version

Summary of OsREG649 (All List)

OrganismOryza sativa  
IDOsREG649  
SequenceGGTCCAGA  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1223  

Entry Sequences (1223 entries)

LocusGene modelSequenceDescription
Os01g0141600016-051-A03TCTGGACCNONE 
AK066922TCTGGACCProtein of unknown function DUF647 family protein. 
Os01g0242900009-042-C12TCTGGACCNONE 
AK071658TCTGGACCConserved hypothetical protein. 
J090060H23TCTGGACCNONE 
J090083G05TCTGGACCNONE 
J090083K20TCTGGACCNONE 
J100029D18TCTGGACCNONE 
J100068A08TCTGGACCNONE 
Os01g0254800AK067017GGTCCAGAConserved hypothetical protein. 
J013089L24GGTCCAGANONE 
Os01g0276500006-030-E04GGTCCAGANONE 
AK061002GGTCCAGASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335GGTCCAGANONE 
Os01g0367100AK068655CAACGGTCCAGANONE 
AK101540CAACGGTCCAGANONE 
AK101542CAACGGTCCAGANONE 
AK119785CAACGGTCCAGAConserved hypothetical protein. 
Os01g0391100012-001-B05TCTGGACCNONE 
012-053-F01TCTGGACCNONE 
AK063499TCTGGACCNONE 
J065021A04TCTGGACCNONE 
J065076H06TCTGGACCNONE 
J065181E05TCTGGACCNONE 
J065187A05TCTGGACCNONE 
J075036C17TCTGGACCNONE 
J075051C18TCTGGACCNONE 
J075063L16TCTGGACCNONE 
J075079M08TCTGGACCNONE 
J075112H15TCTGGACCNONE 
J075135F10TCTGGACCNONE 
J075164H06TCTGGACCNONE 
J075195N02TCTGGACCNONE 
Os01g0763300009-022-H12GGTCCAGANONE 
009-036-F10GGTCCAGANONE 
009-113-G01GGTCCAGANONE 
009-184-E02GGTCCAGANONE 
014-023-A04GGTCCAGANONE 
AK063778GGTCCAGAConserved hypothetical protein. 
AK122186GGTCCAGANONE 
J023086N17GGTCCAGANONE 
J033150K13GGTCCAGANONE 
J065001D05GGTCCAGANONE 
J065042H11GGTCCAGANONE 
J065049J22GGTCCAGANONE 
J065077E09GGTCCAGANONE 
J065171I01GGTCCAGANONE 
J090044K23GGTCCAGANONE 
J100063M07GGTCCAGANONE 
Os01g0780400AK100949GGTCCAGAWD40-like domain containing protein. 
AK108379GGTCCAGANONE 
Os01g0848300AK120668GGTCCAGAProtein prenyltransferase domain containing protein. 
Os01g0878800AK070438GGTCCAGANONE 
AK104297GGTCCAGANONE 
AK105779GGTCCAGANONE 
Os01g0954100009-087-G12TCTGGACCGTTGNONE 
AK062680TCTGGACCGTTGConserved hypothetical protein. 
Os02g0116900009-017-C02GGTCCAGANONE 
AK121401GGTCCAGASimilar to 15.9 kDa subunit of RNA polymerase II. 
J013105H09GGTCCAGANONE 
J023131N03GGTCCAGANONE 
J033145N08GGTCCAGANONE 
J065105G09GGTCCAGANONE 
J075086L06GGTCCAGANONE 
Os02g0150600AK105844GGTCCAGASimilar to Pyridine nucleotide-disulphide oxidoreductase (Fragment). 
Os02g0163600AK068043GGTCCAGAConserved hypothetical protein. 
AK068043TCTGGACCConserved hypothetical protein. 
J013131O20GGTCCAGANONE 
J013131O20TCTGGACCNONE 
J065006E03GGTCCAGANONE 
J065006E03TCTGGACCNONE 
Os02g0437200AK065640GGTCCAGANONE 
AY900120GGTCCAGASimilar to SNAP-34. 
J013038P06GGTCCAGANONE 
J013146B13GGTCCAGANONE 
J065015L12GGTCCAGANONE 
J065089K05GGTCCAGANONE 
J065197E17GGTCCAGANONE 
J090077O07GGTCCAGANONE 
J100050L21GGTCCAGANONE 
J100074L24GGTCCAGANONE 
Os02g0511500AK105023GGTCCAGASimilar to Squamous-cell carcinoma T-cell-recognized antigen (Fragment). 
Os02g0528500J053035P18TCTGGACCNONE 
J053046L13TCTGGACCNONE 
J053099F11TCTGGACCNONE 
Os02g0564000AJ486976GGTCCAGANONE 
AK073086GGTCCAGASimilar to Glutathione S-transferase. 
J065021E14GGTCCAGANONE 
J065139E02GGTCCAGANONE 
J065165G05GGTCCAGANONE 
J065181H16GGTCCAGANONE 
J065217K07GGTCCAGANONE 
J065218L13GGTCCAGANONE 
J100082K21GGTCCAGANONE 
J100084K19GGTCCAGANONE 
Os02g0564100006-072-A11TCTGGACCNONE 
AK073526TCTGGACCSimilar to EL3 protein. 
AK105951TCTGGACCNONE 
J100045C15TCTGGACCNONE 
Os02g0572600AK102182GGTCCAGAProtein kinase PKN/PRK1, effector domain containing protein. 
J033086M11GGTCCAGANONE 
J065038C04GGTCCAGANONE 
J075175G13GGTCCAGANONE 
J100025A12GGTCCAGANONE 
J100025D06GGTCCAGANONE 
J100027J18GGTCCAGANONE 
J100031J12GGTCCAGANONE 
J100033E03GGTCCAGANONE 
J100043E16GGTCCAGANONE 
J100044G03GGTCCAGANONE 
J100051L16GGTCCAGANONE 
J100053C16GGTCCAGANONE 
J100055F24GGTCCAGANONE 
J100056E13GGTCCAGANONE 
J100056G17GGTCCAGANONE 
J100066J05GGTCCAGANONE 
J100080P14GGTCCAGANONE 
J100081O08GGTCCAGANONE 
J100083E16GGTCCAGANONE 
J100084L13GGTCCAGANONE 
J100088N08GGTCCAGANONE 
Os02g0597300AK064896TCTGGACCNONE 
J013000L09TCTGGACCNONE 
J053033L04TCTGGACCNONE 
J053047N16TCTGGACCNONE 
J053098G09TCTGGACCNONE 
J065052G05TCTGGACCNONE 
J065055D23TCTGGACCNONE 
J065096P16TCTGGACCNONE 
J065135B04TCTGGACCNONE 
J065180D09TCTGGACCNONE 
J065210H17TCTGGACCNONE 
Os02g0600200009-154-A06CACTGACAAGTGGGTCCAGANONE 
AK058978CACTGACAAGTGGGTCCAGANONE 
AK066974CACTGACAAGTGGGTCCAGAIQ calmodulin-binding region domain containing protein. 
Os02g0605600016-017-B02AGCCCATCCAGCCCATCTGGACCNONE 
AK066104AGCCCATCCAGCCCATCTGGACCLUC7 related family protein. 
J013052G16AGCCCATCCAGCCCATCTGGACCNONE 
J043022E03AGCCCATCCAGCCCATCTGGACCNONE 
J065105P10AGCCCATCCAGCCCATCTGGACCNONE 
Os02g0611400AK101310GGTCCAGAProtein prenyltransferase domain containing protein. 
J033024H21GGTCCAGANONE 
J033033O21GGTCCAGANONE 
J065134H24GGTCCAGANONE 
J090087E02GGTCCAGANONE 
Os02g0621700011-079-F10TCTGGACCNONE 
AK101006TCTGGACCSimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK103525TCTGGACCNONE 
J013026C02TCTGGACCNONE 
J013104M10TCTGGACCNONE 
J023003D01TCTGGACCNONE 
J023007H13TCTGGACCNONE 
J023019G09TCTGGACCNONE 
J023020L19TCTGGACCNONE 
J023022L12TCTGGACCNONE 
J023022O14TCTGGACCNONE 
J023036F16TCTGGACCNONE 
J023047D16TCTGGACCNONE 
J023052P08TCTGGACCNONE 
J023077C01TCTGGACCNONE 
J023083M06TCTGGACCNONE 
J023105A11TCTGGACCNONE 
J023117F21TCTGGACCNONE 
J023119D20TCTGGACCNONE 
J023148E03TCTGGACCNONE 
J023149B13TCTGGACCNONE 
J033029A10TCTGGACCNONE 
J033046L17TCTGGACCNONE 
J033052M04TCTGGACCNONE 
J033057M14TCTGGACCNONE 
J033066K24TCTGGACCNONE 
J033069K02TCTGGACCNONE 
J033079G14TCTGGACCNONE 
J033101E06TCTGGACCNONE 
J033116E06TCTGGACCNONE 
J033118L18TCTGGACCNONE 
J033135B13TCTGGACCNONE 
J033136C10TCTGGACCNONE 
J033136P08TCTGGACCNONE 
J043027B13TCTGGACCNONE 
J065039I03TCTGGACCNONE 
J065185N21TCTGGACCNONE 
J090008D14TCTGGACCNONE 
J090029K17TCTGGACCNONE 
J090047H20TCTGGACCNONE 
J090048N17TCTGGACCNONE 
J090085G08TCTGGACCNONE 
J090089F07TCTGGACCNONE 
Os02g0665000AK068078GGTCCAGANONE 
AK073120GGTCCAGASimilar to NADP-malic enzyme. 
J013135D10GGTCCAGANONE 
J090011H09GGTCCAGANONE 
J090054H09GGTCCAGANONE 
Os02g0764500006-061-H01GGTCCAGANONE 
009-179-B01GGTCCAGANONE 
AK066291GGTCCAGASimilar to Lhca5 protein. 
J053091A05GGTCCAGANONE 
J065012B02GGTCCAGANONE 
J065034D22GGTCCAGANONE 
J065055H23GGTCCAGANONE 
J065087E07GGTCCAGANONE 
J065104B19GGTCCAGANONE 
J065163L17GGTCCAGANONE 
Os02g0794700003-103-F03GGTCCAGANONE 
003-129-E08GGTCCAGANONE 
006-086-A10GGTCCAGANONE 
AK058513GGTCCAGASimilar to Cytosol aminopeptidase (EC 3.4.11.1) (Leucine aminopeptidase) (LAP) (Leucyl aminopeptidase) (Proline aminopeptidase) (EC 3.4.11.5) (Prolyl aminopeptidase). 
AK104150GGTCCAGANONE 
Os02g0827900AK070500TCTGGACCNONE 
AK099911GGTCCAGASimilar to Signal peptidase 18 subunit (Fragment). 
AK102344TCTGGACCNONE 
J013030L01TCTGGACCNONE 
J013109K04TCTGGACCNONE 
J033076P13TCTGGACCNONE 
J033091B18TCTGGACCNONE 
J090091J11TCTGGACCNONE 
Os03g0116400AK061443TCTGGACCSimilar to Membrane protein. 
AK102725TCTGGACCNONE 
Os03g0119000006-027-A04GGTCCAGANONE 
006-096-F10GGTCCAGANONE 
AK071417GGTCCAGAProlyl 4-hydroxylase, alpha subunit domain containing protein. 
AK104225GGTCCAGANONE 
AK104441GGTCCAGANONE 
J013129D22GGTCCAGANONE 
J023091L16GGTCCAGANONE 
J090094H21GGTCCAGANONE 
Os03g0175200J090059M15GGTCCAGANONE 
Os03g0177000AK071368GGTCCAGAGCN5-related N-acetyltransferase domain containing protein. 
Os03g0177100AK068092ATCCGACGGTCCAGAConserved hypothetical protein. 
J100036F01ATCCGACGGTCCAGANONE 
J100040N06ATCCGACGGTCCAGANONE 
J100043E08ATCCGACGGTCCAGANONE 
Os03g0201100AK102337TCTGGACCSimilar to Cyclophilin-like protein PPIL3b. 
J033091A16TCTGGACCNONE 
J075063K10TCTGGACCNONE 
J075092L23TCTGGACCNONE 
J075093A14TCTGGACCNONE 
Os03g0203000AK065462GGTCCAGAConserved hypothetical protein. 
Os03g0207400AK072292GGTCCAGASimilar to Protein phosphatase 2C-like. 
Os03g0214900AK100534TCTGGACCConserved hypothetical protein. 
Os03g0222100AK070688GGTCCAGASimilar to Topoisomerase-like protein. 
J023057E15GGTCCAGANONE 
J023099M24GGTCCAGANONE 
J023147F14GGTCCAGANONE 
Os03g0244000006-048-F02GGTCCAGATGGGCNONE 
006-049-E12GGTCCAGATGGGCNONE 
006-049-G12GGTCCAGATGGGCNONE 
006-058-C05GGTCCAGATGGGCNONE 
006-115-B08GGTCCAGATGGGCNONE 
009-072-G08GGTCCAGATGGGCNONE 
009-178-E05GGTCCAGATGGGCNONE 
AK061036GGTCCAGATGGGCConserved hypothetical protein. 
AK104109GGTCCAGATGGGCNONE 
J065036J06GGTCCAGATGGGCNONE 
J065052H12GGTCCAGATGGGCNONE 
J065071O22GGTCCAGATGGGCNONE 
J065120M19GGTCCAGATGGGCNONE 
J065140G07GGTCCAGATGGGCNONE 
J065148B11GGTCCAGATGGGCNONE 
J075031N24GGTCCAGATGGGCNONE 
J075062G05GGTCCAGATGGGCNONE 
Os03g0261500AK061995TCTGGACCNONE 
J013044K20TCTGGACCNONE 
J033113A11TCTGGACCNONE 
J100032O18TCTGGACCNONE 
J100037K21TCTGGACCNONE 
Os03g0324800AK059868TCTGGACCNONE 
AK071431TCTGGACCHypothetical protein. 
Os03g0327600014-081-C01TCTGGACCCCACACGNONE 
AK069815TCTGGACCCCACACGRicin B-related lectin domain containing protein. 
X95402TCTGGACCCCACACGNONE 
Os03g0348900006-103-E01TCTGGACCNONE 
AK059950TCTGGACCZinc finger, CHY-type domain containing protein. 
AK073680TCTGGACCNONE 
J065058L22TCTGGACCNONE 
Os03g0353300AK111467TCTGGACCConserved hypothetical protein. 
Os03g0372700AK064323TCTGGACCNONE 
AK073312TCTGGACCLow temperature viability protein family protein. 
Os03g0374100AK066002GGTCCAGAHepatocellular carcinoma-associated antigen 59 family protein. 
AK099328GGTCCAGANONE 
AK104845GGTCCAGANONE 
Os03g0376800012-038-G11GGTCCAGANONE 
012-045-H09GGTCCAGANONE 
AK062206GGTCCAGANONE 
J013040N11GGTCCAGANONE 
J013049O03GGTCCAGANONE 
J013120P04GGTCCAGANONE 
J023031F14GGTCCAGANONE 
J033150L10GGTCCAGANONE 
J065124O05GGTCCAGANONE 
J065141M11GGTCCAGANONE 
J100025A09GGTCCAGANONE 
J100035D13GGTCCAGANONE 
J100062B14GGTCCAGANONE 
Os03g0562400AK063408GTGGGTCCAGADi-copper centre-containing domain containing protein. 
Os03g0586600016-027-D02GGTCCAGANONE 
AK070943GGTCCAGASimilar to DNA-DIRECTED RNA POLYMERASES I, II, AND III 15 KD POLYPEPTIDE(RPABC6). 
J023067P18GGTCCAGANONE 
J065083J09GGTCCAGANONE 
Os03g0634000014-034-A03ACAGCCCATCTGGACCNONE 
AK063673ACAGCCCATCTGGACCSimilar to THA4. 
Os03g0646100AK100526GGTCCAGASimilar to Plastid division protein ftsZ1 precursor. 
Os03g0659900AK067560TCTGGACCGTCCGATCSimilar to S3 self-incompatibility locus-linked pollen 3.15 protein. 
J090029C14TCTGGACCGTCCGATCNONE 
Os03g0726100004-005-B05TCTGGACCCACCTGTCAGTGNONE 
006-023-C08TCTGGACCCACCTGTCAGTGNONE 
006-029-H02TCTGGACCCACCTGTCAGTGNONE 
006-032-B03TCTGGACCCACCTGTCAGTGNONE 
006-035-C10TCTGGACCCACCTGTCAGTGNONE 
006-040-H05TCTGGACCCACCTGTCAGTGNONE 
006-043-C02TCTGGACCCACCTGTCAGTGNONE 
006-046-B11TCTGGACCCACCTGTCAGTGNONE 
006-046-E05TCTGGACCCACCTGTCAGTGNONE 
006-046-H04TCTGGACCCACCTGTCAGTGNONE 
006-048-A09TCTGGACCCACCTGTCAGTGNONE 
006-050-A02TCTGGACCCACCTGTCAGTGNONE 
006-063-A02TCTGGACCCACCTGTCAGTGNONE 
006-064-A09TCTGGACCCACCTGTCAGTGNONE 
006-070-G11TCTGGACCCACCTGTCAGTGNONE 
006-072-G04TCTGGACCCACCTGTCAGTGNONE 
006-077-G12TCTGGACCCACCTGTCAGTGNONE 
006-080-F04TCTGGACCCACCTGTCAGTGNONE 
006-080-H01TCTGGACCCACCTGTCAGTGNONE 
006-084-D10TCTGGACCCACCTGTCAGTGNONE 
006-084-G06TCTGGACCCACCTGTCAGTGNONE 
006-085-H10TCTGGACCCACCTGTCAGTGNONE 
006-086-C05TCTGGACCCACCTGTCAGTGNONE 
006-087-D10TCTGGACCCACCTGTCAGTGNONE 
006-096-C09TCTGGACCCACCTGTCAGTGNONE 
006-100-F10TCTGGACCCACCTGTCAGTGNONE 
006-108-D12TCTGGACCCACCTGTCAGTGNONE 
006-115-G10TCTGGACCCACCTGTCAGTGNONE 
006-119-C09TCTGGACCCACCTGTCAGTGNONE 
006-120-E05TCTGGACCCACCTGTCAGTGNONE 
011-042-H01TCTGGACCCACCTGTCAGTGNONE 
011-075-B11TCTGGACCCACCTGTCAGTGNONE 
013-003-D03TCTGGACCCACCTGTCAGTGNONE 
013-028-B11TCTGGACCCACCTGTCAGTGNONE 
013-031-A01TCTGGACCCACCTGTCAGTGNONE 
013-035-F03TCTGGACCCACCTGTCAGTGNONE 
013-051-D02TCTGGACCCACCTGTCAGTGNONE 
013-055-D06TCTGGACCCACCTGTCAGTGNONE 
013-059-H03TCTGGACCCACCTGTCAGTGNONE 
013-076-A09TCTGGACCCACCTGTCAGTGNONE 
013-076-B01TCTGGACCCACCTGTCAGTGNONE 
013-090-F09TCTGGACCCACCTGTCAGTGNONE 
013-100-A05TCTGGACCCACCTGTCAGTGNONE 
013-100-F05TCTGGACCCACCTGTCAGTGNONE 
013-100-G12TCTGGACCCACCTGTCAGTGNONE 
014-006-G08TCTGGACCCACCTGTCAGTGNONE 
015-003-B07TCTGGACCCACCTGTCAGTGNONE 
016-093-C06TCTGGACCCACCTGTCAGTGNONE 
AF030548TCTGGACCCACCTGTCAGTGNONE 
AK102194TCTGGACCCACCTGTCAGTGSimilar to Tubulin alpha-1 chain (Alpha-1 tubulin). 
AK119247TCTGGACCCACCTGTCAGTGNONE 
AK119362TCTGGACCCACCTGTCAGTGNONE 
AK119638TCTGGACCCACCTGTCAGTGNONE 
J013066P16TCTGGACCCACCTGTCAGTGNONE 
J023022H18TCTGGACCCACCTGTCAGTGNONE 
J023087O13TCTGGACCCACCTGTCAGTGNONE 
J023121I16TCTGGACCCACCTGTCAGTGNONE 
J023123M09TCTGGACCCACCTGTCAGTGNONE 
J033022M05TCTGGACCCACCTGTCAGTGNONE 
J033087C05TCTGGACCCACCTGTCAGTGNONE 
J065022K07TCTGGACCCACCTGTCAGTGNONE 
J065024E22TCTGGACCCACCTGTCAGTGNONE 
J065041G05TCTGGACCCACCTGTCAGTGNONE 
J065045M11TCTGGACCCACCTGTCAGTGNONE 
J065082K10TCTGGACCCACCTGTCAGTGNONE 
J065121K18TCTGGACCCACCTGTCAGTGNONE 
J065137O07TCTGGACCCACCTGTCAGTGNONE 
J065144B12TCTGGACCCACCTGTCAGTGNONE 
J065152E04TCTGGACCCACCTGTCAGTGNONE 
J065159D24TCTGGACCCACCTGTCAGTGNONE 
J065217E02TCTGGACCCACCTGTCAGTGNONE 
J075014N22TCTGGACCCACCTGTCAGTGNONE 
J075064O17TCTGGACCCACCTGTCAGTGNONE 
J080316L10TCTGGACCCACCTGTCAGTGNONE 
J080318L20TCTGGACCCACCTGTCAGTGNONE 
J090034D01TCTGGACCCACCTGTCAGTGNONE 
J090034P05TCTGGACCCACCTGTCAGTGNONE 
J090041H08TCTGGACCCACCTGTCAGTGNONE 
J090042F20TCTGGACCCACCTGTCAGTGNONE 
J090042I15TCTGGACCCACCTGTCAGTGNONE 
J090050O17TCTGGACCCACCTGTCAGTGNONE 
J090054L13TCTGGACCCACCTGTCAGTGNONE 
J090062A12TCTGGACCCACCTGTCAGTGNONE 
J090068I22TCTGGACCCACCTGTCAGTGNONE 
J090070J23TCTGGACCCACCTGTCAGTGNONE 
J090070M18TCTGGACCCACCTGTCAGTGNONE 
J090084L07TCTGGACCCACCTGTCAGTGNONE 
J090087H13TCTGGACCCACCTGTCAGTGNONE 
J090095H10TCTGGACCCACCTGTCAGTGNONE 
J090099M17TCTGGACCCACCTGTCAGTGNONE 
J100022O10TCTGGACCCACCTGTCAGTGNONE 
J100048A05TCTGGACCCACCTGTCAGTGNONE 
J100057O06TCTGGACCCACCTGTCAGTGNONE 
X91806TCTGGACCCACCTGTCAGTGNONE 
Os03g0736600AK060375GGGGCCCGGTCCAGAConserved hypothetical protein. 
Os03g0750800AK061386GGTCCAGANONE 
AK072597GGTCCAGASimilar to Transcriptional adaptor (Fragment). 
Os03g0805400AK071708GGTCCAGAAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
AK102189GGTCCAGANONE 
J100053J07GGTCCAGANONE 
J100054I10GGTCCAGANONE 
J100064K03GGTCCAGANONE 
Os04g0105300006-040-C05GGTCCAGANONE 
AK060144GGTCCAGAProtein of unknown function DUF1295 family protein. 
AK101957GGTCCAGANONE 
Os04g0116200AK064677TCTGGACCProtein of unknown function DUF827, plant family protein. 
J065017D03TCTGGACCNONE 
J065095C04TCTGGACCNONE 
J065211O18TCTGGACCNONE 
J065219H18TCTGGACCNONE 
Os04g0445700AK071888GGTCCAGASimilar to 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplast precursor (EC 2.3.1.41) (Beta-ketoacyl-ACP synthase I) (KAS I). 
AK120916GGTCCAGANONE 
Os04g0470300AK059742TCTGGACCNONE 
AK070483TCTGGACCProtein of unknown function UPF0136, Transmembrane family protein. 
J065200F06TCTGGACCNONE 
J090047A18TCTGGACCNONE 
Os04g0506300AK063591ATCGGACGGTCCAGATMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08ATCGGACGGTCCAGANONE 
Os04g0529600Os04g0529600TCTGGACCLanthionine synthetase C-like family protein. 
Os04g0602600AK120600GGTCCAGAProtein prenyltransferase domain containing protein. 
J013149I02GGTCCAGANONE 
Os04g0630100AK068564TCTGGACCNAD-dependent epimerase/dehydratase family protein. 
J013151C19TCTGGACCNONE 
Os04g0661300AK070723TCTGGACCConserved hypothetical protein. 
AK103942TCTGGACCNONE 
Os04g0661900006-090-F11TCTGGACCNONE 
J053077D04TCTGGACCNONE 
J090095N01TCTGGACCNONE 
J100039F24TCTGGACCNONE 
Os05g0405400J090016P17TCTGGACCNONE 
Os05g0456000AK058420ATCCAACGGTCCAGAMitochondrial glycoprotein family protein. 
AK102036ATCCAACGGTCCAGANONE 
J065066F02ATCCAACGGTCCAGANONE 
Os05g0542200AK071306TCTGGACCEpoxide hydrolase family protein. 
AK071703TCTGGACCNONE 
Os06g0112800J090052L21GGTCCAGANONE 
Os06g0127500Os06g0127500TCTGGACCSimilar to MEG5. 
Os06g0130800014-002-A12GGTCCAGANONE 
AK069863GGTCCAGAHistone H5 family protein. 
J023037L12GGTCCAGANONE 
J065013F22GGTCCAGANONE 
J065021C09GGTCCAGANONE 
J065065E23GGTCCAGANONE 
J065066L24GGTCCAGANONE 
J065093N06GGTCCAGANONE 
J065135B12GGTCCAGANONE 
J065142J19GGTCCAGANONE 
J065163M21GGTCCAGANONE 
J065167K01GGTCCAGANONE 
J065178F24GGTCCAGANONE 
J065179A22GGTCCAGANONE 
J065196O19GGTCCAGANONE 
J075041I03GGTCCAGANONE 
J075071E18GGTCCAGANONE 
J075071F17GGTCCAGANONE 
J075125K04GGTCCAGANONE 
J075141I12GGTCCAGANONE 
J075142M02GGTCCAGANONE 
J075150G22GGTCCAGANONE 
J075151J04GGTCCAGANONE 
J075195A03GGTCCAGANONE 
J080023G18GGTCCAGANONE 
J080076P03GGTCCAGANONE 
J090051F21GGTCCAGANONE 
J090082L05GGTCCAGANONE 
U74296GGTCCAGANONE 
Os06g0167200AK100240TCTGGACCSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
J023054P08TCTGGACCNONE 
Os06g0291600AK100261TCTGGACCSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
J023063D14TCTGGACCNONE 
J090041B12TCTGGACCNONE 
Os06g0338900016-067-B02TCTGGACCATGGGCCGANONE 
AK100837TCTGGACCATGGGCCGANucleotidyl transferase domain containing protein. 
J013058L01TCTGGACCATGGGCCGANONE 
J013135N01TCTGGACCATGGGCCGANONE 
J023123E15TCTGGACCATGGGCCGANONE 
J033051J01TCTGGACCATGGGCCGANONE 
J090002O21TCTGGACCATGGGCCGANONE 
J090013F06TCTGGACCATGGGCCGANONE 
J090056F16TCTGGACCATGGGCCGANONE 
J090081G13TCTGGACCATGGGCCGANONE 
J090090P21TCTGGACCATGGGCCGANONE 
J100039F05TCTGGACCATGGGCCGANONE 
J100059J03TCTGGACCATGGGCCGANONE 
Os06g0603600012-088-B11TCTGGACCNONE 
AK063544TCTGGACCNONE 
AK072067TCTGGACCSimilar to Ids4-like protein. 
J065011H14TCTGGACCNONE 
J065020D09TCTGGACCNONE 
J065130O10TCTGGACCNONE 
J065132J07TCTGGACCNONE 
J075015L15TCTGGACCNONE 
J090091K07TCTGGACCNONE 
Os06g0659600AK110885GGTCCAGAGCCCACACConserved hypothetical protein. 
Os06g0708600009-019-C12TCTGGACCNONE 
013-092-H09TCTGGACCNONE 
014-031-G05TCTGGACCNONE 
AK100915TCTGGACCConserved hypothetical protein. 
J065065F24TCTGGACCNONE 
J065208J10TCTGGACCNONE 
J100068H01TCTGGACCNONE 
J100084D18TCTGGACCNONE 
Os06g0713300J065143C11GGTCCAGANONE 
Os07g0100200006-022-D06TCTGGACCNONE 
011-025-B06TCTGGACCNONE 
012-069-A07TCTGGACCNONE 
AK060986TCTGGACCNONE 
AK073305TCTGGACCSimilar to PDX1-like protein 4. 
J023055C05TCTGGACCNONE 
J033024J11TCTGGACCNONE 
J065045F14TCTGGACCNONE 
J075097C22TCTGGACCNONE 
Os07g0179400015-011-G09TCTGGACCNONE 
015-011-G09TCTGGACCNONE 
AK073022TCTGGACCCytidyltransferase-related domain containing protein. 
AK073022TCTGGACCCytidyltransferase-related domain containing protein. 
J023149P22TCTGGACCNONE 
J023149P22TCTGGACCNONE 
Os07g0180900006-055-B11GGTCCAGANONE 
006-103-F09GGTCCAGANONE 
011-009-E03GGTCCAGANONE 
011-035-H08GGTCCAGANONE 
014-043-F08GGTCCAGANONE 
AK060711GGTCCAGARibosomal protein L4/L1e family protein. 
AK060963GGTCCAGANONE 
AK104447GGTCCAGANONE 
AK104504GGTCCAGANONE 
AK104629GGTCCAGANONE 
J023003P15GGTCCAGANONE 
J023075H14GGTCCAGANONE 
J033101N17GGTCCAGANONE 
J033132M11GGTCCAGANONE 
J065081C24GGTCCAGANONE 
J080004L10GGTCCAGANONE 
J080009H21GGTCCAGANONE 
J080013F01GGTCCAGANONE 
J080022K24GGTCCAGANONE 
J080023C22GGTCCAGANONE 
J080024M16GGTCCAGANONE 
J080026K06GGTCCAGANONE 
J080030J23GGTCCAGANONE 
J080030L05GGTCCAGANONE 
J080031G03GGTCCAGANONE 
J080033C03GGTCCAGANONE 
J080033D02GGTCCAGANONE 
J080035A11GGTCCAGANONE 
J080035A14GGTCCAGANONE 
J080039E08GGTCCAGANONE 
J080040L15GGTCCAGANONE 
J080040M03GGTCCAGANONE 
J080041L21GGTCCAGANONE 
J080043E09GGTCCAGANONE 
J080048B14GGTCCAGANONE 
J080048O09GGTCCAGANONE 
J080051H01GGTCCAGANONE 
J080052H06GGTCCAGANONE 
J080065K05GGTCCAGANONE 
J080066D10GGTCCAGANONE 
J080066E23GGTCCAGANONE 
J080069F10GGTCCAGANONE 
J080074M06GGTCCAGANONE 
J080075D13GGTCCAGANONE 
J080076G02GGTCCAGANONE 
J080082G15GGTCCAGANONE 
J080082K06GGTCCAGANONE 
J080082P12GGTCCAGANONE 
J080085F01GGTCCAGANONE 
J080090H22GGTCCAGANONE 
J080092D07GGTCCAGANONE 
J080094M03GGTCCAGANONE 
J080094O10GGTCCAGANONE 
J090008I06GGTCCAGANONE 
J100058N20GGTCCAGANONE 
J100060M07GGTCCAGANONE 
J100062M08GGTCCAGANONE 
J100064L07GGTCCAGANONE 
J100073H16GGTCCAGANONE 
J100074C10GGTCCAGANONE 
J100075N06GGTCCAGANONE 
J100087P11GGTCCAGANONE 
J100088B13GGTCCAGANONE 
J100088J16GGTCCAGANONE 
J100088L17GGTCCAGANONE 
J100088O12GGTCCAGANONE 
Os07g0574800006-097-G09GGTCCAGANONE 
013-077-E02GGTCCAGANONE 
014-010-B04GGTCCAGANONE 
AK067721GGTCCAGATubulin alpha-1 chain. 
AK069140GGTCCAGANONE 
AK104900GGTCCAGANONE 
J013037J23GGTCCAGANONE 
J013045O05GGTCCAGANONE 
J013056A21GGTCCAGANONE 
J013119N24GGTCCAGANONE 
J023036H19GGTCCAGANONE 
J023036K16GGTCCAGANONE 
J023067J23GGTCCAGANONE 
J023075H08GGTCCAGANONE 
J023084K13GGTCCAGANONE 
J023097O10GGTCCAGANONE 
J033093K22GGTCCAGANONE 
J033105L08GGTCCAGANONE 
J065219H05GGTCCAGANONE 
J075010N07GGTCCAGANONE 
J075130I08GGTCCAGANONE 
J090014E16GGTCCAGANONE 
J090025K17GGTCCAGANONE 
J090030L19GGTCCAGANONE 
J090035J05GGTCCAGANONE 
J090036B17GGTCCAGANONE 
J090037A15GGTCCAGANONE 
J090064C17GGTCCAGANONE 
J090069L18GGTCCAGANONE 
J090073N11GGTCCAGANONE 
J090077F23GGTCCAGANONE 
J090099F02GGTCCAGANONE 
J100029N06GGTCCAGANONE 
J100056I04GGTCCAGANONE 
J100061A13GGTCCAGANONE 
J100062B10GGTCCAGANONE 
J100062J17GGTCCAGANONE 
J100072F22GGTCCAGANONE 
J100072J22GGTCCAGANONE 
J100076C03GGTCCAGANONE 
X91808GGTCCAGANONE 
Z11931GGTCCAGANONE 
Os07g0585800006-106-A05TCTGGACCNONE 
AK066419TCTGGACCNONE 
AK105064TCTGGACCSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TCTGGACCNONE 
J065085B08TCTGGACCNONE 
J065099I23TCTGGACCNONE 
J065169A01TCTGGACCNONE 
J065187N13TCTGGACCNONE 
J065191L18TCTGGACCNONE 
J065194D04TCTGGACCNONE 
J065211M09TCTGGACCNONE 
J065212I02TCTGGACCNONE 
J090003C10TCTGGACCNONE 
J090025O11TCTGGACCNONE 
J090092F10TCTGGACCNONE 
J100055A04TCTGGACCNONE 
J100064A01TCTGGACCNONE 
J100080L02TCTGGACCNONE 
Os07g0661100Os07g0661100GGTCCAGAGlycosyl transferase, family 4 protein. 
Os07g0668800003-129-B01GGTCCAGANONE 
012-093-H06GGTCCAGANONE 
AK063550GGTCCAGANONE 
AK103292GGTCCAGAConserved hypothetical protein. 
AK105114GGTCCAGANONE 
Os07g0691800AK058311GGTCCAGASimilar to 26S proteasome subunit 4-like protein (26S proteasome subunit AtRPT2a). 
AK099264GGTCCAGANONE 
AK105861GGTCCAGANONE 
D17789GGTCCAGANONE 
J065005K03GGTCCAGANONE 
J065053H14GGTCCAGANONE 
J065122H01GGTCCAGANONE 
J075115N24GGTCCAGANONE 
J090023C17GGTCCAGANONE 
J090048E03GGTCCAGANONE 
J090067G13GGTCCAGANONE 
J100037C03GGTCCAGANONE 
J100054H14GGTCCAGANONE 
J100081C14GGTCCAGANONE 
J100086K13GGTCCAGANONE 
J100087M03GGTCCAGANONE 
J100090M23GGTCCAGANONE 
Os08g0119000012-092-A02GGTCCAGANONE 
AK099289GGTCCAGANONE 
J043003N14GGTCCAGANONE 
J065089O11GGTCCAGANONE 
J065095O18GGTCCAGANONE 
J065109K03GGTCCAGANONE 
J065134L16GGTCCAGANONE 
J090023B12GGTCCAGANONE 
J090070G24GGTCCAGANONE 
Os08g0127100003-104-H01TCTGGACCNONE 
015-032-F08TCTGGACCNONE 
AK065217TCTGGACCNONE 
AK102015TCTGGACCAmino acid transporter, transmembrane family protein. 
J013002G10TCTGGACCNONE 
J013152E01TCTGGACCNONE 
J023007G24TCTGGACCNONE 
J023019F17TCTGGACCNONE 
J023074N19TCTGGACCNONE 
J023120E22TCTGGACCNONE 
J023120J05TCTGGACCNONE 
J023125E14TCTGGACCNONE 
J023145J12TCTGGACCNONE 
J033092G02TCTGGACCNONE 
J065019M06TCTGGACCNONE 
J065029J04TCTGGACCNONE 
J065031G24TCTGGACCNONE 
J065043J15TCTGGACCNONE 
J065049A17TCTGGACCNONE 
J065055N20TCTGGACCNONE 
J065062O05TCTGGACCNONE 
J065083A02TCTGGACCNONE 
J065086H21TCTGGACCNONE 
J065109F15TCTGGACCNONE 
J065121C11TCTGGACCNONE 
J065132J19TCTGGACCNONE 
J065135C06TCTGGACCNONE 
J065194N14TCTGGACCNONE 
J065201A20TCTGGACCNONE 
J100027B05TCTGGACCNONE 
J100036C02TCTGGACCNONE 
J100043G09TCTGGACCNONE 
J100048A10TCTGGACCNONE 
J100056I17TCTGGACCNONE 
J100062N21TCTGGACCNONE 
J100064N15TCTGGACCNONE 
J100082K15TCTGGACCNONE 
Os08g0138500AK102951TCTGGACCSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458TCTGGACCNONE 
J033115D14TCTGGACCNONE 
J065013F04TCTGGACCNONE 
J065050P11TCTGGACCNONE 
J065063K18TCTGGACCNONE 
J090054H10TCTGGACCNONE 
J100083F11TCTGGACCNONE 
Os08g0473600011-035-H09GGTCCAGANONE 
011-052-E06GGTCCAGANONE 
012-004-D02GGTCCAGANONE 
012-006-G11GGTCCAGANONE 
012-025-G01GGTCCAGANONE 
012-026-E10GGTCCAGANONE 
012-034-F07GGTCCAGANONE 
012-038-A04GGTCCAGANONE 
012-043-A07GGTCCAGANONE 
012-050-C12GGTCCAGANONE 
012-060-A06GGTCCAGANONE 
012-062-A07GGTCCAGANONE 
012-066-G07GGTCCAGANONE 
012-067-G12GGTCCAGANONE 
012-075-F02GGTCCAGANONE 
012-082-H06GGTCCAGANONE 
012-088-C08GGTCCAGANONE 
012-088-D06GGTCCAGANONE 
012-089-D12GGTCCAGANONE 
012-091-H05GGTCCAGANONE 
012-092-C06GGTCCAGANONE 
012-093-H01GGTCCAGANONE 
012-100-C09GGTCCAGANONE 
013-033-C02GGTCCAGANONE 
014-042-F10GGTCCAGANONE 
014-050-E03GGTCCAGANONE 
014-075-F10GGTCCAGANONE 
015-004-G11GGTCCAGANONE 
015-005-E07GGTCCAGANONE 
015-005-G08GGTCCAGANONE 
015-013-D03GGTCCAGANONE 
015-013-F04GGTCCAGANONE 
015-017-D03GGTCCAGANONE 
015-048-D02GGTCCAGANONE 
015-049-D02GGTCCAGANONE 
015-092-F03GGTCCAGANONE 
016-019-H02GGTCCAGANONE 
016-027-F03GGTCCAGANONE 
016-096-D06GGTCCAGANONE 
AK064071GGTCCAGANONE 
AK064300GGTCCAGAAlpha-amylase isozyme 3E precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
AK103413GGTCCAGANONE 
AK106526GGTCCAGANONE 
J033030A15GGTCCAGANONE 
J033040E10GGTCCAGANONE 
J033057P15GGTCCAGANONE 
J033127G12GGTCCAGANONE 
J033128G11GGTCCAGANONE 
J053054F05GGTCCAGANONE 
J065006J19GGTCCAGANONE 
J065007M11GGTCCAGANONE 
J065013H10GGTCCAGANONE 
J065015G17GGTCCAGANONE 
J065019C10GGTCCAGANONE 
J065020H22GGTCCAGANONE 
J065022H12GGTCCAGANONE 
J065024C08GGTCCAGANONE 
J065029F11GGTCCAGANONE 
J065036D04GGTCCAGANONE 
J065039F22GGTCCAGANONE 
J065042G09GGTCCAGANONE 
J065045L16GGTCCAGANONE 
J065046M13GGTCCAGANONE 
J065049E18GGTCCAGANONE 
J065052H21GGTCCAGANONE 
J065053G17GGTCCAGANONE 
J065066H10GGTCCAGANONE 
J065069M24GGTCCAGANONE 
J065070P07GGTCCAGANONE 
J065073O06GGTCCAGANONE 
J065078G19GGTCCAGANONE 
J065082P16GGTCCAGANONE 
J065086P15GGTCCAGANONE 
J065093H11GGTCCAGANONE 
J065097A14GGTCCAGANONE 
J065103D19GGTCCAGANONE 
J065105A18GGTCCAGANONE 
J065108N23GGTCCAGANONE 
J065109N14GGTCCAGANONE 
J065121K22GGTCCAGANONE 
J065122C18GGTCCAGANONE 
J065129L03GGTCCAGANONE 
J065130B11GGTCCAGANONE 
J065135P07GGTCCAGANONE 
J065139B03GGTCCAGANONE 
J065144O11GGTCCAGANONE 
J065163I17GGTCCAGANONE 
J065163J15GGTCCAGANONE 
J065177G16GGTCCAGANONE 
J065186D17GGTCCAGANONE 
J065187D02GGTCCAGANONE 
J065188L03GGTCCAGANONE 
J065191L02GGTCCAGANONE 
J065193F09GGTCCAGANONE 
J065197J03GGTCCAGANONE 
J065200F07GGTCCAGANONE 
J065208K11GGTCCAGANONE 
J065211I22GGTCCAGANONE 
J065213O22GGTCCAGANONE 
J065213P22GGTCCAGANONE 
Os09g0127800AK103786CAACGGTCCAGASimilar to Coatomer alpha subunit. 
Os09g0322300AK107151ATCCAACGGTCCAGAHypothetical protein. 
J075023P17ATCCAACGGTCCAGANONE 
J075143O05ATCCAACGGTCCAGANONE 
Os09g0394600AK065379GGTCCAGAInositol polyphosphate related phosphatase domain containing protein. 
Os09g0400700009-060-D04GGTCCAGANONE 
009-104-G09GGTCCAGANONE 
009-106-D08GGTCCAGANONE 
014-041-F03GGTCCAGANONE 
AK062784GGTCCAGAConserved hypothetical protein. 
Os09g0450901J065009G09GGTCCAGANONE 
J065015O13GGTCCAGANONE 
J065082C06GGTCCAGAConserved hypothetical protein. 
Os09g0525700AK064676GGTCCAGAConserved hypothetical protein. 
Os09g0532800J065167K16GGTCCAGAGCCCATATProtein prenyltransferase domain containing protein. 
Os09g0539100AK071977GGTCCAGASimilar to 3-dehydroquinate synthase-like protein. 
AK098959GGTCCAGANONE 
Os09g0557900AK107999GGTCCAGANONE 
AK108807GGTCCAGASimilar to Protein phosphatase 2C gamma isoform (EC 3.1.3.16) (PP2C-gamma) (Protein phosphatase magnesium-dependent 1 gamma) (Protein phosphatase 1C) (Fibroblast growth factor inducible protein 13) (FIN13). 
J075028G15GGTCCAGANONE 
J075129K23GGTCCAGANONE 
J075159K01GGTCCAGANONE 
J075192F10GGTCCAGANONE 
J080018P13GGTCCAGANONE 
J080021E17GGTCCAGANONE 
J080022I11GGTCCAGANONE 
J080029C07GGTCCAGANONE 
J080034N15GGTCCAGANONE 
J080038L24GGTCCAGANONE 
J080039C15GGTCCAGANONE 
J080040E11GGTCCAGANONE 
J080055L15GGTCCAGANONE 
J080077G08GGTCCAGANONE 
J080080A20GGTCCAGANONE 
Os11g0109700003-126-G04GGTCCAGANONE 
AK059364GGTCCAGAProtein of unknown function Cys-rich family protein. 
AK065601GGTCCAGANONE 
AK072035GGTCCAGANONE 
AK120107GGTCCAGANONE 
Os11g0176000AK105568TCTGGACCWD40-like domain containing protein. 
Os11g0270000J100043N02GGTCCAGAConserved hypothetical protein. 
J100049K11GGTCCAGANONE 
J100069O14GGTCCAGANONE 
Os11g0444700006-038-B02TCTGGACCNONE 
006-109-D01TCTGGACCNONE 
009-059-B05TCTGGACCNONE 
AK066452TCTGGACCOcticosapeptide/Phox/Bem1p domain containing protein. 
AK104816TCTGGACCNONE 
J013026N06TCTGGACCNONE 
J013061N18TCTGGACCNONE 
J013074P06TCTGGACCNONE 
J013121I11TCTGGACCNONE 
J013159L19TCTGGACCNONE 
J023029I15TCTGGACCNONE 
J023074A09TCTGGACCNONE 
J033108B05TCTGGACCNONE 
J043013A16TCTGGACCNONE 
J065006P22TCTGGACCNONE 
J065017F01TCTGGACCNONE 
J065043M12TCTGGACCNONE 
J065043M20TCTGGACCNONE 
J065078G09TCTGGACCNONE 
J065090O18TCTGGACCNONE 
J065112I16TCTGGACCNONE 
J065115E06TCTGGACCNONE 
J065121G09TCTGGACCNONE 
J065161D12TCTGGACCNONE 
J065162H03TCTGGACCNONE 
J065168C17TCTGGACCNONE 
J065216I09TCTGGACCNONE 
J075029K20TCTGGACCNONE 
J075066H23TCTGGACCNONE 
J075149F23TCTGGACCNONE 
J080003D11TCTGGACCNONE 
J080008B08TCTGGACCNONE 
J080008E06TCTGGACCNONE 
J080013B17TCTGGACCNONE 
J080013H15TCTGGACCNONE 
J080013J10TCTGGACCNONE 
J080022G13TCTGGACCNONE 
J080023H13TCTGGACCNONE 
J080025L12TCTGGACCNONE 
J080027F17TCTGGACCNONE 
J080027L02TCTGGACCNONE 
J080028C21TCTGGACCNONE 
J080037D11TCTGGACCNONE 
J080040N11TCTGGACCNONE 
J080041I24TCTGGACCNONE 
J080043H11TCTGGACCNONE 
J080045G24TCTGGACCNONE 
J080047K12TCTGGACCNONE 
J080048D06TCTGGACCNONE 
J080048D23TCTGGACCNONE 
J080050B15TCTGGACCNONE 
J080050E22TCTGGACCNONE 
J080053F11TCTGGACCNONE 
J080057C14TCTGGACCNONE 
J080057E09TCTGGACCNONE 
J080063E01TCTGGACCNONE 
J080064I19TCTGGACCNONE 
J080065C13TCTGGACCNONE 
J080067I03TCTGGACCNONE 
J080068F04TCTGGACCNONE 
J080070B08TCTGGACCNONE 
J080071P03TCTGGACCNONE 
J080074H04TCTGGACCNONE 
J080074I18TCTGGACCNONE 
J080075J24TCTGGACCNONE 
J080077N07TCTGGACCNONE 
J080082B01TCTGGACCNONE 
J080095L11TCTGGACCNONE 
J100053N24TCTGGACCNONE 
Os11g0444900009-136-A09TCTGGACCNONE 
009-154-A11TCTGGACCNONE 
AF493074TCTGGACCOcticosapeptide/Phox/Bem1p domain containing protein. 
J053033M12TCTGGACCNONE 
J053074N04TCTGGACCNONE 
J053075A20TCTGGACCNONE 
J053095D10TCTGGACCNONE 
J065034G24TCTGGACCNONE 
J065102M17TCTGGACCNONE 
J065214D08TCTGGACCNONE 
J075010E19TCTGGACCNONE 
J075010L20TCTGGACCNONE 
J075017G03TCTGGACCNONE 
J075098J18TCTGGACCNONE 
J075130C14TCTGGACCNONE 
J075132P21TCTGGACCNONE 
J075134G15TCTGGACCNONE 
J075145F02TCTGGACCNONE 
J075182B15TCTGGACCNONE 
J075186G06TCTGGACCNONE 
J100045J19TCTGGACCNONE 
J100061O07TCTGGACCNONE 
J100090H07TCTGGACCNONE 
Os12g0145700AK071391GGTCCAGAPyruvate kinase family protein. 
J023013N02GGTCCAGANONE 
J033085D15GGTCCAGANONE 
J043021I09GGTCCAGANONE 
J100055L05GGTCCAGANONE 
Os12g0242100006-114-F12GGTCCAGANONE 
AK109396GGTCCAGASimilar to Glycine-rich cell wall structural protein 1 precursor. 
Os12g0288000AK069283GGTCCAGAProtein of unknown function DUF6, transmembrane domain containing protein. 
AK100993GGTCCAGANONE 
J080302K21GGTCCAGANONE 
J080309K03GGTCCAGANONE 
J080311D18GGTCCAGANONE 
J080312M01GGTCCAGANONE 
J080317J17GGTCCAGANONE 
J080318J16GGTCCAGANONE 
J080319M08GGTCCAGANONE 
J080319P03GGTCCAGANONE 
Os12g0291100013-021-D10GGTCCAGANONE 
013-038-B12GGTCCAGANONE 
AK068555GGTCCAGASimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
AY445627GGTCCAGANONE 
D00644GGTCCAGANONE 
J013156H12GGTCCAGANONE 
J023122F15GGTCCAGANONE 
J065001F13GGTCCAGANONE 
J065001O16GGTCCAGANONE 
J065006D15GGTCCAGANONE 
J065008I17GGTCCAGANONE 
J065008N22GGTCCAGANONE 
J065010K05GGTCCAGANONE 
J065015G11GGTCCAGANONE 
J065019H21GGTCCAGANONE 
J065020N17GGTCCAGANONE 
J065024O18GGTCCAGANONE 
J065025A04GGTCCAGANONE 
J065026I06GGTCCAGANONE 
J065028C06GGTCCAGANONE 
J065029C01GGTCCAGANONE 
J065029C06GGTCCAGANONE 
J065029D16GGTCCAGANONE 
J065029E02GGTCCAGANONE 
J065030P11GGTCCAGANONE 
J065032M13GGTCCAGANONE 
J065034C06GGTCCAGANONE 
J065037H24GGTCCAGANONE 
J065037O14GGTCCAGANONE 
J065038A12GGTCCAGANONE 
J065043A05GGTCCAGANONE 
J065046C06GGTCCAGANONE 
J065046D22GGTCCAGANONE 
J065048C14GGTCCAGANONE 
J065048D24GGTCCAGANONE 
J065049F19GGTCCAGANONE 
J065050C04GGTCCAGANONE 
J065052J16GGTCCAGANONE 
J065055E07GGTCCAGANONE 
J065055I04GGTCCAGANONE 
J065060L04GGTCCAGANONE 
J065062I15GGTCCAGANONE 
J065062J11GGTCCAGANONE 
J065065I12GGTCCAGANONE 
J065068C24GGTCCAGANONE 
J065069M04GGTCCAGANONE 
J065071J22GGTCCAGANONE 
J065076A12GGTCCAGANONE 
J065076C24GGTCCAGANONE 
J065076F09GGTCCAGANONE 
J065076F16GGTCCAGANONE 
J065077O06GGTCCAGANONE 
J065081E14GGTCCAGANONE 
J065082K22GGTCCAGANONE 
J065082L04GGTCCAGANONE 
J065085B02GGTCCAGANONE 
J065089C21GGTCCAGANONE 
J065092L07GGTCCAGANONE 
J065093G08GGTCCAGANONE 
J065093I19GGTCCAGANONE 
J065093K24GGTCCAGANONE 
J065093N04GGTCCAGANONE 
J065094I09GGTCCAGANONE 
J065094N19GGTCCAGANONE 
J065095J17GGTCCAGANONE 
J065095N24GGTCCAGANONE 
J065096B17GGTCCAGANONE 
J065096C02GGTCCAGANONE 
J065097P18GGTCCAGANONE 
J065099E07GGTCCAGANONE 
J065103D23GGTCCAGANONE 
J065104F04GGTCCAGANONE 
J065104L17GGTCCAGANONE 
J065111L14GGTCCAGANONE 
J065112K11GGTCCAGANONE 
J065115P09GGTCCAGANONE 
J065123A02GGTCCAGANONE 
J065127P14GGTCCAGANONE 
J065137E16GGTCCAGANONE 
J065138H20GGTCCAGANONE 
J065138J11GGTCCAGANONE 
J065141K23GGTCCAGANONE 
J065141L14GGTCCAGANONE 
J065143P04GGTCCAGANONE 
J065146N12GGTCCAGANONE 
J065147F21GGTCCAGANONE 
J065147N15GGTCCAGANONE 
J065154L06GGTCCAGANONE 
J065156C09GGTCCAGANONE 
J065156J18GGTCCAGANONE 
J065157C19GGTCCAGANONE 
J065159H23GGTCCAGANONE 
J065159M08GGTCCAGANONE 
J065163B19GGTCCAGANONE 
J065164K14GGTCCAGANONE 
J065166K07GGTCCAGANONE 
J065166O07GGTCCAGANONE 
J065168A18GGTCCAGANONE 
J065170B18GGTCCAGANONE 
J065170D18GGTCCAGANONE 
J065173E05GGTCCAGANONE 
J065174L23GGTCCAGANONE 
J065177F08GGTCCAGANONE 
J065177I05GGTCCAGANONE 
J065178P20GGTCCAGANONE 
J065181G24GGTCCAGANONE 
J065182A07GGTCCAGANONE 
J065183D24GGTCCAGANONE 
J065184K10GGTCCAGANONE 
J065185F09GGTCCAGANONE 
J065185P10GGTCCAGANONE 
J065186J16GGTCCAGANONE 
J065188K23GGTCCAGANONE 
J065190E22GGTCCAGANONE 
J065191D06GGTCCAGANONE 
J065193C05GGTCCAGANONE 
J065193N13GGTCCAGANONE 
J065194B15GGTCCAGANONE 
J065199C03GGTCCAGANONE 
J065200P19GGTCCAGANONE 
J065202O18GGTCCAGANONE 
J065203F16GGTCCAGANONE 
J065204A15GGTCCAGANONE 
J065206P13GGTCCAGANONE 
J065207P12GGTCCAGANONE 
J065210J24GGTCCAGANONE 
J065211K01GGTCCAGANONE 
J065213O21GGTCCAGANONE 
J065215L18GGTCCAGANONE 
J065216N22GGTCCAGANONE 
J065219A16GGTCCAGANONE 
J065219C24GGTCCAGANONE 
J075012P04GGTCCAGANONE 
J075013K19GGTCCAGANONE 
J075028N24GGTCCAGANONE 
J075028P16GGTCCAGANONE 
J075032H22GGTCCAGANONE 
J075032J18GGTCCAGANONE 
J075042O14GGTCCAGANONE 
J075047A04GGTCCAGANONE 
J075053A16GGTCCAGANONE 
J075064C23GGTCCAGANONE 
J075072H11GGTCCAGANONE 
J075073C03GGTCCAGANONE 
J075081G11GGTCCAGANONE 
J075093H04GGTCCAGANONE 
J075095A11GGTCCAGANONE 
J075095C13GGTCCAGANONE 
J075100D18GGTCCAGANONE 
J075101P08GGTCCAGANONE 
J075114G11GGTCCAGANONE 
J075118D19GGTCCAGANONE 
J075122K13GGTCCAGANONE 
J075125G22GGTCCAGANONE 
J075129E22GGTCCAGANONE 
J075129I07GGTCCAGANONE 
J075132C12GGTCCAGANONE 
J075135E24GGTCCAGANONE 
J075136I06GGTCCAGANONE 
J075136O07GGTCCAGANONE 
J075138I07GGTCCAGANONE 
J075142G08GGTCCAGANONE 
J075147J22GGTCCAGANONE 
J075150H20GGTCCAGANONE 
J075151A15GGTCCAGANONE 
J075151G24GGTCCAGANONE 
J075151J20GGTCCAGANONE 
J075156N21GGTCCAGANONE 
J075158O12GGTCCAGANONE 
J075161E05GGTCCAGANONE 
J075166F17GGTCCAGANONE 
J075169M10GGTCCAGANONE 
J075174K15GGTCCAGANONE 
J075179F17GGTCCAGANONE 
J075185G15GGTCCAGANONE 
J075188P12GGTCCAGANONE 
J075191P15GGTCCAGANONE 
J075192A13GGTCCAGANONE 
J075197E23GGTCCAGANONE 
J075197M02GGTCCAGANONE 
J075198M16GGTCCAGANONE 
J080020B11GGTCCAGANONE 
J080021M20GGTCCAGANONE 
J080066K02GGTCCAGANONE 
J080301F01GGTCCAGANONE 
J080301G19GGTCCAGANONE 
J080305G02GGTCCAGANONE 
J080306N09GGTCCAGANONE 
J080309D21GGTCCAGANONE 
J080309I02GGTCCAGANONE 
J080313J11GGTCCAGANONE 
J080313P09GGTCCAGANONE 
J080315B10GGTCCAGANONE 
J080315O13GGTCCAGANONE 
J080316G02GGTCCAGANONE 
J080317F03GGTCCAGANONE 
J080318D17GGTCCAGANONE 
J080319C10GGTCCAGANONE 
J090017E03GGTCCAGANONE 
J090034N22GGTCCAGANONE 
J090042G07GGTCCAGANONE 
J090062P21GGTCCAGANONE 
J090082D08GGTCCAGANONE 
J090096M13GGTCCAGANONE 
J100086J22GGTCCAGANONE 
Os12g0407100J075130F11CAACGGTCCAGANONE 
J075150G14CAACGGTCCAGAConserved hypothetical protein. 
J090089B20CAACGGTCCAGANONE 
J100042D22CAACGGTCCAGANONE 
Os12g0541400AK101210TCTGGACCPrefoldin domain containing protein. 
J033031A17TCTGGACCNONE 
J090051F01TCTGGACCNONE 
Os12g0576300AK058735TCTGGACCHypothetical protein. 
Os12g0617900AK062131TCTGGACCNONE 
J013001J19TCTGGACCNONE 
J013002D13TCTGGACCNONE 
J013071J10TCTGGACCNONE 
J013106M08TCTGGACCNONE 
J013118K02TCTGGACCNONE 
J075027K24TCTGGACCNONE 
J075048E18TCTGGACCNONE 
J075048G24TCTGGACCNONE 
J075101H19TCTGGACCNONE 
J075119O22TCTGGACCNONE 
J075143K24TCTGGACCNONE 
J090069P17TCTGGACCNONE 
Os12g0636200AK104872TCTGGACCNONE 
J013022E02TCTGGACCNONE 
J013120K03TCTGGACCNONE 
J013126K24TCTGGACCNONE 
J023054P21TCTGGACCNONE 
J023122O08TCTGGACCNONE 
J033041N06TCTGGACCNONE 
J033098M10TCTGGACCNONE 
J043012P03TCTGGACCNONE 
J065165C08TCTGGACCNONE 
J065194H22TCTGGACCNONE 
J065217M08TCTGGACCNONE 
J065218K08TCTGGACCNONE 
J090015F16TCTGGACCNONE 
J090064D22TCTGGACCNONE 
J090065L20TCTGGACCNONE 
J090077G18TCTGGACCNONE 
J090088E05TCTGGACCNONE 
J100019F24TCTGGACCNONE 
J100048B22TCTGGACCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.