version

Summary of OsREG650 (All List)

OrganismOryza sativa  
IDOsREG650  
SequenceGGTCCCAC  
Annotation  
PPDB MotifGGGACCC  function unknown  
PLACE Motif 
Total Entry Count1636  

Entry Sequences (1636 entries)

LocusGene modelSequenceDescription
Os01g0102600AK064812GGTGGGACCCACShikimate kinase domain containing protein. 
J013000E05GGTGGGACCCACNONE 
J013027D08GGTGGGACCCACNONE 
J013045K12GGTGGGACCCACNONE 
J023119M03GGTGGGACCCACNONE 
J065081F02GGTGGGACCCACNONE 
J065180C08GGTGGGACCCACNONE 
J065211M06GGTGGGACCCACNONE 
J075073J06GGTGGGACCCACNONE 
J075123A18GGTGGGACCCACNONE 
J075124A07GGTGGGACCCACNONE 
J075187B05GGTGGGACCCACNONE 
Os01g0103600006-072-A01GTGGGTCCCACNONE 
009-148-C12GTGGGTCCCACNONE 
AK059848GTGGGTCCCACEmopamil-binding family protein. 
AK102848GTGGGTCCCACNONE 
J033036P20GTGGGTCCCACNONE 
J065171N21GTGGGTCCCACNONE 
J065209M02GTGGGTCCCACNONE 
J075067A03GTGGGTCCCACNONE 
J075110C09GTGGGTCCCACNONE 
Os01g0143800006-025-F03TGGGTCCCACNONE 
006-028-B11TGGGTCCCACNONE 
006-050-B02TGGGTCCCACNONE 
006-063-C08TGGGTCCCACNONE 
006-100-C05TGGGTCCCACNONE 
AK066079TGGGTCCCACMitochondrial glycoprotein family protein. 
AK104561TGGGTCCCACNONE 
AK104721TGGGTCCCACNONE 
J013052K21TGGGTCCCACNONE 
J033051K24TGGGTCCCACNONE 
Os01g0144600009-164-E06GGTCCCACCTGTCNONE 
AK063058GGTCCCACCTGTCNONE 
J065061I15GGTCCCACCTGTCNONE 
J065128M13GGTCCCACCTGTCNONE 
J065152N15GGTCCCACCTGTCNONE 
J075170M11GGTCCCACCTGTCNONE 
J090071M11GGTCCCACCTGTCNONE 
J090073B22GGTCCCACCTGTCNONE 
Os01g0147700AK066686GACAGGTGGGACCCACCCGRegion of unknown function, putative Zinc finger, XS and XH domain containing protein. 
Os01g0172300AK106113GGTGGGACCCAConserved hypothetical protein. 
Os01g0180300AK120377GTGGGTCCCACCACLipoprotein, type 6 family protein. 
J013071N06GTGGGTCCCACCACNONE 
J023088F12GTGGGTCCCACCACNONE 
J100027H24GTGGGTCCCACCACNONE 
J100053K15GTGGGTCCCACCACNONE 
J100082M15GTGGGTCCCACCACNONE 
Os01g0198100AK119908TGGGTCCCACConserved hypothetical protein. 
Os01g0206600J065041P19GTGGGACCConserved hypothetical protein. 
Os01g0273300Os01g0273300GGTCCCACACGBSD domain containing protein. 
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein. 
AK109672TTCGTGGGTCCCACConserved hypothetical protein. 
J065013K07GGTGGGACCCACGTGGACACGTGGCNONE 
J065013K07TTCGTGGGTCCCACNONE 
J065040E15GGTGGGACCCACGTGGACACGTGGCNONE 
J065040E15TTCGTGGGTCCCACNONE 
J065127F12GGTGGGACCCACGTGGACACGTGGCNONE 
J065127F12TTCGTGGGTCCCACNONE 
J075155K23GGTGGGACCCACGTGGACACGTGGCNONE 
J075155K23TTCGTGGGTCCCACNONE 
Os01g0301700003-118-B08GTGGGTCCCACNONE 
016-048-H09GTGGGTCCCACNONE 
AK064223GTGGGTCCCACNONE 
AK100563GTGGGTCCCACProtein prenyltransferase domain containing protein. 
J023104I21GTGGGTCCCACNONE 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0391100AK108533CGCGTGGGACCCACCTGNONE 
AK121200CGCGTGGGACCCACCTGSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
J023042H11CGCGTGGGACCCACCTGNONE 
J023087I02CGCGTGGGACCCACCTGNONE 
J065099C01CGCGTGGGACCCACCTGNONE 
Os01g0517800J075194B21GGTCCCACProtein of unknown function DUF597 family protein. 
Os01g0528300009-015-C05GTGGGTCCCACCNONE 
AK062349GTGGGTCCCACCSimilar to HcrVf3 protein. 
Os01g0618200AK102319GGTCCCACProtein phosphatase 2C family protein. 
Os01g0654500013-057-E05GACAGGTGGGACCCANONE 
AF155333GACAGGTGGGACCCANONE 
AK061752GACAGGTGGGACCCASimilar to NADP-isocitrate dehydrogenase. 
D21069GACAGGTGGGACCCANONE 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
Os01g0694800015-093-H11GTGGGACCCACGTGGGCCCCACANONE 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os01g0699400AK107168GGTCCCACProtein kinase-like domain containing protein. 
Os01g0719400012-066-H10GTGGGACCNONE 
AK063516GTGGGACCConserved hypothetical protein. 
Os01g0723000AK073592GGTGGGACCSimilar to Elongation factor EF-2 (Fragment). 
AK102586GGTGGGACCNONE 
J033048F11GGTGGGACCNONE 
J033098E24GGTGGGACCNONE 
Os01g0745400AK107872AAAGCCCATGTGGGACCCACSec34-like protein family protein. 
Os01g0764000006-021-G03GGTCCCACNONE 
006-025-C07GGTCCCACNONE 
006-029-G11GGTCCCACNONE 
006-030-C04GGTCCCACNONE 
006-035-E05GGTCCCACNONE 
006-037-G01GGTCCCACNONE 
006-038-C01GGTCCCACNONE 
006-039-G05GGTCCCACNONE 
006-042-E11GGTCCCACNONE 
006-044-H04GGTCCCACNONE 
006-045-A10GGTCCCACNONE 
006-045-C05GGTCCCACNONE 
006-047-A11GGTCCCACNONE 
006-048-H10GGTCCCACNONE 
006-050-C01GGTCCCACNONE 
006-050-H11GGTCCCACNONE 
006-051-G10GGTCCCACNONE 
006-051-G11GGTCCCACNONE 
006-056-B04GGTCCCACNONE 
006-063-F04GGTCCCACNONE 
006-063-H12GGTCCCACNONE 
006-065-G09GGTCCCACNONE 
006-067-F11GGTCCCACNONE 
006-073-D10GGTCCCACNONE 
006-074-G09GGTCCCACNONE 
006-075-D04GGTCCCACNONE 
006-077-C10GGTCCCACNONE 
006-082-A10GGTCCCACNONE 
006-084-C12GGTCCCACNONE 
006-085-F05GGTCCCACNONE 
006-087-H12GGTCCCACNONE 
006-092-E10GGTCCCACNONE 
006-094-C06GGTCCCACNONE 
006-096-G11GGTCCCACNONE 
006-097-H11GGTCCCACNONE 
006-101-A07GGTCCCACNONE 
006-101-G08GGTCCCACNONE 
006-110-E08GGTCCCACNONE 
006-111-D04GGTCCCACNONE 
006-116-H04GGTCCCACNONE 
AK058894GGTCCCACNONE 
AK059818GGTCCCACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142GGTCCCACNONE 
J013119N15GGTCCCACNONE 
J013123P15GGTCCCACNONE 
J023055F24GGTCCCACNONE 
J023125K17GGTCCCACNONE 
J053050A20GGTCCCACNONE 
J053056P10GGTCCCACNONE 
J053074D19GGTCCCACNONE 
J053078A14GGTCCCACNONE 
J053086P10GGTCCCACNONE 
J053094N23GGTCCCACNONE 
J053095M23GGTCCCACNONE 
J065006D02GGTCCCACNONE 
J065030A17GGTCCCACNONE 
J065030K04GGTCCCACNONE 
J065035L12GGTCCCACNONE 
J065046E12GGTCCCACNONE 
J065065H19GGTCCCACNONE 
J065073C01GGTCCCACNONE 
J065105F01GGTCCCACNONE 
J065131N16GGTCCCACNONE 
J065144O13GGTCCCACNONE 
J065160E12GGTCCCACNONE 
J065160K02GGTCCCACNONE 
J065163F09GGTCCCACNONE 
J065165E18GGTCCCACNONE 
J065174E04GGTCCCACNONE 
J065175O08GGTCCCACNONE 
J065191N24GGTCCCACNONE 
J065193D19GGTCCCACNONE 
J065198D04GGTCCCACNONE 
J065200G09GGTCCCACNONE 
J075016L06GGTCCCACNONE 
J075017J11GGTCCCACNONE 
J075019L08GGTCCCACNONE 
J075028M08GGTCCCACNONE 
J075029K05GGTCCCACNONE 
J075039K04GGTCCCACNONE 
J075047J22GGTCCCACNONE 
J075079H13GGTCCCACNONE 
J075095K14GGTCCCACNONE 
J075111D21GGTCCCACNONE 
J075131A19GGTCCCACNONE 
J075147G20GGTCCCACNONE 
J075158F11GGTCCCACNONE 
J075166N10GGTCCCACNONE 
J075196G09GGTCCCACNONE 
J075198I24GGTCCCACNONE 
J090001L08GGTCCCACNONE 
J090026G07GGTCCCACNONE 
J090050M15GGTCCCACNONE 
J090071A01GGTCCCACNONE 
J090072P16GGTCCCACNONE 
J090078D22GGTCCCACNONE 
J090089C18GGTCCCACNONE 
J100019B07GGTCCCACNONE 
J100019H15GGTCCCACNONE 
J100019P09GGTCCCACNONE 
J100023A16GGTCCCACNONE 
J100023B09GGTCCCACNONE 
J100026O18GGTCCCACNONE 
J100027E09GGTCCCACNONE 
J100028F22GGTCCCACNONE 
J100029P05GGTCCCACNONE 
J100031M19GGTCCCACNONE 
J100032A11GGTCCCACNONE 
J100036G19GGTCCCACNONE 
J100038E22GGTCCCACNONE 
J100040A12GGTCCCACNONE 
J100040L02GGTCCCACNONE 
J100043O13GGTCCCACNONE 
J100045E20GGTCCCACNONE 
J100046H18GGTCCCACNONE 
J100047E08GGTCCCACNONE 
J100050E08GGTCCCACNONE 
J100050P14GGTCCCACNONE 
J100051G10GGTCCCACNONE 
J100052L12GGTCCCACNONE 
J100056G24GGTCCCACNONE 
J100066B15GGTCCCACNONE 
J100068O15GGTCCCACNONE 
J100070J16GGTCCCACNONE 
J100074I22GGTCCCACNONE 
J100075M12GGTCCCACNONE 
J100077M09GGTCCCACNONE 
J100077O14GGTCCCACNONE 
J100079J08GGTCCCACNONE 
J100080I16GGTCCCACNONE 
Os01g0789100AK069910GGTCCCACCCDP-alcohol phosphatidyltransferase family protein. 
J080093C23GGTCCCACCNONE 
Os01g0805400AK105954TGGGTCCCACUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os01g0818000AK069848GGTCCCACCCGNONE 
AK070194GGTCCCACCCGAuxin Efflux Carrier family protein. 
J023041H12GGTCCCACCCGNONE 
Os01g0818300AK063274GTGGGACCKH domain containing protein. 
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
Os01g0858900AK107493GTGGGACCCACGlycosyl transferase, family 29 protein. 
J065097H23GTGGGACCCACNONE 
J100070A02GTGGGACCCACNONE 
J100072M10GTGGGACCCACNONE 
Os01g0860700009-026-D05GTGGGACCCACNONE 
AK062402GTGGGACCCACConserved hypothetical protein. 
Os01g0867900AK061366CGCGTCGCAGGTGGGTCCCACCTGProtein of unknown function DUF502 family protein. 
Os01g0885600AK059523CGGGTCCCACEsterase/lipase/thioesterase domain containing protein. 
J065013G01CGGGTCCCACNONE 
J065063D03CGGGTCCCACNONE 
J065143H01CGGGTCCCACNONE 
J065146F08CGGGTCCCACNONE 
J065153D14CGGGTCCCACNONE 
J065170E02CGGGTCCCACNONE 
J065175M22CGGGTCCCACNONE 
J065186E13CGGGTCCCACNONE 
J075023J16CGGGTCCCACNONE 
J075176J06CGGGTCCCACNONE 
Os01g0896400AK107067GGTCCCACCTGConserved hypothetical protein. 
Os01g0897600J065120F23GTGGGTCCCACCNONE 
Os01g0908100AK072293CGGGTCCCACRabGAP/TBC domain containing protein. 
J065010B13CGGGTCCCACNONE 
J065010M12CGGGTCCCACNONE 
J065047C19CGGGTCCCACNONE 
J065069B18CGGGTCCCACNONE 
J065071K24CGGGTCCCACNONE 
J065142P04CGGGTCCCACNONE 
J065170E11CGGGTCCCACNONE 
Os01g0908400009-140-E01GGTCCCACCNONE 
AK062957GGTCCCACCConserved hypothetical protein. 
AK099301GGTCCCACCNONE 
J065123M13GGTCCCACCNONE 
J075020O14GGTCCCACCNONE 
J075136L21GGTCCCACCNONE 
Os01g0911200AK101333GGTCCCACCRibophorin II family protein. 
Os01g0913100AK070387GGTCCCACCACProtein of unknown function DUF538 family protein. 
J100090K15GGTCCCACCACNONE 
Os01g0934300AK101422GGTGGGACCCNONE 
J033038C07GGTGGGACCCNONE 
Os01g0961200011-099-H06GTGGGTCCCACCNONE 
AK105424GTGGGTCCCACCCBS domain containing protein. 
J065169J18GTGGGTCCCACCNONE 
J075109H12GTGGGTCCCACCNONE 
Os01g0972300009-034-G05TGGGTCCCACCCACTCCCACTCCNONE 
AK062432TGGGTCCCACCCACTCCCACTCCDVL family protein. 
Os01g0976600AK072971GTGGGACCCACSimilar to Methlytransferase, UbiE/COQ5 family. 
J023148G18GTGGGACCCACNONE 
J075095H03GTGGGACCCACNONE 
J090089M19GTGGGACCCACNONE 
Os02g0103800006-046-H11GTGGGTCCCACGTGNONE 
006-060-B05GTGGGTCCCACGTGNONE 
006-097-A09GTGGGTCCCACGTGNONE 
006-102-A10GTGGGTCCCACGTGNONE 
006-104-E11GTGGGTCCCACGTGNONE 
006-112-D09GTGGGTCCCACGTGNONE 
AK061774GTGGGTCCCACGTGNONE 
AK065309GTGGGTCCCACGTGNONE 
AK106213GTGGGTCCCACGTGSimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment). 
J013002O13GTGGGTCCCACGTGNONE 
J013026F06GTGGGTCCCACGTGNONE 
J013037O14GTGGGTCCCACGTGNONE 
J013066N06GTGGGTCCCACGTGNONE 
J013108G22GTGGGTCCCACGTGNONE 
J023050M15GTGGGTCCCACGTGNONE 
J023054B21GTGGGTCCCACGTGNONE 
J023073C23GTGGGTCCCACGTGNONE 
J023086H17GTGGGTCCCACGTGNONE 
J023105A20GTGGGTCCCACGTGNONE 
J065019E16GTGGGTCCCACGTGNONE 
J065064G10GTGGGTCCCACGTGNONE 
J065071C18GTGGGTCCCACGTGNONE 
J065103B02GTGGGTCCCACGTGNONE 
J065153G06GTGGGTCCCACGTGNONE 
J075152G24GTGGGTCCCACGTGNONE 
J075166P04GTGGGTCCCACGTGNONE 
J080001F02GTGGGTCCCACGTGNONE 
J080001M07GTGGGTCCCACGTGNONE 
J080001O05GTGGGTCCCACGTGNONE 
J080003I19GTGGGTCCCACGTGNONE 
J080004C12GTGGGTCCCACGTGNONE 
J080008E17GTGGGTCCCACGTGNONE 
J080008M08GTGGGTCCCACGTGNONE 
J080010H21GTGGGTCCCACGTGNONE 
J080011F22GTGGGTCCCACGTGNONE 
J080012C16GTGGGTCCCACGTGNONE 
J080013D20GTGGGTCCCACGTGNONE 
J080018K15GTGGGTCCCACGTGNONE 
J080020O14GTGGGTCCCACGTGNONE 
J080020P21GTGGGTCCCACGTGNONE 
J080021A07GTGGGTCCCACGTGNONE 
J080021B06GTGGGTCCCACGTGNONE 
J080022G21GTGGGTCCCACGTGNONE 
J080022P14GTGGGTCCCACGTGNONE 
J080023H24GTGGGTCCCACGTGNONE 
J080023M08GTGGGTCCCACGTGNONE 
J080027E08GTGGGTCCCACGTGNONE 
J080027E18GTGGGTCCCACGTGNONE 
J080027O16GTGGGTCCCACGTGNONE 
J080029M22GTGGGTCCCACGTGNONE 
J080034A17GTGGGTCCCACGTGNONE 
J080038G04GTGGGTCCCACGTGNONE 
J080040F13GTGGGTCCCACGTGNONE 
J080040F22GTGGGTCCCACGTGNONE 
J080041L15GTGGGTCCCACGTGNONE 
J080042L04GTGGGTCCCACGTGNONE 
J080042M14GTGGGTCCCACGTGNONE 
J080043C22GTGGGTCCCACGTGNONE 
J080043O09GTGGGTCCCACGTGNONE 
J080045N17GTGGGTCCCACGTGNONE 
J080046N08GTGGGTCCCACGTGNONE 
J080047K11GTGGGTCCCACGTGNONE 
J080047O06GTGGGTCCCACGTGNONE 
J080048H10GTGGGTCCCACGTGNONE 
J080048N03GTGGGTCCCACGTGNONE 
J080050N02GTGGGTCCCACGTGNONE 
J080051A05GTGGGTCCCACGTGNONE 
J080052I20GTGGGTCCCACGTGNONE 
J080053E08GTGGGTCCCACGTGNONE 
J080055P05GTGGGTCCCACGTGNONE 
J080056F15GTGGGTCCCACGTGNONE 
J080056H07GTGGGTCCCACGTGNONE 
J080057M20GTGGGTCCCACGTGNONE 
J080059K09GTGGGTCCCACGTGNONE 
J080059M10GTGGGTCCCACGTGNONE 
J080060B12GTGGGTCCCACGTGNONE 
J080061N09GTGGGTCCCACGTGNONE 
J080062H11GTGGGTCCCACGTGNONE 
J080062M13GTGGGTCCCACGTGNONE 
J080063D14GTGGGTCCCACGTGNONE 
J080063G10GTGGGTCCCACGTGNONE 
J080063H18GTGGGTCCCACGTGNONE 
J080066J23GTGGGTCCCACGTGNONE 
J080067J06GTGGGTCCCACGTGNONE 
J080069I11GTGGGTCCCACGTGNONE 
J080069O22GTGGGTCCCACGTGNONE 
J080070P11GTGGGTCCCACGTGNONE 
J080072D06GTGGGTCCCACGTGNONE 
J080072J22GTGGGTCCCACGTGNONE 
J080075A20GTGGGTCCCACGTGNONE 
J080076F11GTGGGTCCCACGTGNONE 
J080076J24GTGGGTCCCACGTGNONE 
J080076K05GTGGGTCCCACGTGNONE 
J080077O10GTGGGTCCCACGTGNONE 
J080078L19GTGGGTCCCACGTGNONE 
J080080I08GTGGGTCCCACGTGNONE 
J080081J23GTGGGTCCCACGTGNONE 
J080083A17GTGGGTCCCACGTGNONE 
J080085C05GTGGGTCCCACGTGNONE 
J080086G24GTGGGTCCCACGTGNONE 
J080087H02GTGGGTCCCACGTGNONE 
J080089A13GTGGGTCCCACGTGNONE 
J080090K08GTGGGTCCCACGTGNONE 
J080092M01GTGGGTCCCACGTGNONE 
J080095A19GTGGGTCCCACGTGNONE 
J080095B20GTGGGTCCCACGTGNONE 
J100028F13GTGGGTCCCACGTGNONE 
J100040G22GTGGGTCCCACGTGNONE 
Os02g0115700AK065094GTGGGACCCACatalase isozyme A (EC 1.11.1.6) (CAT-A). 
AK099231GTGGGACCCANONE 
AK099923GTGGGACCCANONE 
X61626GTGGGACCCANONE 
Os02g0119400AK060055TGGGTCCCACACGNONE 
AK102774TGGGTCCCACACGSimilar to Syntaxin 52 (AtSYP52). 
J033107H09TGGGTCCCACACGNONE 
J075175F09TGGGTCCCACACGNONE 
J090011H05TGGGTCCCACACGNONE 
J090091O05TGGGTCCCACACGNONE 
Os02g0121000AK099931GTGGGTCCCACCTGTCAGTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0137100015-082-A12GGTCCCACCNONE 
016-013-D11GGTCCCACCNONE 
AK073353GGTCCCACCConserved hypothetical protein 1589, plant family protein. 
J013026D20GGTCCCACCNONE 
J013111M05GGTCCCACCNONE 
J023099B09GGTCCCACCNONE 
J033025E21GGTCCCACCNONE 
J033082H04GGTCCCACCNONE 
J065110E11GGTCCCACCNONE 
Os02g0162500009-181-F03GGTCCCACTTGNONE 
AK058907GGTCCCACTTGNONE 
AK121223GGTCCCACTTGSimilar to 40S ribosomal protein S14. 
J023090I10GGTCCCACTTGNONE 
J023136J11GGTCCCACTTGNONE 
J053097J20GGTCCCACTTGNONE 
J053098F01GGTCCCACTTGNONE 
J065065B09GGTCCCACTTGNONE 
J065082M04GGTCCCACTTGNONE 
J065188O05GGTCCCACTTGNONE 
J075057P15GGTCCCACTTGNONE 
J075061J08GGTCCCACTTGNONE 
J075061N15GGTCCCACTTGNONE 
J075131I08GGTCCCACTTGNONE 
J075141H13GGTCCCACTTGNONE 
J080062E14GGTCCCACTTGNONE 
J080062P15GGTCCCACTTGNONE 
J080318G17GGTCCCACTTGNONE 
J080319G19GGTCCCACTTGNONE 
J090001L10GGTCCCACTTGNONE 
J090024I18GGTCCCACTTGNONE 
J090033F24GGTCCCACTTGNONE 
J090036M16GGTCCCACTTGNONE 
J090040I24GGTCCCACTTGNONE 
J090048P06GGTCCCACTTGNONE 
J090049B12GGTCCCACTTGNONE 
J090068C02GGTCCCACTTGNONE 
J090069O04GGTCCCACTTGNONE 
J090084H22GGTCCCACTTGNONE 
J100022L03GGTCCCACTTGNONE 
J100028O14GGTCCCACTTGNONE 
J100028O18GGTCCCACTTGNONE 
J100032A15GGTCCCACTTGNONE 
J100033D21GGTCCCACTTGNONE 
J100034J23GGTCCCACTTGNONE 
J100043K22GGTCCCACTTGNONE 
J100052M22GGTCCCACTTGNONE 
J100053N03GGTCCCACTTGNONE 
J100074N24GGTCCCACTTGNONE 
J100082J10GGTCCCACTTGNONE 
Os02g0192300Os02g0192300GACACGTGGGTCCCACZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0192300TGGGTCCCACTCCZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0216500AK103179GTGGGTCCCACHypothetical protein. 
Os02g0228900AK121870GGTCCCACCSimilar to Auxin-responsive protein IAA18 (Indoleacetic acid-induced protein 18). 
Os02g0303200AK107731GTGGGACCCACTTGHypothetical protein. 
Os02g0318400AK064642GGTCCCACCTGTCConserved hypothetical protein. 
J075032B17GGTCCCACCTGTCNONE 
Os02g0332200AK067672GTGGGTCCCACTTGCCACGTGSimilar to T-complex protein 1 delta subunit. 
Os02g0464700AK107077GTGGGACCCACConserved hypothetical protein. 
Os02g0506500AK062572GACAGGTGGGACCNONE 
AK063549GACAGGTGGGACCNONE 
AK101016GACAGGTGGGACCMolybdenum cofactor biosynthesis domain containing protein. 
AK109318GACAGGTGGGACCNONE 
J013000C16GACAGGTGGGACCNONE 
J013155N06GACAGGTGGGACCNONE 
J023067A02GACAGGTGGGACCNONE 
J023149E02GACAGGTGGGACCNONE 
J033033J18GACAGGTGGGACCNONE 
J033051O15GACAGGTGGGACCNONE 
J075034C22GACAGGTGGGACCNONE 
J075054O10GACAGGTGGGACCNONE 
J075108L14GACAGGTGGGACCNONE 
J090043O06GACAGGTGGGACCNONE 
J100024P03GACAGGTGGGACCNONE 
Os02g0530100AK058520GTGGGACCCAHeavy metal transport/detoxification protein domain containing protein. 
Os02g0534600Os02g0534600GTGGGTCCCACCConserved hypothetical protein. 
Os02g0535400AK111881GGTCCCACCConserved hypothetical protein. 
J033050A01GGTCCCACCNONE 
J065043D01GGTCCCACCNONE 
Os02g0562300AK073250GTGGGACCCACCalmodulin binding protein-like family protein. 
Os02g0578201J065065K19GTGGGTCCCACConserved hypothetical protein. 
Os02g0611400AK101310GGTCCCACTTGProtein prenyltransferase domain containing protein. 
J033024H21GGTCCCACTTGNONE 
J033033O21GGTCCCACTTGNONE 
J065134H24GGTCCCACTTGNONE 
J090087E02GGTCCCACTTGNONE 
Os02g0613200AK064869ACACGTGGGACCCACNONE 
AK065051ACACGTGGGACCCACNONE 
AK098853ACACGTGGGACCCACConserved hypothetical protein. 
AK098974ACACGTGGGACCCACNONE 
J013000H15ACACGTGGGACCCACNONE 
J013001I18ACACGTGGGACCCACNONE 
J013022I18ACACGTGGGACCCACNONE 
J013025D06ACACGTGGGACCCACNONE 
J013037H17ACACGTGGGACCCACNONE 
J013043F22ACACGTGGGACCCACNONE 
J013075E01ACACGTGGGACCCACNONE 
J013088D09ACACGTGGGACCCACNONE 
J013088E19ACACGTGGGACCCACNONE 
J013102O18ACACGTGGGACCCACNONE 
J013110C08ACACGTGGGACCCACNONE 
J013118C06ACACGTGGGACCCACNONE 
J013119F22ACACGTGGGACCCACNONE 
J013128K14ACACGTGGGACCCACNONE 
J013158C17ACACGTGGGACCCACNONE 
J023013P15ACACGTGGGACCCACNONE 
J023044L21ACACGTGGGACCCACNONE 
J033023I04ACACGTGGGACCCACNONE 
J033038I22ACACGTGGGACCCACNONE 
J033095M02ACACGTGGGACCCACNONE 
J043022F05ACACGTGGGACCCACNONE 
J080307N20ACACGTGGGACCCACNONE 
J080315C02ACACGTGGGACCCACNONE 
J080316A15ACACGTGGGACCCACNONE 
J080316G03ACACGTGGGACCCACNONE 
J090029E24ACACGTGGGACCCACNONE 
J090031H15ACACGTGGGACCCACNONE 
J090034F13ACACGTGGGACCCACNONE 
J090047G02ACACGTGGGACCCACNONE 
J090069M24ACACGTGGGACCCACNONE 
J100052E15ACACGTGGGACCCACNONE 
Os02g0617600AK111533GGTCCCACConserved hypothetical protein. 
AK111600GGTCCCACNONE 
J013030C15GGTCCCACNONE 
J013094K16GGTCCCACNONE 
J065038P16GGTCCCACNONE 
J065083O12GGTCCCACNONE 
J065208C17GGTCCCACNONE 
J065212K03GGTCCCACNONE 
Os02g0626100006-106-E04GGTCCCACNONE 
015-001-G02GGTCCCACNONE 
015-086-D09GGTCCCACNONE 
015-098-G04GGTCCCACNONE 
015-099-A02GGTCCCACNONE 
Os02g0686700AK111294AGCCCACAGACAGGTGGGACCCGProtein of unknown function DUF581 family protein. 
AK111294GGTCCCACProtein of unknown function DUF581 family protein. 
Os02g0697700AK120209CGGGTGGGACCConserved hypothetical protein. 
J013038N05CGGGTGGGACCNONE 
J013170I01CGGGTGGGACCNONE 
J033144L08CGGGTGGGACCNONE 
J033145L08CGGGTGGGACCNONE 
J043004E24CGGGTGGGACCNONE 
J065032A08CGGGTGGGACCNONE 
J065166F03CGGGTGGGACCNONE 
J075174D13CGGGTGGGACCNONE 
J100019I19CGGGTGGGACCNONE 
J100073F13CGGGTGGGACCNONE 
Os02g0725100AK071759CACTGACAAGTGGGACCCNONE 
Os02g0728600AK063054GGTCCCACSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04GGTCCCACNONE 
Os02g0733300AK101108TCCAACGGTCCCACCCGSimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4). 
AK105446TCCAACGGTCCCACCCGNONE 
Os02g0753800AK101787CGGGTCCCACCSimilar to Annexin p35. 
Os02g0754500AK069965CGGGTCCCACNONE 
AK105696CGGGTCCCACAmidase family protein. 
Os02g0761400009-088-B01GTGGGACCNONE 
AK060417GTGGGACCConserved hypothetical protein. 
Os02g0769200J065031C02GGTCCCACCTGTCNONE 
J065206E04GGTCCCACCTGTCNONE 
Os02g0771500006-096-D12CCCGTGGGACCCACNONE 
006-096-D12GTGGGACCCACNONE 
006-096-D12TGGGTCCCACNONE 
009-011-G02CCCGTGGGACCCACNONE 
009-011-G02GTGGGACCCACNONE 
009-011-G02TGGGTCCCACNONE 
AK062335CCCGTGGGACCCACNONE 
AK062335GTGGGACCCACNONE 
AK062335TGGGTCCCACNONE 
AK106018CCCGTGGGACCCACSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
AK106018GTGGGACCCACSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
AK106018TGGGTCCCACSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
Os02g0788600Os02g0788600GGTCCCACCClp, N terminal domain containing protein. 
Os02g0805200AK071591GGTCCCACProliferating cell nuclear antigen (PCNA) (Cyclin). 
J023105C08GGTCCCACNONE 
J033030H07GGTCCCACNONE 
J033050M24GGTCCCACNONE 
J033069B10GGTCCCACNONE 
J033121A16GGTCCCACNONE 
J053023M14GGTCCCACNONE 
J053033A15GGTCCCACNONE 
J053054H14GGTCCCACNONE 
J053055H24GGTCCCACNONE 
J053082B18GGTCCCACNONE 
J065001N03GGTCCCACNONE 
J065011O16GGTCCCACNONE 
J065026K24GGTCCCACNONE 
J065056C09GGTCCCACNONE 
J065067H11GGTCCCACNONE 
J065097E19GGTCCCACNONE 
J065118O11GGTCCCACNONE 
J065124N09GGTCCCACNONE 
J065143A02GGTCCCACNONE 
J065213P06GGTCCCACNONE 
J065215E24GGTCCCACNONE 
J075051B11GGTCCCACNONE 
J075065K05GGTCCCACNONE 
J080306E10GGTCCCACNONE 
J090042I16GGTCCCACNONE 
J090066J24GGTCCCACNONE 
J090092K17GGTCCCACNONE 
J100029A17GGTCCCACNONE 
J100052N08GGTCCCACNONE 
J100071I23GGTCCCACNONE 
Os02g0824900AK073217GTGGGACCNONE 
AK103528GTGGGACCConserved hypothetical protein. 
J090069J01GTGGGACCNONE 
J090081B04GTGGGACCNONE 
Os02g0831600AB081951GTGGGACCNONE 
AK103279GTGGGACCAGO1 homologous protein. 
Os03g0106400AK108687GGTGGGACCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os03g0108700003-131-E01GTGGGACCCACGTGGCNONE 
AK105115GTGGGACCCACGTGGCConserved hypothetical protein. 
AY224538GTGGGACCCACGTGGCNONE 
J065029A19GTGGGACCCACGTGGCNONE 
J065109N11GTGGGACCCACGTGGCNONE 
Os03g0130400AK070255CGTGTGGGACCAdenylate kinase, subfamily protein. 
AK070255GACAGGTGGGACCAdenylate kinase, subfamily protein. 
Os03g0136900AK067183GTGGGACCSimilar to Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase). 
Os03g0151800AK064955GTGGGACCCACNONE 
AK098874GTGGGACCCACNONE 
AK098980GTGGGACCCACNONE 
AK099712GTGGGACCCACNONE 
AK099889GTGGGACCCACNONE 
AK121641GTGGGACCCACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05GTGGGACCCACNONE 
J013001D04GTGGGACCCACNONE 
J013121O12GTGGGACCCACNONE 
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0174200AK060616CAAGTGGGTCCCACNONE 
AK103762CAAGTGGGTCCCACConserved hypothetical protein. 
J033143G15CAAGTGGGTCCCACNONE 
J090025L02CAAGTGGGTCCCACNONE 
Os03g0175600AK059981GGGTCCCACGTGSimilar to Nit protein 2 (CUA002). 
Os03g0177000AK071368GTGGGTCCCACCGCN5-related N-acetyltransferase domain containing protein. 
Os03g0195200AK068949GGTCCCACPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0213600AK100407GGTCCCACACGConserved hypothetical protein. 
AK100407GGTGGGACCCACCCGConserved hypothetical protein. 
Os03g0218400AK069202GTGGGTCCCACCSimilar to Hexose transporter. 
AK099306GTGGGTCCCACCNONE 
AY342321GTGGGTCCCACCNONE 
J023066K08GTGGGTCCCACCNONE 
J100032N19GTGGGTCCCACCNONE 
Os03g0275900AK109303GGTGGGACCNONE 
AK121978GGTGGGACCSimilar to Spotted leaf protein 11 (Spotted leaf11) (Cell death-related protein SPL11). 
Os03g0283100006-097-E01GGTCCCACCNONE 
AK061849GGTCCCACCNONE 
AK065887GGTCCCACCSimilar to In2-1 protein. 
J013044J05GGTCCCACCNONE 
J013130I02GGTCCCACCNONE 
J013162M18GGTCCCACCNONE 
J023014O17GGTCCCACCNONE 
J023139N17GGTCCCACCNONE 
Os03g0284400AF095709GGTCCCACNONE 
AK061592GGTCCCACNONE 
AK069064GGTCCCACSimilar to Ribosomal protein L10-like. 
J013169G16GGTCCCACNONE 
J023009H08GGTCCCACNONE 
J065161F15GGTCCCACNONE 
J080052C13GGTCCCACNONE 
Os03g0288101J023001N08GGTCCCACCNONE 
J033068A04GGTCCCACCNONE 
J033111P19GGTCCCACCNONE 
J065131H13GGTCCCACCHypothetical protein. 
Os03g0298900006-028-C11CCCGTGGGACCCACNONE 
006-028-C11GGTGGGACCCACNONE 
AK060996CCCGTGGGACCCACHypothetical protein. 
AK060996GGTGGGACCCACHypothetical protein. 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0308000016-023-H09GGTCCCACNONE 
AK100355GGTCCCACUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05GGTCCCACNONE 
J023043K04GGTCCCACNONE 
J023083I20GGTCCCACNONE 
J033068F22GGTCCCACNONE 
J033125P21GGTCCCACNONE 
J065207A22GGTCCCACNONE 
J100018D20GGTCCCACNONE 
J100026L17GGTCCCACNONE 
J100055D14GGTCCCACNONE 
J100060P03GGTCCCACNONE 
J100078A20GGTCCCACNONE 
Os03g0343700AK060603GGTGGGACCCACBrix domain containing protein. 
AK102274GGTGGGACCCACNONE 
J033089C06GGTGGGACCCACNONE 
J090089A17GGTGGGACCCACNONE 
Os03g0390600009-122-E09GTGGGACCNONE 
J065165K04GTGGGACCNONE 
Os03g0415500AK108435GGAGTGGGTCCCACMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12GGAGTGGGTCCCACNONE 
Os03g0418700AK099879GTGGGACCCGNONE 
AK101797GTGGGACCCGConserved hypothetical protein. 
Os03g0596800AK073603GTGGGACCCAConserved hypothetical protein. 
J033052N01GTGGGACCCANONE 
Os03g0597400AK108626TGGGTCCCACProtein of unknown function DUF1618 domain containing protein. 
Os03g0684400AK100086GTGGGACCCACMg2+ transporter protein, CorA-like family protein. 
Os03g0704200AK071176GCCACGTGGGTCCCACCZinc finger, MYND-type domain containing protein. 
J023083O08GCCACGTGGGTCCCACCNONE 
Os03g0713100J013039M09GGTCCCACCACNONE 
J023007K01GGTCCCACCACNONE 
J023073H01GGTCCCACCACNONE 
J023087M20GGTCCCACCACNONE 
J023142E01GGTCCCACCACNONE 
J033048E03GGTCCCACCACNONE 
J033048F03GGTCCCACCACSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11GGTCCCACCACNONE 
J033074M20GGTCCCACCACNONE 
J033084M11GGTCCCACCACNONE 
J033091I23GGTCCCACCACNONE 
J033100C08GGTCCCACCACNONE 
J033123K19GGTCCCACCACNONE 
J090006P21GGTCCCACCACNONE 
J090045O16GGTCCCACCACNONE 
J100087M13GGTCCCACCACNONE 
Os03g0735000AK069296GTGGGTCCCACGCGSimilar to Glucose-1-phosphate adenylyltransferase large subunit 2 (EC 2.7.7.27) (ADP-glucose synthase) (ADP-glucose pyrophosphorylase) (AGPASE S) (Alpha-D-glucose-1-phosphate adenyl transferase) (BLPL) (Fragment). 
Os03g0780600AK120180TGGGTCCCACCNONE 
D13224TGGGTCCCACCTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18TGGGTCCCACCNONE 
J033022G05TGGGTCCCACCNONE 
J033028A16TGGGTCCCACCNONE 
J033050M08TGGGTCCCACCNONE 
J090053F04TGGGTCCCACCNONE 
J090064E19TGGGTCCCACCNONE 
J090083J24TGGGTCCCACCNONE 
J100024I23TGGGTCCCACCNONE 
Os03g0786600AK109838GGGTCCCACProtein of unknown function DUF860, plant family protein. 
Os03g0791800013-037-A12CACGTGGGACCCANONE 
AB079798CACGTGGGACCCANONE 
AK067703CACGTGGGACCCARad6 (Ubiquitin carrier protein). 
AK120251CACGTGGGACCCANONE 
J013045G10CACGTGGGACCCANONE 
J023102B18CACGTGGGACCCANONE 
J065020J23CACGTGGGACCCANONE 
J065127I21CACGTGGGACCCANONE 
J065151E11CACGTGGGACCCANONE 
J075076B05CACGTGGGACCCANONE 
J075116C15CACGTGGGACCCANONE 
J075136A07CACGTGGGACCCANONE 
J100029G21CACGTGGGACCCANONE 
J100030K01CACGTGGGACCCANONE 
J100041J02CACGTGGGACCCANONE 
J100049C22CACGTGGGACCCANONE 
J100057G17CACGTGGGACCCANONE 
J100086L12CACGTGGGACCCANONE 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
J033125G24GTGGGACCCACGTGGGCCCCACANONE 
J065132N21GTGGGACCCACGTGGGCCCCACANONE 
Os03g0822400013-072-A06GGTCCCACNONE 
014-009-H06GGTCCCACNONE 
014-025-G05GGTCCCACNONE 
014-033-G02GGTCCCACNONE 
014-038-G06GGTCCCACNONE 
014-047-H10GGTCCCACNONE 
014-054-H04GGTCCCACNONE 
014-055-F05GGTCCCACNONE 
014-075-E04GGTCCCACNONE 
014-084-B02GGTCCCACNONE 
014-087-F10GGTCCCACNONE 
014-098-D02GGTCCCACNONE 
014-099-B04GGTCCCACNONE 
014-100-H10GGTCCCACNONE 
AK070075GGTCCCACConserved hypothetical protein. 
AK102425GGTCCCACNONE 
J065134M15GGTCCCACNONE 
J090053B16GGTCCCACNONE 
Os03g0832600AK120137CAAGTGGGTCCCACSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0837900AK068346CACGCCACTGACAAGTGGGACCCACStreptomyces cyclase/dehydrase family protein. 
Os03g0844800AK071813GGCCGTGGGACCCGCGCConserved hypothetical protein. 
J023114B14GGCCGTGGGACCCGCGCNONE 
Os04g0258900009-146-B02GTGGGACCCACGTGGGTCCCACNONE 
AK062983GTGGGACCCACGTGGGTCCCACCyclin-like F-box domain containing protein. 
Os04g0278000AK120988CGTGTGGGACCCACCACSimilar to PRLI-interacting factor G (Fragment). 
Os04g0319800J065187N03GGTCCCACGCGSimilar to Cytokinin-O-glucosyltransferase 2 (EC 2.4.1.-) (Zeatin O- glucosyltransferase 2). 
Os04g0329500015-081-E12GTGGGACCNONE 
AK064343GTGGGACCProtein of unknown function DUF295 family protein. 
AK073994GTGGGACCNONE 
J033072H16GTGGGACCNONE 
Os04g0378200AK103076GGTCCCACGGGSterile alpha motif SAM domain containing protein. 
J033118E02GGTCCCACGGGNONE 
J065065F15GGTCCCACGGGNONE 
J090080I24GGTCCCACGGGNONE 
Os04g0435700AK100857GCCACGTGGGACCSimilar to UVB-resistance protein UVR8. 
Os04g0462500006-073-E08GGCCGTGGGACCCACNONE 
AK062065GGCCGTGGGACCCACNONE 
AK071311GGCCGTGGGACCCACSimilar to 14-3-3-like protein GF14-6. 
AK071822GGCCGTGGGACCCACNONE 
AK099243GGCCGTGGGACCCACNONE 
AK101938GGCCGTGGGACCCACNONE 
J013056F02GGCCGTGGGACCCACNONE 
J023020E08GGCCGTGGGACCCACNONE 
J023085B16GGCCGTGGGACCCACNONE 
J023117D08GGCCGTGGGACCCACNONE 
J023133K12GGCCGTGGGACCCACNONE 
J033025G04GGCCGTGGGACCCACNONE 
J033052A15GGCCGTGGGACCCACNONE 
J033074G16GGCCGTGGGACCCACNONE 
J033090A16GGCCGTGGGACCCACNONE 
J033122A07GGCCGTGGGACCCACNONE 
J033133G09GGCCGTGGGACCCACNONE 
J065002F16GGCCGTGGGACCCACNONE 
J065030M09GGCCGTGGGACCCACNONE 
J065056B11GGCCGTGGGACCCACNONE 
J065115I10GGCCGTGGGACCCACNONE 
J065120O09GGCCGTGGGACCCACNONE 
J065124G21GGCCGTGGGACCCACNONE 
J075031C14GGCCGTGGGACCCACNONE 
J075040H07GGCCGTGGGACCCACNONE 
J075047F04GGCCGTGGGACCCACNONE 
J075065F14GGCCGTGGGACCCACNONE 
J075066G20GGCCGTGGGACCCACNONE 
J075105D01GGCCGTGGGACCCACNONE 
J075147B04GGCCGTGGGACCCACNONE 
J075149A12GGCCGTGGGACCCACNONE 
J075172D07GGCCGTGGGACCCACNONE 
J075190J11GGCCGTGGGACCCACNONE 
J090038H18GGCCGTGGGACCCACNONE 
J090087G05GGCCGTGGGACCCACNONE 
J100025A10GGCCGTGGGACCCACNONE 
J100025O10GGCCGTGGGACCCACNONE 
J100027D02GGCCGTGGGACCCACNONE 
J100027P06GGCCGTGGGACCCACNONE 
J100032K04GGCCGTGGGACCCACNONE 
J100056D21GGCCGTGGGACCCACNONE 
J100060J08GGCCGTGGGACCCACNONE 
J100063N19GGCCGTGGGACCCACNONE 
J100064C14GGCCGTGGGACCCACNONE 
J100064K18GGCCGTGGGACCCACNONE 
J100070L21GGCCGTGGGACCCACNONE 
J100072M17GGCCGTGGGACCCACNONE 
J100074F21GGCCGTGGGACCCACNONE 
J100087E05GGCCGTGGGACCCACNONE 
U65956GGCCGTGGGACCCACNONE 
Os04g0485200006-033-B07GTGGGTCCCACTTGNONE 
AK061463GTGGGTCCCACTTGNONE 
J023037H14GTGGGTCCCACTTGNONE 
J023083B19GTGGGTCCCACTTGNONE 
J023104H04GTGGGTCCCACTTGNONE 
J043022C03GTGGGTCCCACTTGNONE 
Os04g0521800006-043-D11GTGGGACCNONE 
AK061536GTGGGACCNONE 
AK102934GTGGGACCPeptidase M20 family protein. 
AK103369GTGGGACCNONE 
Os04g0543200AK101961GGTCCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK102135GGTCCCACNONE 
Os04g0548000011-097-D07GTGGGACCCACNONE 
AK073099GTGGGACCCACNONE 
AK104979GTGGGACCCACProtein of unknown function DUF862, eukaryotic domain containing protein. 
J065102C18GTGGGACCCACNONE 
J075076A16GTGGGACCCACNONE 
J075082L09GTGGGACCCACNONE 
J075092L18GTGGGACCCACNONE 
J075092N01GTGGGACCCACNONE 
J075122P14GTGGGACCCACNONE 
J075148L06GTGGGACCCACNONE 
Os04g0549300AK063296GTGGGACCCASimilar to GA protein (Fragment). 
J065073I11GTGGGACCCANONE 
J065172C13GTGGGACCCANONE 
J090004B10GTGGGACCCANONE 
J090039N18GTGGGACCCANONE 
J090088F09GTGGGACCCANONE 
Os04g0558400AK061440GGTCCCACCTGACAGGAcyl-CoA thioesterase family protein. 
AK102197GGTCCCACCTGACAGGNONE 
J013046K23GGTCCCACCTGACAGGNONE 
J013090O17GGTCCCACCTGACAGGNONE 
J033087D05GGTCCCACCTGACAGGNONE 
J065029A16GGTCCCACCTGACAGGNONE 
J065121A13GGTCCCACCTGACAGGNONE 
J090063H18GGTCCCACCTGACAGGNONE 
J100048C18GGTCCCACCTGACAGGNONE 
Os04g0558500J065017H16GTGGGTCCCACConserved hypothetical protein. 
Os04g0606800009-159-H11GGTCCCACCNONE 
AK072824GGTCCCACCConserved hypothetical protein. 
J033070J06GGTCCCACCNONE 
J033119D03GGTCCCACCNONE 
J100043F05GGTCCCACCNONE 
J100050A01GGTCCCACCNONE 
Os04g0617050J065197A20GTGGGACCCACCTGTNONE 
J090067K01GTGGGACCCACCTGTAuxin responsive SAUR protein family protein. 
Os04g0642100011-074-F06TGGGTCCCACCNONE 
J043006J10TGGGTCCCACCSimilar to Microtubule-associated protein EB1. 
J043006P09TGGGTCCCACCNONE 
Os04g0661300AK070723GGTCCCACConserved hypothetical protein. 
AK103942GGTCCCACNONE 
Os04g0690866014-091-B08GTGGGACCCACGTGConserved hypothetical protein. 
J065085H18GTGGGACCCACGTGNONE 
J065099J05GTGGGACCCACGTGNONE 
J065194D12GTGGGACCCACGTGNONE 
J065197H01GTGGGACCCACGTGNONE 
Os05g0102500009-183-E08GGTCCCACGCGTNONE 
AK063894GGTCCCACGCGTNONE 
AK073341GGTCCCACGCGTConserved hypothetical protein. 
J023022C11GGTCCCACGCGTNONE 
J065095B14GGTCCCACGCGTNONE 
J065130O12GGTCCCACGCGTNONE 
J065142P07GGTCCCACGCGTNONE 
J065155L18GGTCCCACGCGTNONE 
Os05g0110100009-015-D08GTGGGACCCGNONE 
009-023-C09GTGGGACCCGNONE 
009-031-B11GTGGGACCCGNONE 
009-034-C02GTGGGACCCGNONE 
009-050-B08GTGGGACCCGNONE 
009-065-D12GTGGGACCCGNONE 
009-090-G08GTGGGACCCGNONE 
009-111-H07GTGGGACCCGNONE 
009-136-F12GTGGGACCCGNONE 
009-138-E06GTGGGACCCGNONE 
009-138-G12GTGGGACCCGNONE 
009-141-D08GTGGGACCCGNONE 
009-143-D01GTGGGACCCGNONE 
009-179-D09GTGGGACCCGNONE 
009-179-E03GTGGGACCCGNONE 
009-196-A09GTGGGACCCGNONE 
009-199-F04GTGGGACCCGNONE 
013-021-E05GTGGGACCCGNONE 
013-076-C04GTGGGACCCGNONE 
013-096-F06GTGGGACCCGNONE 
014-071-A05GTGGGACCCGNONE 
014-077-F09GTGGGACCCGNONE 
AK099779GTGGGACCCGNONE 
AK121142GTGGGACCCGConserved hypothetical protein. 
J013095A16GTGGGACCCGNONE 
J013111A17GTGGGACCCGNONE 
J013132G04GTGGGACCCGNONE 
J023077M04GTGGGACCCGNONE 
J065001B11GTGGGACCCGNONE 
J065001E11GTGGGACCCGNONE 
J065057G10GTGGGACCCGNONE 
J065057L08GTGGGACCCGNONE 
J065080E07GTGGGACCCGNONE 
J065087K10GTGGGACCCGNONE 
J065091M15GTGGGACCCGNONE 
J065167A15GTGGGACCCGNONE 
J075018F02GTGGGACCCGNONE 
J075063F20GTGGGACCCGNONE 
J075064F18GTGGGACCCGNONE 
J075066N19GTGGGACCCGNONE 
J075073I02GTGGGACCCGNONE 
J075080P17GTGGGACCCGNONE 
J075081F11GTGGGACCCGNONE 
J075085E03GTGGGACCCGNONE 
J075101G18GTGGGACCCGNONE 
J075149N08GTGGGACCCGNONE 
J075158I21GTGGGACCCGNONE 
J075161M20GTGGGACCCGNONE 
J075190F12GTGGGACCCGNONE 
J075194K16GTGGGACCCGNONE 
J080001E08GTGGGACCCGNONE 
J080001F21GTGGGACCCGNONE 
J080001H19GTGGGACCCGNONE 
J080001O15GTGGGACCCGNONE 
J080005I22GTGGGACCCGNONE 
J080006K23GTGGGACCCGNONE 
J080014D20GTGGGACCCGNONE 
J080014I05GTGGGACCCGNONE 
J080014K21GTGGGACCCGNONE 
J080017I24GTGGGACCCGNONE 
J080017K11GTGGGACCCGNONE 
J080018F11GTGGGACCCGNONE 
J080022L18GTGGGACCCGNONE 
J080024N23GTGGGACCCGNONE 
J080027J23GTGGGACCCGNONE 
J080029B14GTGGGACCCGNONE 
J080032F14GTGGGACCCGNONE 
J080032K19GTGGGACCCGNONE 
J080032O21GTGGGACCCGNONE 
J080033P17GTGGGACCCGNONE 
J080034I06GTGGGACCCGNONE 
J080039F24GTGGGACCCGNONE 
J080040O13GTGGGACCCGNONE 
J080042B02GTGGGACCCGNONE 
J080043E12GTGGGACCCGNONE 
J080043J15GTGGGACCCGNONE 
J080043N09GTGGGACCCGNONE 
J080052J08GTGGGACCCGNONE 
J080053K01GTGGGACCCGNONE 
J080053K19GTGGGACCCGNONE 
J080055J09GTGGGACCCGNONE 
J080058D07GTGGGACCCGNONE 
J080062F11GTGGGACCCGNONE 
J080063J24GTGGGACCCGNONE 
J080066H04GTGGGACCCGNONE 
J080066I09GTGGGACCCGNONE 
J080067B02GTGGGACCCGNONE 
J080067N09GTGGGACCCGNONE 
J080068D22GTGGGACCCGNONE 
J080068K13GTGGGACCCGNONE 
J080069N19GTGGGACCCGNONE 
J080070D07GTGGGACCCGNONE 
J080070E05GTGGGACCCGNONE 
J080071G04GTGGGACCCGNONE 
J080077G05GTGGGACCCGNONE 
J080077O06GTGGGACCCGNONE 
J080085F05GTGGGACCCGNONE 
J080086E07GTGGGACCCGNONE 
J080089G16GTGGGACCCGNONE 
J080092K15GTGGGACCCGNONE 
J080094A08GTGGGACCCGNONE 
J080097A09GTGGGACCCGNONE 
J080097J07GTGGGACCCGNONE 
J090027N01GTGGGACCCGNONE 
J090081J05GTGGGACCCGNONE 
Os05g0129400AK102359TGGGACCCACGTGGGTCCCACAnkyrin repeat containing protein. 
J033091I05TGGGACCCACGTGGGTCCCACNONE 
Os05g0139200AK108058TGCGGCCCACATGGGTCCCACCyclin-like F-box domain containing protein. 
Os05g0162600012-069-E09GTGGGACCCACNONE 
AK063518GTGGGACCCACSimilar to Splicing factor RSZ33. 
AK121854GTGGGACCCACNONE 
J065178M11GTGGGACCCACNONE 
J090016J24GTGGGACCCACNONE 
J090023E07GTGGGACCCACNONE 
Os05g0163700AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0169400AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein. 
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
Os05g0198000J080004C03GTGGGACCProtein of unknown function DUF247, plant family protein. 
J080004M24GTGGGACCNONE 
J080004O15GTGGGACCNONE 
J080006E14GTGGGACCNONE 
J080006I07GTGGGACCNONE 
J080007N13GTGGGACCNONE 
J080009C21GTGGGACCNONE 
J080009L03GTGGGACCNONE 
J080010F10GTGGGACCNONE 
J080015H04GTGGGACCNONE 
J080015L04GTGGGACCNONE 
J080018C21GTGGGACCNONE 
J080022M22GTGGGACCNONE 
J080027O19GTGGGACCNONE 
J080030I07GTGGGACCNONE 
J080037P07GTGGGACCNONE 
J080044C18GTGGGACCNONE 
J080049F14GTGGGACCNONE 
J080050F04GTGGGACCNONE 
J080052B18GTGGGACCNONE 
J080081B11GTGGGACCNONE 
J080083G12GTGGGACCNONE 
J080086A11GTGGGACCNONE 
J080087C06GTGGGACCNONE 
J080088E06GTGGGACCNONE 
J080091O21GTGGGACCNONE 
J080094N23GTGGGACCNONE 
Os05g0220900AK109172GTGGGTCCCACNONE 
AK109456GTGGGTCCCACPrefoldin domain containing protein. 
Os05g0300700014-079-G07GGTGGGACCCACNONE 
AK063728GGTGGGACCCACNONE 
AK067846GGTGGGACCCACConserved hypothetical protein. 
Os05g0319800AK100483GTGGGACCCACSimilar to Plasma membrane H+ ATPase (EC 3.6.3.6). 
Os05g0322900006-057-H12GGTCCCACCTGNONE 
014-051-A08GGTCCCACCTGNONE 
AK063697GGTCCCACCTGNONE 
AK066255GGTCCCACCTGSimilar to WRKY transcription factor 45. 
AK103959GGTCCCACCTGNONE 
AY870611GGTCCCACCTGNONE 
J100068H13GGTCCCACCTGNONE 
Os05g0325200J090038J19TGGGTCCCACCyclin-like domain containing protein. 
Os05g0354400AK065144GGTGGGACCCAProtein of unknown function DUF231, plant domain containing protein. 
Os05g0357200014-046-H09GGTCCCACCNONE 
AK064069GGTCCCACCNONE 
AK072064GGTCCCACCMitochondrial substrate carrier family protein. 
J065038M01GGTCCCACCNONE 
J065121C16GGTCCCACCNONE 
J075173E09GGTCCCACCNONE 
J080307A20GGTCCCACCNONE 
J090046B19GGTCCCACCNONE 
J100033N12GGTCCCACCNONE 
J100036G01GGTCCCACCNONE 
J100057B19GGTCCCACCNONE 
Os05g0358000006-083-G07CGGGTCCCACCNONE 
AK061141CGGGTCCCACCNONE 
AK070900CGGGTCCCACCNONE 
AK101263CGGGTCCCACCDrought induced 19 family protein. 
J023098C13CGGGTCCCACCNONE 
J033032J06CGGGTCCCACCNONE 
J065014A09CGGGTCCCACCNONE 
J065121L01CGGGTCCCACCNONE 
J065130K19CGGGTCCCACCNONE 
J065208B21CGGGTCCCACCNONE 
J075080G14CGGGTCCCACCNONE 
J075135L01CGGGTCCCACCNONE 
J075180J15CGGGTCCCACCNONE 
Os05g0372400AK068781GGACACGTGGGTCCCACLipase, class 3 family protein. 
AK068781TGGGTCCCACLipase, class 3 family protein. 
Os05g0376300AK110968GGTCCCACNONE 
Os05g0392801J090025K15GTGGGACCCACGTGGGCCCCACGTConserved hypothetical protein. 
J090053E06GTGGGACCCACGTGGGCCCCACGTNONE 
Os05g0413200006-067-C03CGCGTGGGACCGTCCGATCNONE 
006-080-C03CGCGTGGGACCGTCCGATCNONE 
006-095-G10CGCGTGGGACCGTCCGATCNONE 
006-115-G11CGCGTGGGACCGTCCGATCNONE 
013-040-E05CGCGTGGGACCGTCCGATCNONE 
AB104732CGCGTGGGACCGTCCGATCNONE 
AK122099CGCGTGGGACCGTCCGATCBeta-tubulin. 
J033087H20CGCGTGGGACCGTCCGATCNONE 
J033117C18CGCGTGGGACCGTCCGATCNONE 
J033125G10CGCGTGGGACCGTCCGATCNONE 
Os05g0440100015-006-F06CACGTGGGTCCCACNONE 
015-076-D04CACGTGGGTCCCACNONE 
AK073094CACGTGGGTCCCACNONE 
AK102786CACGTGGGTCCCACHistone deacetylase superfamily protein. 
J033107M16CACGTGGGTCCCACNONE 
Os05g0490000011-076-C07GGTGGGACCCANONE 
015-026-D07GGTGGGACCCANONE 
015-074-A08GGTGGGACCCANONE 
AK064335GGTGGGACCCANONE 
AK101340GGTGGGACCCAKrr1 family protein. 
J033034J18GGTGGGACCCANONE 
Os05g0503300011-013-H12GTGTCACTGACAGTGGGACCCACCACNONE 
012-072-B03GTGTCACTGACAGTGGGACCCACCACNONE 
AK073969GTGTCACTGACAGTGGGACCCACCACSimilar to Sulfite reductase (Fragment). 
AK100773GTGTCACTGACAGTGGGACCCACCACNONE 
AK103289GTGTCACTGACAGTGGGACCCACCACNONE 
J013045K07GTGTCACTGACAGTGGGACCCACCACNONE 
J033075F01GTGTCACTGACAGTGGGACCCACCACNONE 
J033125N07GTGTCACTGACAGTGGGACCCACCACNONE 
J033130G12GTGTCACTGACAGTGGGACCCACCACNONE 
Os05g0507000AK108025CACGTGGGACCCAConserved hypothetical protein. 
Os05g0508300Os05g0508300GTGGGACCSimilar to Papain-like cysteine peptidase XBCP3. 
Os05g0515600Os05g0515600GGTCCCACSimilar to O-methyltransferase ZRP4 (EC 2.1.1.-) (OMT). 
Os05g0519700014-100-B04GTGGGACCCNONE 
AF332981GTGGGACCCNONE 
AK100903GTGGGACCCNONE 
AK105433GTGGGACCCHeat shock protein 101. 
Os05g0519800AK069435GGGTCCCACProtein of unknown function DUF28 family protein. 
J023024L22GGGTCCCACNONE 
Os05g0535900AK101539GGAGTGGGACCCACNONE 
AK101555GGAGTGGGACCCACIQ calmodulin-binding region domain containing protein. 
J013047J05GGAGTGGGACCCACNONE 
Os05g0583400AK101992TGTGGGGCCCACGTGGGTCCCACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit). 
Os05g0585900AK062575GTGGGTCCCACTCCMitochondrial substrate carrier family protein. 
AK098854GTGGGTCCCACTCCNONE 
J013000H16GTGGGTCCCACTCCNONE 
J033118D07GTGGGTCCCACTCCNONE 
Os06g0136900AK107405GTGGGTCCCACCGCACProtein of unknown function DUF296 domain containing protein. 
Os06g0137700006-069-H03GGGTCCCACNONE 
011-035-G09GGGTCCCACNONE 
016-001-C08GGGTCCCACNONE 
AK061097GGGTCCCACNONE 
AK073547GGGTCCCACNONE 
AK106455GGGTCCCACSimilar to GDP-mannose 4,6 dehydratase 1 (EC 4.2.1.47) (GDP-D-mannose dehydratase 1) (GMD 1). 
Os06g0179800AK065817GGTCCCACCACNONE 
AK121252GGTCCCACCACLeucine rich repeat, N-terminal domain containing protein. 
Os06g0215600006-037-G11GGTCCCACNONE 
006-098-D08GGTCCCACNONE 
006-106-G02GGTCCCACNONE 
AK061212GGTCCCACSimilar to Oxo-phytodienoic acid reductase. 
AK104039GGTCCCACNONE 
AK104193GGTCCCACNONE 
AK104256GGTCCCACNONE 
Os06g0215900011-006-B01GGGTCCCACNONE 
011-088-G08GGGTCCCACNONE 
AK072596GGGTCCCACSimilar to Oxo-phytodienoic acid reductase. 
AK105590GGGTCCCACNONE 
J023125E21GGGTCCCACNONE 
J033051F13GGGTCCCACNONE 
J033091L21GGGTCCCACNONE 
J033107E18GGGTCCCACNONE 
J043034N06GGGTCCCACNONE 
J065021A14GGGTCCCACNONE 
J065136F10GGGTCCCACNONE 
J065142G20GGGTCCCACNONE 
J065166I12GGGTCCCACNONE 
J065171G17GGGTCCCACNONE 
J065179A21GGGTCCCACNONE 
J065190J04GGGTCCCACNONE 
J065214E03GGGTCCCACNONE 
J100022N12GGGTCCCACNONE 
J100025A03GGGTCCCACNONE 
J100034H20GGGTCCCACNONE 
J100054C23GGGTCCCACNONE 
J100057K17GGGTCCCACNONE 
J100061L01GGGTCCCACNONE 
J100077K16GGGTCCCACNONE 
J100078D16GGGTCCCACNONE 
J100084G04GGGTCCCACNONE 
Os06g0231300AK073934GGTCCCACCTGTCATCCACCHSP20-like chaperone domain containing protein. 
Os06g0233000009-177-C07CGGGTCCCACNONE 
AK063118CGGGTCCCACConserved hypothetical protein. 
Os06g0241200AK100783GGTCCCACHypothetical protein. 
Os06g0264300AK061556GTGGGTCCCACNONE 
AK073271GTGGGTCCCACSimilar to RAD23, isoform I. 
Os06g0324000AK109614GTGGGACCCACGTGGACCConserved hypothetical protein. 
Os06g0550800J065058J22GGTCCCACCTGConserved hypothetical protein. 
Os06g0551400009-003-D11ACAGGTGGGACCNONE 
011-025-C09ACAGGTGGGACCNONE 
AK066548ACAGGTGGGACCRas-related protein RIC2. 
D13758ACAGGTGGGACCNONE 
J013069H14ACAGGTGGGACCNONE 
J053037J07ACAGGTGGGACCNONE 
J065011J03ACAGGTGGGACCNONE 
J065078L15ACAGGTGGGACCNONE 
J065103H24ACAGGTGGGACCNONE 
J065157A07ACAGGTGGGACCNONE 
J065213P12ACAGGTGGGACCNONE 
J090007P04ACAGGTGGGACCNONE 
J090052N23ACAGGTGGGACCNONE 
Os06g0574200Os06g0574200GTGGGTCCCACACGTGTGGGCCCACCCCCACACAGCCGTTGUspA domain containing protein. 
Os06g0609900AK109324GGTCCCACACGConserved hypothetical protein. 
AK109324GGTGGGACCCACConserved hypothetical protein. 
Os06g0668200011-004-A12GTGGGACCCACNONE 
AK070705GTGGGACCCACSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
AK101622GTGGGACCCACNONE 
D10408GTGGGACCCACNONE 
J033044L05GTGGGACCCACNONE 
J033052L01GTGGGACCCACNONE 
J033086F09GTGGGACCCACNONE 
J033096I19GTGGGACCCACNONE 
J053072J20GTGGGACCCACNONE 
J065074N09GTGGGACCCACNONE 
J065075K09GTGGGACCCACNONE 
J065130L15GTGGGACCCACNONE 
J065136P12GTGGGACCCACNONE 
J065137M09GTGGGACCCACNONE 
J065139O15GTGGGACCCACNONE 
J075003J03GTGGGACCCACNONE 
J075021J20GTGGGACCCACNONE 
Os06g0714000AK069538CGGGTCCCACCACProtein of unknown function UPF0183 family protein. 
AK069538TGGGTCCCACCACProtein of unknown function UPF0183 family protein. 
J023020A02CGGGTCCCACCACNONE 
J023020A02TGGGTCCCACCACNONE 
J023039H03CGGGTCCCACCACNONE 
J023039H03TGGGTCCCACCACNONE 
J100042E23CGGGTCCCACCACNONE 
J100042E23TGGGTCCCACCACNONE 
J100069N01CGGGTCCCACCACNONE 
J100069N01TGGGTCCCACCACNONE 
J100089L13CGGGTCCCACCACNONE 
J100089L13TGGGTCCCACCACNONE 
Os06g0728700AK111637TGGGTCCCACHomeodomain-like containing protein. 
AK119632TGGGTCCCACNONE 
J075015J02TGGGTCCCACNONE 
J075016L14TGGGTCCCACNONE 
J075078O03TGGGTCCCACNONE 
J075098O14TGGGTCCCACNONE 
J075171L20TGGGTCCCACNONE 
Os07g0124600AK073437GTGGGACCCACCTGTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GTGGGACCCACCTGTCNONE 
J033136G07GTGGGACCCACCTGTCNONE 
J065092I12GTGGGACCCACCTGTCNONE 
J065132F04GTGGGACCCACCTGTCNONE 
J065143I11GTGGGACCCACCTGTCNONE 
Os07g0136300AK064609CGGGTGGGACCConserved hypothetical protein. 
Os07g0154900009-142-E09GTGGGACCCACNONE 
AK062969GTGGGACCCACConserved hypothetical protein. 
Os07g0300900AK061941GTGGGACCSimilar to Lysine-sensitive aspartate kinase. 
AK102162GTGGGACCNONE 
Os07g0408700004-019-E03CAAGTGGGACCCACNONE 
015-093-D01CAAGTGGGACCCACNONE 
AJ251298CAAGTGGGACCCACNONE 
AK060916CAAGTGGGACCCACNONE 
AK099606CAAGTGGGACCCACSimilar to Spermidine synthase 2 (EC 2.5.1.16) (Putrescine aminopropyltransferase 2) (SPDSY 2). 
J013052G01CAAGTGGGACCCACNONE 
Os07g0442000AK068559GTGGGACCCACGGGCCCACCACyclin-like F-box domain containing protein. 
Os07g0479300AK120117GGTCCCACCGCCCACCCPeptidase S10, serine carboxypeptidase family protein. 
D17587GGTCCCACCGCCCACCCNONE 
Os07g0564600AK061125GTGGGACCNONE 
AK102110GTGGGACCSimilar to Secretory carrier membrane protein. 
Os07g0568300AK067784CCACTGACAGGTGGGTCCCACNONE 
AK067895CCACTGACAGGTGGGTCCCACSimilar to ZF protein (Fragment). 
J013119M01CCACTGACAGGTGGGTCCCACNONE 
J013120B09CCACTGACAGGTGGGTCCCACNONE 
J013123G12CCACTGACAGGTGGGTCCCACNONE 
J023012C12CCACTGACAGGTGGGTCCCACNONE 
J023020G17CCACTGACAGGTGGGTCCCACNONE 
J023037E23CCACTGACAGGTGGGTCCCACNONE 
J033076I01CCACTGACAGGTGGGTCCCACNONE 
J033108A07CCACTGACAGGTGGGTCCCACNONE 
J033138J02CCACTGACAGGTGGGTCCCACNONE 
J075033L09CCACTGACAGGTGGGTCCCACNONE 
J075049E02CCACTGACAGGTGGGTCCCACNONE 
J075060N23CCACTGACAGGTGGGTCCCACNONE 
J075094H13CCACTGACAGGTGGGTCCCACNONE 
J075179L18CCACTGACAGGTGGGTCCCACNONE 
J080005P09CCACTGACAGGTGGGTCCCACNONE 
J080044J03CCACTGACAGGTGGGTCCCACNONE 
J080062G20CCACTGACAGGTGGGTCCCACNONE 
J080063L23CCACTGACAGGTGGGTCCCACNONE 
J080065B16CCACTGACAGGTGGGTCCCACNONE 
J080071K09CCACTGACAGGTGGGTCCCACNONE 
J080089C23CCACTGACAGGTGGGTCCCACNONE 
J090008P21CCACTGACAGGTGGGTCCCACNONE 
J090046B22CCACTGACAGGTGGGTCCCACNONE 
J090094C19CCACTGACAGGTGGGTCCCACNONE 
J090096B19CCACTGACAGGTGGGTCCCACNONE 
J100060G03CCACTGACAGGTGGGTCCCACNONE 
J100082D16CCACTGACAGGTGGGTCCCACNONE 
Os07g0583000009-007-G05GTGGGTCCCACNONE 
009-190-E05GTGGGTCCCACNONE 
AK121047GTGGGTCCCACRibosome associated membrane RAMP4 family protein. 
J023055F01GTGGGTCCCACNONE 
J023102M16GTGGGTCCCACNONE 
J065014E08GTGGGTCCCACNONE 
J065022K10GTGGGTCCCACNONE 
J065022L10GTGGGTCCCACNONE 
J065108H15GTGGGTCCCACNONE 
J065142D09GTGGGTCCCACNONE 
J065209L19GTGGGTCCCACNONE 
J075063E11GTGGGTCCCACNONE 
J075072D09GTGGGTCCCACNONE 
J075095G11GTGGGTCCCACNONE 
J075112K10GTGGGTCCCACNONE 
J075128I05GTGGGTCCCACNONE 
J075130O07GTGGGTCCCACNONE 
J075137F12GTGGGTCCCACNONE 
J075139O19GTGGGTCCCACNONE 
J075173L21GTGGGTCCCACNONE 
J075194I22GTGGGTCCCACNONE 
J090062I16GTGGGTCCCACNONE 
J100055L14GTGGGTCCCACNONE 
J100058G14GTGGGTCCCACNONE 
J100058H12GTGGGTCCCACNONE 
J100067L21GTGGGTCCCACNONE 
Os07g0588600AK108320GTGGGTCCCACCZinc finger, C2H2-type domain containing protein. 
Os07g0592200AK099740GACAGGTGGGACCCACGCGPeptidase A1, pepsin family protein. 
AK110717GACAGGTGGGACCCACGCGNONE 
Os07g0597625J065130O18GGTGGGACCCACGTGGCD-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein. 
J065166J07GGTGGGACCCACGTGGCNONE 
Os07g0598500AK073214ACGCGTGGGTCCCACProtein prenyltransferase domain containing protein. 
J065192M24ACGCGTGGGTCCCACNONE 
J100039G03ACGCGTGGGTCCCACNONE 
Os07g0622900006-108-G01GGTGGGACCNONE 
AK059960GGTGGGACCConserved hypothetical protein. 
J065176B03GGTGGGACCNONE 
J080005P16GGTGGGACCNONE 
J080009F09GGTGGGACCNONE 
J080013F07GGTGGGACCNONE 
J080016L01GGTGGGACCNONE 
J080021K23GGTGGGACCNONE 
J080023D15GGTGGGACCNONE 
J080025D04GGTGGGACCNONE 
J080039C01GGTGGGACCNONE 
J080039G22GGTGGGACCNONE 
J080043K06GGTGGGACCNONE 
J080049H15GGTGGGACCNONE 
J080051K09GGTGGGACCNONE 
J080053I18GGTGGGACCNONE 
J080067C12GGTGGGACCNONE 
J080067G19GGTGGGACCNONE 
J080068L22GGTGGGACCNONE 
J080068M23GGTGGGACCNONE 
J080077I06GGTGGGACCNONE 
J080077J19GGTGGGACCNONE 
J080080A18GGTGGGACCNONE 
J080092J08GGTGGGACCNONE 
Os07g0633400AK071894CGGGTGGGTCCCACCACIQ calmodulin-binding region domain containing protein. 
Os07g0659500AK073537TGGGTCCCACNon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0670300006-085-D04CAAGTGGGTCCCACTCCNONE 
006-116-A08CAAGTGGGTCCCACTCCNONE 
AK061154CAAGTGGGTCCCACTCCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK099020CAAGTGGGTCCCACTCCNONE 
J100056C05CAAGTGGGTCCCACTCCNONE 
Os08g0119800AJ437536CAGGTGGGACCCACNONE 
AK060602CAGGTGGGACCCACSimilar to Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine metabolising enzyme) (L-AME) [Contains: Photosystem II protein psbY-1 (psbY-A1); Photosystem II protein psbY-2 (psbY-A2)]. 
AK067636CAGGTGGGACCCACNONE 
AK068273CAGGTGGGACCCACNONE 
J100075K05CAGGTGGGACCCACNONE 
Os08g0121900AK101512CCCGTGGGACCCACCTGTCProtein of unknown function DUF23 family protein. 
Os08g0128200AK120428GTGGGTCCCACCACConserved hypothetical protein. 
Os08g0143400015-006-A10CACTGACAAGTGGGACCCACNONE 
AK066792CACTGACAAGTGGGACCCACNONE 
AK120532CACTGACAAGTGGGACCCACSWIRM domain containing protein. 
J100083F02CACTGACAAGTGGGACCCACNONE 
Os08g0158600AK072477GTGGGACCCGSimilar to Cell wall invertase (EC 3.2.1.26). 
J023125I06GTGGGACCCGNONE 
J065194K03GTGGGACCCGNONE 
Os08g0208400AK066265GTGGGACCCAEn/Spm-like transposon proteins family protein. 
AK102509GTGGGACCCANONE 
J013059M15GTGGGACCCANONE 
J023080E16GTGGGACCCANONE 
J033095G06GTGGGACCCANONE 
J065170I05GTGGGACCCANONE 
J090034L11GTGGGACCCANONE 
Os08g0316900013-024-A06GTGGGTCCCACCNONE 
J033112J20GTGGGTCCCACCNONE 
J065025M22GTGGGTCCCACCNONE 
J065026E15GTGGGTCCCACCNONE 
Os08g0321600AK060315GTGGGACCNONE 
AK060315GTGGGACCNONE 
AK060871GTGGGACCConserved hypothetical protein. 
AK060871GTGGGACCConserved hypothetical protein. 
AK104500GTGGGACCNONE 
AK104500GTGGGACCNONE 
Os08g0322400AK120116GTGGGACCNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20GTGGGACCNONE 
J013096J15GTGGGACCNONE 
Os08g0326600AK065219TGGGTCCCACCTGTCAGSimilar to GMP synthetase. 
Os08g0356500AK101110GGGTCCCACProtein of unknown function DUF247, plant family protein. 
J033025F01GGGTCCCACNONE 
J065104L22GGGTCCCACNONE 
Os08g0360100AK066365ACACGTGGGTCCCACCRS1/YhbY domain containing protein. 
Os08g0366100AK061882GGTCCCACCNONE 
AK120339GGTCCCACCSimilar to Endothelial differentiation-related factor 1 (EDF-1) (Multiprotein bridging factor 1) (MBF1). 
J013060M10GGTCCCACCNONE 
J023135H23GGTCCCACCNONE 
J033095L23GGTCCCACCNONE 
J065010L09GGTCCCACCNONE 
J065016A02GGTCCCACCNONE 
J065041H14GGTCCCACCNONE 
J065043F09GGTCCCACCNONE 
J065045E03GGTCCCACCNONE 
J065058F23GGTCCCACCNONE 
J065075L19GGTCCCACCNONE 
J065078N12GGTCCCACCNONE 
J065105J19GGTCCCACCNONE 
J065162I03GGTCCCACCNONE 
J065164D10GGTCCCACCNONE 
J065170B05GGTCCCACCNONE 
J075039K19GGTCCCACCNONE 
J075039M06GGTCCCACCNONE 
J075057L17GGTCCCACCNONE 
J075059F17GGTCCCACCNONE 
J075109J04GGTCCCACCNONE 
J075120B14GGTCCCACCNONE 
J075153I11GGTCCCACCNONE 
J075156C19GGTCCCACCNONE 
J075166J20GGTCCCACCNONE 
J090052H04GGTCCCACCNONE 
J100051E13GGTCCCACCNONE 
J100057L03GGTCCCACCNONE 
J100059G23GGTCCCACCNONE 
Os08g0408300006-093-E12GTGGGACCNONE 
AK059926GTGGGACCConserved hypothetical protein. 
AK100845GTGGGACCNONE 
J023123H01GTGGGACCNONE 
Os08g0416400AK064144GTGGGTCCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0439900AK110628TGTGGGGCCCATGTGGGTCCCACMitochondrial glycoprotein family protein. 
J065118D13TGTGGGGCCCATGTGGGTCCCACNONE 
Os08g0465300AK108076GTGGGTCCCACConserved hypothetical protein. 
Os08g0490100009-038-D02CTGACAGGTGGGACCCGNONE 
J065152E11CTGACAGGTGGGACCCGSimilar to PBF protein. 
J090050K03CTGACAGGTGGGACCCGNONE 
J090053L01CTGACAGGTGGGACCCGNONE 
Os08g0490300011-064-F08TGGGTCCCACNONE 
015-050-C06TGGGTCCCACNONE 
AK066895TGGGTCCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013090I22TGGGTCCCACNONE 
J090060F02TGGGTCCCACNONE 
Os08g0511400AK069673CAGGTGGGTCCCACCConserved hypothetical protein. 
J065161H07CAGGTGGGTCCCACCNONE 
Os08g0517300AK069175GTGGGTCCCACCZinc finger, C2H2-type domain containing protein. 
Os08g0524800AK072041GGTCCCACCNONE 
AK099291GGTCCCACCSimilar to TA1 protein (Fragment). 
J065053E08GGTCCCACCNONE 
J065163F15GGTCCCACCNONE 
Os08g0548300AK073266GTGGGACCCAZinc finger, RING-type domain containing protein. 
J013030C19GTGGGACCCANONE 
J033029A20GTGGGACCCANONE 
J033050L14GTGGGACCCANONE 
J033058F03GTGGGACCCANONE 
J033110K01GTGGGACCCANONE 
J033123D21GTGGGACCCANONE 
Os09g0108400016-081-D07GTGGGACCCGCGCNONE 
AK071505GTGGGACCCGCGCConserved hypothetical protein. 
AK106506GTGGGACCCGCGCNONE 
Os09g0129500015-026-C02GTGGGACCNONE 
AK099466GTGGGACCConserved hypothetical protein. 
J013023L05GTGGGACCNONE 
J013124I15GTGGGACCNONE 
J065068J04GTGGGACCNONE 
J065069J19GTGGGACCNONE 
J065166L13GTGGGACCNONE 
J075013J21GTGGGACCNONE 
J075020B06GTGGGACCNONE 
J100036B09GTGGGACCNONE 
J100041L13GTGGGACCNONE 
J100049M17GTGGGACCNONE 
J100071J03GTGGGACCNONE 
J100087O14GTGGGACCNONE 
Os09g0296400J090084M08GGTCCCACConserved hypothetical protein. 
Os09g0380400009-200-D01GACAGGTGGGTCCCACTTGNONE 
AK063909GACAGGTGGGTCCCACTTGNONE 
AK072517GACAGGTGGGTCCCACTTGConserved hypothetical protein. 
AK073073GACAGGTGGGTCCCACTTGNONE 
J065205F20GACAGGTGGGTCCCACTTGNONE 
J100036D22GACAGGTGGGTCCCACTTGNONE 
J100047M01GACAGGTGGGTCCCACTTGNONE 
J100071G04GACAGGTGGGTCCCACTTGNONE 
Os09g0392000AK120392GTGGGACCCGConserved hypothetical protein. 
J013074N02GTGGGACCCGNONE 
Os09g0397200J065178K08GGTCCCACCTGTCConserved hypothetical protein. 
J065178L07GGTCCCACCTGTCNONE 
Os09g0409000AK107676GGTCCCACCTGTCConserved hypothetical protein. 
Os09g0412900014-003-F10GACACGTGGGTCCCACNONE 
AK102254GACACGTGGGTCCCACProtein prenyltransferase domain containing protein. 
AK102867GACACGTGGGTCCCACNONE 
J033088H22GACACGTGGGTCCCACNONE 
Os09g0424850J065006K24GTGGGTCCCACCConserved hypothetical protein. 
Os09g0446200011-092-H04GGTCCCACCSpc97/Spc98 family protein. 
Os09g0456900AK073236GGTCCCACNucleic acid-binding, OB-fold domain containing protein. 
Os09g0465600AB107218GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
AK068061GACAGGTGGGTCCCACGTGGTGACGTGGCSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
Os09g0474501J065129D17GTGGGACCCAConserved hypothetical protein. 
Os09g0477700AK121644CACTGACAGGTGGGTCCCACGGGConserved hypothetical protein. 
Os09g0479400AK109596GTGGGACCCACPhenylalanyl-tRNA synthetase, class IIc family protein. 
Os09g0491788AK073442GGTGGGACCNAD-dependent epimerase/dehydratase family protein. 
J033135E10GGTGGGACCNONE 
Os09g0492700AK101104GTGGTGGGACCSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34) (Fragment). 
U95816GTGGTGGGACCNONE 
Os09g0527700AK111128CGGGTCCCACSimilar to Auxin-induced protein IAA4. 
J065124H12CGGGTCCCACNONE 
J065181I07CGGGTCCCACNONE 
J065207G14CGGGTCCCACNONE 
Os09g0547500009-006-F11GTGGGTCCCACCNONE 
Os09g0552300AK111721GGTCCCACProtein kinase-like domain containing protein. 
J043013E21GGTCCCACNONE 
Os09g0572000J065136G16AGAGTGGGGTGGGTCCCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
J065136G16GTGGGTCCCACCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os11g0109500015-062-C02GGTGGGACCCACNONE 
AK064326GGTGGGACCCACStaphylococcus nuclease (SNase-like) domain containing protein. 
Os11g0118200AK105536GTGGGACCCACGTGTCGHypothetical protein. 
Os11g0127800006-035-E01AGAGTGGGACCNONE 
006-060-G02AGAGTGGGACCNONE 
006-082-D01AGAGTGGGACCNONE 
006-104-F10AGAGTGGGACCNONE 
006-110-B07AGAGTGGGACCNONE 
006-112-D02AGAGTGGGACCNONE 
AK059969AGAGTGGGACCSMAD/FHA domain containing protein. 
AK104015AGAGTGGGACCNONE 
AK104179AGAGTGGGACCNONE 
AK104250AGAGTGGGACCNONE 
J065085P11AGAGTGGGACCNONE 
J065160C07AGAGTGGGACCNONE 
J065172K01AGAGTGGGACCNONE 
J065189L16AGAGTGGGACCNONE 
J065201E06AGAGTGGGACCNONE 
J065209L06AGAGTGGGACCNONE 
J075042M10AGAGTGGGACCNONE 
J075080O12AGAGTGGGACCNONE 
J075087M02AGAGTGGGACCNONE 
J075117O20AGAGTGGGACCNONE 
J075185C03AGAGTGGGACCNONE 
J075188L14AGAGTGGGACCNONE 
Os11g0159000AK065738CCACTGACACGTGGGTCCCACConserved hypothetical protein. 
Os11g0240600015-031-E04GGTCCCACCCGNONE 
016-077-E10GGTCCCACCCGNONE 
AK061589GGTCCCACCCGEsterase/lipase/thioesterase domain containing protein. 
AK120858GGTCCCACCCGNONE 
J075181M24GGTCCCACCCGNONE 
Os11g0256200AK107906GTGGGTCCCACProtein of unknown function DUF842, eukaryotic family protein. 
J065007J01GTGGGTCCCACNONE 
J065167G22GTGGGTCCCACNONE 
J075001G14GTGGGTCCCACNONE 
J075121L13GTGGGTCCCACNONE 
Os11g0484000012-001-D04GGTCCCACNONE 
012-001-D04GTGGGACCCACNONE 
AK065321GGTCCCACClass II aldolase/adducin, N-terminal family protein. 
AK065321GTGGGACCCACClass II aldolase/adducin, N-terminal family protein. 
J013002P15GGTCCCACNONE 
J013002P15GTGGGACCCACNONE 
Os11g0527000J065137N17GTGGGTCCCACCTGTCConserved hypothetical protein. 
Os11g0550900015-031-H10TGGGTCCCACNONE 
AK106291TGGGTCCCACConserved hypothetical protein. 
Os11g0568300016-075-B02GGTGGGACCCACNONE 
AK064398GGTGGGACCCACHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK103282GGTGGGACCCACNONE 
J033124M10GGTGGGACCCACNONE 
J065120I21GGTGGGACCCACNONE 
J065144H16GGTGGGACCCACNONE 
Os11g0585100AK107496GTGGGACCConserved hypothetical protein. 
J065184E24GTGGGACCNONE 
Os11g0648000AK066444GCCACGTGGCCCACAGGTGGGTCCCACSimilar to Na+/H+ antiporter. 
AK072026GCCACGTGGCCCACAGGTGGGTCCCACNONE 
Os11g0672900014-017-A02GGTCCCACCTGTCAGNONE 
AK105350GGTCCCACCTGTCAGProtein of unknown function DUF1645 family protein. 
Os11g0682600J090026G08GTGGGACCConserved hypothetical protein. 
J090037N19GTGGGACCNONE 
J090061M21GTGGGACCNONE 
Os12g0109200AK103380GGTGGGACCCACSimilar to Ca(2+)-dependent nuclease. 
J033127E15GGTGGGACCCACNONE 
J090085H16GGTGGGACCCACNONE 
Os12g0145200AK111428GTGGGACCCACGTGGGCCCCACASimilar to Protein MONOCULM 1. 
J065208D22GTGGGACCCACGTGGGCCCCACANONE 
Os12g0151500AK058389GTGGGTCCCACCACSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865GTGGGTCCCACCACNONE 
Os12g0168000AK065623GGTCCCAC5-formyltetrahydrofolate cyclo-ligase family protein. 
AK065623GGTCCCACCTGTCAGTG5-formyltetrahydrofolate cyclo-ligase family protein. 
AK072953GGTCCCACNONE 
AK072953GGTCCCACCTGTCAGTGNONE 
J100024I20GGTCCCACNONE 
J100024I20GGTCCCACCTGTCAGTGNONE 
Os12g0175400009-157-A08CAAGTGGGACCCACTCCNONE 
011-089-A10CAAGTGGGACCCACTCCNONE 
AK063027CAAGTGGGACCCACTCCNONE 
D88618CAAGTGGGACCCACTCCHomeodomain-like containing protein. 
Os12g0238100AK064983GGTGGGACCExocyst complex component Sec10 family protein. 
Os12g0270300AK070311GGTCCCACCAACGGCDisease resistance protein family protein. 
AK103036GGTCCCACCAACGGCNONE 
Os12g0405300AK070969GTGGGACCCACCTGTCConserved hypothetical protein. 
Os12g0460800J023003J21CCCGTGGGTCCCACCNONE 
Os12g0477600009-115-E02GGGTCCCACNONE 
009-125-D04GGGTCCCACNONE 
009-152-E11GGGTCCCACNONE 
013-003-H06GGGTCCCACNONE 
AK099534GGGTCCCACConserved hypothetical protein. 
J065109J18GGGTCCCACNONE 
J065115L23GGGTCCCACNONE 
J075002K19GGGTCCCACNONE 
J075034D13GGGTCCCACNONE 
J075038B07GGGTCCCACNONE 
J075051A21GGGTCCCACNONE 
J075052J11GGGTCCCACNONE 
J075072A08GGGTCCCACNONE 
J075080E10GGGTCCCACNONE 
J075101E13GGGTCCCACNONE 
J075112F22GGGTCCCACNONE 
J075139O17GGGTCCCACNONE 
J075141K08GGGTCCCACNONE 
J075146N01GGGTCCCACNONE 
J075171J24GGGTCCCACNONE 
Os12g0532500J065025O16GGTCCCACHypothetical protein. 
Os12g0605800AK121511CTGACAGGTGGGTCCCACTCCSimilar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment). 
Os12g0620400015-008-B10GGTGGGACCNONE 
AK059006GGTGGGACCNONE 
AK059973GGTGGGACCNONE 
AK063843GGTGGGACCMethyl-CpG binding domain containing protein. 
AK072503GGTGGGACCNONE 
AK072934GGTGGGACCNONE 
J023126H05GGTGGGACCNONE 
J023131G11GGTGGGACCNONE 
J023146E17GGTGGGACCNONE 
J033064P08GGTGGGACCNONE 
J033095L07GGTGGGACCNONE 
J065101N06GGTGGGACCNONE 
J065186F11GGTGGGACCNONE 
J065215J15GGTGGGACCNONE 
J080049H05GGTGGGACCNONE 
J080059L05GGTGGGACCNONE 
J080061M17GGTGGGACCNONE 
J080063D16GGTGGGACCNONE 
J090012D01GGTGGGACCNONE 
J090023D20GGTGGGACCNONE 
J090040A09GGTGGGACCNONE 
J090044K08GGTGGGACCNONE 
J100019H03GGTGGGACCNONE 
J100054N04GGTGGGACCNONE 
Os12g0634900AK106811GGAGTGGGACCCTetratricopeptide-like helical domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.