein. 
Os05g0112101J065141G20TGGGGCCCAGTEpsin, N-terminal domain containing protein. 
Os05g0113000AK067079TGTGGGCCCCACCTGAmino acid-binding ACT domain containing protein. 
AK070895CCTGGGCCCCACADehydroascorbate reductase. 
Os05g0119000AK069359GCGTGGGCCCCACCConserved hypothetical protein 245 family protein. 
AK099495GCTGGGCCCCACGCGXYPPX repeat containing protein. 
Os05g0137400AK065206CCACTGACATGTGGGCCCCACCTGSimilar to Aspartic protease precursor. 
AK104336CGGGTGGGCCCCACACACACCSimilar to Na+/H+ antiporter. 
Os05g0163700AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK072243CCCCCGCGTGGGCCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC (EC (Fragment). 
AK072243CGGGTGGGGCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC (EC (Fragment). 
AK072243CGTGTGGGCCCCACGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC (EC (Fragment). 
Os05g0194550J075140P14GGACCCACGTGGGCCCCACAConserved hypothetical protein. 
AK106392TGTGGGCCCCCACZinc finger, CCCH-type domain containing protein. 
Os05g0198000J080004C03TGTGGGCCCCACProtein of unknown function DUF247, plant family protein. 
AK065280GGGTGGGCCCCACCACConserved hypothetical protein. 
Os05g0217000AK062517GGTGGGGCCCACCProtein of unknown function DUF1070 family protein. 
Os05g0220600AK073669AGTGGGCCCCCACRhomboid-like protein family protein. 
AK061317GGGGCCCAAAASimilar to Ribosomal protein L13. 
Os05g0320700AK100598TGTGGGCCCCACATCCCCCACACSimilar to Cytochrome P450. 
Os05g0342100AK111106TGTGGGCCCCACCWound-induced WI12 family protein. 
AK072064GCCCCACGTGGGCCCCACGCCTCMitochondrial substrate carrier family protein. 
AK072064TCGTGGGCCCCACGGCCMitochondrial substrate carrier family protein. 
AK101263CCCGTGGGCCCCACCDrought induced 19 family protein. 
Os05g0380900AK067214CAGGTGGGCCCCACCTGTCAGSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK073634GCTGGGCCCCACCCGReticulon family protein. 
Os05g0392801J090025K15GTGGGACCCACGTGGGCCCCACGTConserved hypothetical protein. 
AK070832GGGGCCCACGGCCConserved hypothetical protein. 
AK070832TTCGTGGGGCCCACGAConserved hypothetical protein. 
Os05g0407500AK074026GTGGGGGCCCACCTEsterase/lipase/thioesterase domain containing protein. 
AK071931ACGTGGGCCCCACGTGTCConserved hypothetical protein. 
Os05g0415400AK107330CAGGTGGGGCCCAACTSimilar to OsNAC6 protein. 
AK066000AGGTGGGCCCCACCTGTCProtein kinase-like domain containing protein. 
AK103559TCGTGGGCCCCACCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0454400AK107942GCGTGGGCCCCACAConserved hypothetical protein. 
J023150E11GGGGCCCACCAACGCGTCCSimilar to 70 kDa heat shock cognate protein 1. 
Os05g0461300AK111917AATTGGGCCCCACTCCSimilar to RAB8C. 
Os05g0463400AK100354CCGTGGGCCCCACAPWWP domain containing protein. 
AK109855TGTGGGCCCCACGCCTCSimilar to Ethylene response factor 1. 
Os05g0494100AK068320GGTGGGGCCCACAAHistone-fold domain containing protein. 
Os05g0509400AK108053CAAGTGGGCCCCACASimilar to DNA binding protein-like. 
AK105433TCGTGGGCCCCACAHeat shock protein 101. 
Os05g0529300AK102648AGTGGGCCCCACGSimilar to ER lumen protein retaining receptor (HDEL receptor). 
AK063846CGTGGGGCCCACTConserved hypothetical protein. 
Os05g0533600AK067577GGTGGGGCCCAGASimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
Os05g0543700AK071113GGTGGGGCCCAGCCSimilar to Chaperone protein dnaJ. 
Os05g0553400AK108452CTGGGGCCCAACCSimilar to Myb-related transcription factor-like protein (MYB transcription factor). 
AK102111CGTGTGGGGCCCACGCGArmadillo-like helical domain containing protein. 
AK063781GGTGGGGCCCACCTGTCProtein of unknown function DUF1645 family protein. 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
Os05g0583400AK101992TGTGGGGCCCACGTGGGTCCCACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit). 
Os05g0585900AK062575GACAGGTGGGCCCCMitochondrial substrate carrier family protein. 
AK121601GGGGCCCACACGCCACSimilar to CONSTANS-like protein. 
Os06g0105900AK072638ACTGGGCCCCACACConserved hypothetical protein. 
J100048P05CCACTGACATGTGGGCCCCACGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
J100048P05TGTGGGGCCCACACQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK062901GGGGCCCATGConserved hypothetical protein. 
Os06g0136900AK107405TGGTGGGCCCCACTCCProtein of unknown function DUF296 domain containing protein. 
AK071301GGGGCCCAACTIron-superoxide dismutase (EC 
Os06g0144000AK068998TTTTGGGCCCCAGBRCT domain containing protein. 
AK106752GCCCCCACCGGGTGGGGCCCACCCCCACCACProtein of unknown function DUF250 domain containing protein. 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
AY739306CCATGGGCCCCThioredoxin domain 2 containing protein. 
Os06g0241200AK100783TGTGGGCCCCACATGTCAGTGGGTCCCAHypothetical protein. 
Os06g0268700AK120783GGGGCCCATTPeptidase A1, pepsin family protein. 
AK073079CAAGTGGGCCCCACASimilar to RF2 (EC (T cytoplasm male sterility restorer factor 2). 
AK102553TGGGGCCCACACGSimilar to 65kD microtubule associated protein. 
AK101229GCCACGTGGGCCCCACCBZR1, transcriptional repressor family protein. 
Os06g0557100AK111851CGTGGGGCCCACACProtein kinase-like domain containing protein. 
Os06g0573600AK102756AGTGGGCCCCACACGTCTCSimilar to Beta-galactosidase precursor (EC (Lactase). 
Os06g0587300AK069419CACTGACATGTGGGCCCCACAConserved hypothetical protein. 
Os06g0589500AK073322CCCGTGGGCCCCConserved hypothetical protein. 
AK062563GGGGCCCAATTConserved hypothetical protein. 
AK069376GGTGGGCCCCACCSimilar to Auxin responsive protein IAA-Re. 
AK106905GGGGCCCAAACSimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC (RNA polymerase III C39 subunit). 
Os06g0609600AK072533CCTGGGCCCCACCTGEF-Hand type domain containing protein. 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0622700AK107021CGCGTGGGCCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
Os06g0648500AK106895CGGGTGGGGCCCACGGConserved hypothetical protein. 
Os06g0666400AK108002GGGGCCCACCCACCACVQ domain containing protein. 
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein. 
J023143A16ACTGGGCCCCACCZinc finger, RING-type domain containing protein. 
Os06g0704700AK120907GGGGCCCAGCNmrA-like family protein. 
Os06g0727400AK069558CACTGACAGGTGGGCCCCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
AK071749ATCTGGGCCCCACSimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
Os07g0123300AK108490GGGGCCCACCTGConserved hypothetical protein. 
AK106244GGGGCCCACAProtein of unknown function DUF1005 family protein. 
AK065558CGCGTGGGCCCCACTCCUDP-glucose 4-epimerase family protein. 
AK065558TGTGGGGCCCAGCUDP-glucose 4-epimerase family protein. 
Os07g0146600J075074M15GGGGCCCATGGGCCAGAConserved hypothetical protein. 
Os07g0152800AK065458GGTGGGCCCCACCTGConserved hypothetical protein. 
Os07g0153400AK069618GTGGGGGCCCACCCCyclin-like F-box domain containing protein. 
AK062969GGGGCCCACGTGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0168600AK068262TGTGGGCCCCACSimilar to 3-glucanase. 
AK121818GGGGCCCACTTG2OG-Fe(II) oxygenase domain containing protein. 
AK121818TGTGGGGCCCACT2OG-Fe(II) oxygenase domain containing protein. 
Os07g0171200AK071075AGTGGGCCCCACAGalactose-1-phosphate uridyl transferase, class I family protein. 
Os07g0181800AK121080TGTGGGCCCCACTTGTCTGGCCCConserved hypothetical protein. 
Os07g0191700AK066389ACCCGCGCGACGTGGGGCCCACGCSimilar to AT.I.24-9 protein (Fragment). 
Os07g0240300AK072205AGGTGGGCCCCACGTGConserved hypothetical protein. 
Os07g0241500AK107239CACGTCACCGACACGTGGGGCCCACCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os07g0262950J033120B02CCTGGGCCCCConserved hypothetical protein. 
Os07g0474300AK108961CTGGGGCCCACAConserved hypothetical protein. 
AK073883CAAGTGGGGCCCACCTCupin, RmlC-type domain containing protein. 
AK064235TGGGGCCCACCTGTCPhosphate-induced protein 1 conserved region family protein. 
AK059124TCGTGGGCCCCACACConserved hypothetical protein. 
AK067845GGGGCCCACCCGPhospholipid/glycerol acyltransferase domain containing protein. 
Os07g0537300015-019-C12GCTGGGCCCCACCTGTCSimilar to Serine/threonine kinase receptor-like protein. 
Os07g0556000AK121938CTGACAGGTGGGCCCCACCCyclin-like domain containing protein. 
Os07g0557500AK101830AGAGTGGGCCCCACGTZinc finger, RING-type domain containing protein. 
AK119534TGGGGCCCATCCACCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
AK067895TCGTGGGCCCCACCCGCGCSimilar to ZF protein (Fragment). 
AK062660TTATGGGCCCCCACGConserved hypothetical protein. 
Os07g0569000AK073915CGTGGGGGCCCATAAConserved hypothetical protein. 
AK067725TGGTGGGCCCCCACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os07g0596600AK067238CCCGTGGGCCCCACCSimilar to Cdc2MsC protein. 
Os07g0603100AK101352CGCGTGGGGCCCACCANuclear transport factor 2 domain containing protein. 
AK101352GGGGCCCACANuclear transport factor 2 domain containing protein. 
AK064312AGTGGGCCCCACCSimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK064312GGGGCCCACTSimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK064704CCCGTGGGCCCCACCGGGCCMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
016-059-F04GGTGGGCCCCACCTGTCGGTGGGCCGTGGHeavy metal transport/detoxification protein domain containing protein. 
Os07g0608400AK109447CGATGGGCCGGGGCCCACCASimilar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)]. 
AK109447GGTGGGCCCCACGCGSimilar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)]. 
Os07g0620200AK099859ACTGACAGGTGGGCCCCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os07g0621201J065152G13ACGTGGGGCCCACAConserved hypothetical protein. 
J065152G13GGGGCCCACAConserved hypothetical protein. 
Os07g0626600Os07g0626600TGTGGGCCCCACGSimilar to Embryogenic callus protein-like. 
Os07g0659500AK073537GACACGTGGGCCCCACCNon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
AK066432CCTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK099229CACTGACATGTGGGCCCCACASimilar to Alpha-galactosidase precursor (EC (Melibiase) (Alpha-D- galactoside galactohydrolase). 
Os08g0110400AK100025AGTGACACATGGGCCCCACCCCACGCGProtein of unknown function DUF266, plant family protein. 
AK070120CAGGTGGGCCCCACCSimilar to Fructokinase (Fragment).