version

Summary of OsREG651 (All List)

OrganismOryza sativa  
IDOsREG651  
SequenceGGTGGGAC  
Annotation  
PPDB MotifGGGACCC  function unknown  
PLACE Motif 
Total Entry Count934  

Entry Sequences (934 entries)

LocusGene modelSequenceDescription
Os01g0102600AK064812GGTGGGACCCACShikimate kinase domain containing protein. 
J013000E05GGTGGGACCCACNONE 
J013027D08GGTGGGACCCACNONE 
J013045K12GGTGGGACCCACNONE 
J023119M03GGTGGGACCCACNONE 
J065081F02GGTGGGACCCACNONE 
J065180C08GGTGGGACCCACNONE 
J065211M06GGTGGGACCCACNONE 
J075073J06GGTGGGACCCACNONE 
J075123A18GGTGGGACCCACNONE 
J075124A07GGTGGGACCCACNONE 
J075187B05GGTGGGACCCACNONE 
Os01g0144600009-164-E06GGTCCCACCTGTCNONE 
AK063058GGTCCCACCTGTCNONE 
J065061I15GGTCCCACCTGTCNONE 
J065128M13GGTCCCACCTGTCNONE 
J065152N15GGTCCCACCTGTCNONE 
J075170M11GGTCCCACCTGTCNONE 
J090071M11GGTCCCACCTGTCNONE 
J090073B22GGTCCCACCTGTCNONE 
Os01g0147700AK066686GACAGGTGGGACCCACCCGRegion of unknown function, putative Zinc finger, XS and XH domain containing protein. 
Os01g0172300AK106113GGTGGGACCCAConserved hypothetical protein. 
Os01g0180300AK120377GTGGGTCCCACCACLipoprotein, type 6 family protein. 
J013071N06GTGGGTCCCACCACNONE 
J023088F12GTGGGTCCCACCACNONE 
J100027H24GTGGGTCCCACCACNONE 
J100053K15GTGGGTCCCACCACNONE 
J100082M15GTGGGTCCCACCACNONE 
Os01g0211600AK060710GTCCCACCCytochrome P450 family protein. 
Os01g0246500AK058984CCGATCCGATCCGTCCCACCSimilar to Minus dominance protein. 
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein. 
J065013K07GGTGGGACCCACGTGGACACGTGGCNONE 
J065040E15GGTGGGACCCACGTGGACACGTGGCNONE 
J065127F12GGTGGGACCCACGTGGACACGTGGCNONE 
J075155K23GGTGGGACCCACGTGGACACGTGGCNONE 
Os01g0355400AK064594GTCCCACCConserved hypothetical protein. 
AK107903GTCCCACCNONE 
Os01g0528300009-015-C05GTGGGTCCCACCNONE 
AK062349GTGGGTCCCACCSimilar to HcrVf3 protein. 
Os01g0618900AK099329GTGGTGGGACNONE 
Os01g0654500013-057-E05GACAGGTGGGACCCANONE 
AF155333GACAGGTGGGACCCANONE 
AK061752GACAGGTGGGACCCASimilar to NADP-isocitrate dehydrogenase. 
D21069GACAGGTGGGACCCANONE 
Os01g0674500013-062-A08GGTGGGACNONE 
AK072815GGTGGGACNONE 
J023142B02GGTGGGACNONE 
Os01g0695200015-090-F01GTCCCACCTGTCNONE 
AK064145GTCCCACCTGTCProtein of unknown function DUF266, plant family protein. 
J065163N10GTCCCACCTGTCNONE 
J100051F21GTCCCACCTGTCNONE 
Os01g0703300014-015-D07GTCCCACCNONE 
AK099917GTCCCACCNONE 
Os01g0723000AK073592GGTGGGACCSimilar to Elongation factor EF-2 (Fragment). 
AK102586GGTGGGACCNONE 
J033048F11GGTGGGACCNONE 
J033098E24GGTGGGACCNONE 
Os01g0756300014-074-B05GTCCCACCNONE 
AK069648GTCCCACCConserved hypothetical protein. 
Os01g0764000006-021-G03GTCCCACCNONE 
006-025-C07GTCCCACCNONE 
006-029-G11GTCCCACCNONE 
006-030-C04GTCCCACCNONE 
006-035-E05GTCCCACCNONE 
006-037-G01GTCCCACCNONE 
006-038-C01GTCCCACCNONE 
006-039-G05GTCCCACCNONE 
006-042-E11GTCCCACCNONE 
006-044-H04GTCCCACCNONE 
006-045-A10GTCCCACCNONE 
006-045-C05GTCCCACCNONE 
006-047-A11GTCCCACCNONE 
006-048-H10GTCCCACCNONE 
006-050-C01GTCCCACCNONE 
006-050-H11GTCCCACCNONE 
006-051-G10GTCCCACCNONE 
006-051-G11GTCCCACCNONE 
006-056-B04GTCCCACCNONE 
006-063-F04GTCCCACCNONE 
006-063-H12GTCCCACCNONE 
006-065-G09GTCCCACCNONE 
006-067-F11GTCCCACCNONE 
006-073-D10GTCCCACCNONE 
006-074-G09GTCCCACCNONE 
006-075-D04GTCCCACCNONE 
006-077-C10GTCCCACCNONE 
006-082-A10GTCCCACCNONE 
006-084-C12GTCCCACCNONE 
006-085-F05GTCCCACCNONE 
006-087-H12GTCCCACCNONE 
006-092-E10GTCCCACCNONE 
006-094-C06GTCCCACCNONE 
006-096-G11GTCCCACCNONE 
006-097-H11GTCCCACCNONE 
006-101-A07GTCCCACCNONE 
006-101-G08GTCCCACCNONE 
006-110-E08GTCCCACCNONE 
006-111-D04GTCCCACCNONE 
006-116-H04GTCCCACCNONE 
AK058894GTCCCACCNONE 
AK059818GTCCCACCSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142GTCCCACCNONE 
J013119N15GTCCCACCNONE 
J013123P15GTCCCACCNONE 
J023055F24GTCCCACCNONE 
J023125K17GTCCCACCNONE 
J053050A20GTCCCACCNONE 
J053056P10GTCCCACCNONE 
J053074D19GTCCCACCNONE 
J053078A14GTCCCACCNONE 
J053086P10GTCCCACCNONE 
J053094N23GTCCCACCNONE 
J053095M23GTCCCACCNONE 
J065006D02GTCCCACCNONE 
J065030A17GTCCCACCNONE 
J065030K04GTCCCACCNONE 
J065035L12GTCCCACCNONE 
J065046E12GTCCCACCNONE 
J065065H19GTCCCACCNONE 
J065073C01GTCCCACCNONE 
J065105F01GTCCCACCNONE 
J065131N16GTCCCACCNONE 
J065144O13GTCCCACCNONE 
J065160E12GTCCCACCNONE 
J065160K02GTCCCACCNONE 
J065163F09GTCCCACCNONE 
J065165E18GTCCCACCNONE 
J065174E04GTCCCACCNONE 
J065175O08GTCCCACCNONE 
J065191N24GTCCCACCNONE 
J065193D19GTCCCACCNONE 
J065198D04GTCCCACCNONE 
J065200G09GTCCCACCNONE 
J075016L06GTCCCACCNONE 
J075017J11GTCCCACCNONE 
J075019L08GTCCCACCNONE 
J075028M08GTCCCACCNONE 
J075029K05GTCCCACCNONE 
J075039K04GTCCCACCNONE 
J075047J22GTCCCACCNONE 
J075079H13GTCCCACCNONE 
J075095K14GTCCCACCNONE 
J075111D21GTCCCACCNONE 
J075131A19GTCCCACCNONE 
J075147G20GTCCCACCNONE 
J075158F11GTCCCACCNONE 
J075166N10GTCCCACCNONE 
J075196G09GTCCCACCNONE 
J075198I24GTCCCACCNONE 
J090001L08GTCCCACCNONE 
J090026G07GTCCCACCNONE 
J090050M15GTCCCACCNONE 
J090071A01GTCCCACCNONE 
J090072P16GTCCCACCNONE 
J090078D22GTCCCACCNONE 
J090089C18GTCCCACCNONE 
J100019B07GTCCCACCNONE 
J100019H15GTCCCACCNONE 
J100019P09GTCCCACCNONE 
J100023A16GTCCCACCNONE 
J100023B09GTCCCACCNONE 
J100026O18GTCCCACCNONE 
J100027E09GTCCCACCNONE 
J100028F22GTCCCACCNONE 
J100029P05GTCCCACCNONE 
J100031M19GTCCCACCNONE 
J100032A11GTCCCACCNONE 
J100036G19GTCCCACCNONE 
J100038E22GTCCCACCNONE 
J100040A12GTCCCACCNONE 
J100040L02GTCCCACCNONE 
J100043O13GTCCCACCNONE 
J100045E20GTCCCACCNONE 
J100046H18GTCCCACCNONE 
J100047E08GTCCCACCNONE 
J100050E08GTCCCACCNONE 
J100050P14GTCCCACCNONE 
J100051G10GTCCCACCNONE 
J100052L12GTCCCACCNONE 
J100056G24GTCCCACCNONE 
J100066B15GTCCCACCNONE 
J100068O15GTCCCACCNONE 
J100070J16GTCCCACCNONE 
J100074I22GTCCCACCNONE 
J100075M12GTCCCACCNONE 
J100077M09GTCCCACCNONE 
J100077O14GTCCCACCNONE 
J100079J08GTCCCACCNONE 
J100080I16GTCCCACCNONE 
Os01g0766600AK061986GTCCCACCACNONE 
AK103570GTCCCACCACBSD domain containing protein. 
Os01g0789100AK069910GGTCCCACCCDP-alcohol phosphatidyltransferase family protein. 
J080093C23GGTCCCACCNONE 
Os01g0818000AK069848GGTCCCACCCGNONE 
AK070194GGTCCCACCCGAuxin Efflux Carrier family protein. 
J023041H12GGTCCCACCCGNONE 
Os01g0833200AK121629GGTGGGACConserved hypothetical protein. 
J023093N07GGTGGGACNONE 
J033050C20GGTGGGACNONE 
J080302F22GGTGGGACNONE 
J080303H06GGTGGGACNONE 
J080306J04GGTGGGACNONE 
J080309K06GGTGGGACNONE 
J080311E18GGTGGGACNONE 
J080318A20GGTGGGACNONE 
J100031F20GGTGGGACNONE 
J100034P21GGTGGGACNONE 
J100042K08GGTGGGACNONE 
J100047H24GGTGGGACNONE 
J100065C14GGTGGGACNONE 
J100074E23GGTGGGACNONE 
Os01g0835500AK100241GTCCCACCACSimilar to Respiratory burst oxidase protein. 
Os01g0862800AK071274GTCCCACCACGCCACNo apical meristem (NAM) protein domain containing protein. 
Os01g0865600AK068033GTCCCACCNONE 
AK099677GTCCCACCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J090007G21GTCCCACCNONE 
J090023C20GTCCCACCNONE 
J090039J16GTCCCACCNONE 
J090054K15GTCCCACCNONE 
Os01g0867900AK061366CGCGTCGCAGGTGGGTCCCACCTGProtein of unknown function DUF502 family protein. 
Os01g0896400AK107067GGTCCCACCTGConserved hypothetical protein. 
Os01g0897600J065120F23GTGGGTCCCACCNONE 
Os01g0908400009-140-E01GGTCCCACCNONE 
AK062957GGTCCCACCConserved hypothetical protein. 
AK099301GGTCCCACCNONE 
J065123M13GGTCCCACCNONE 
J075020O14GGTCCCACCNONE 
J075136L21GGTCCCACCNONE 
Os01g0911200AK101333GGTCCCACCRibophorin II family protein. 
Os01g0913100AK070387GGTCCCACCACProtein of unknown function DUF538 family protein. 
J100090K15GGTCCCACCACNONE 
Os01g0919900006-027-D02GTCCCACCNONE 
009-156-F01GTCCCACCNONE 
AK060087GTCCCACCNONE 
Os01g0934300AK101422GGTGGGACCCNONE 
J033038C07GGTGGGACCCNONE 
Os01g0961200011-099-H06GTGGGTCCCACCNONE 
AK105424GTGGGTCCCACCCBS domain containing protein. 
J065169J18GTGGGTCCCACCNONE 
J075109H12GTGGGTCCCACCNONE 
Os01g0972300009-034-G05TGGGTCCCACCCACTCCCACTCCNONE 
AK062432TGGGTCCCACCCACTCCCACTCCDVL family protein. 
Os02g0119700AK108777GTCCCACCTGProtein prenyltransferase domain containing protein. 
Os02g0121000AK099931GTGGGTCCCACCTGTCAGTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0137100015-082-A12GGTCCCACCNONE 
016-013-D11GGTCCCACCNONE 
AK073353GGTCCCACCConserved hypothetical protein 1589, plant family protein. 
J013026D20GGTCCCACCNONE 
J013111M05GGTCCCACCNONE 
J023099B09GGTCCCACCNONE 
J033025E21GGTCCCACCNONE 
J033082H04GGTCCCACCNONE 
J065110E11GGTCCCACCNONE 
Os02g0228900AK121870GGTCCCACCSimilar to Auxin-responsive protein IAA18 (Indoleacetic acid-induced protein 18). 
Os02g0312700AK072956CACGGCCCAAAGTCCCACCATP11 family protein. 
AK102909CACGGCCCAAAGTCCCACCNONE 
J065017G18CACGGCCCAAAGTCCCACCNONE 
J075066A05CACGGCCCAAAGTCCCACCNONE 
Os02g0318400AK064642GGTCCCACCTGTCConserved hypothetical protein. 
J075032B17GGTCCCACCTGTCNONE 
Os02g0326000006-099-D01GGTGGGACNONE 
AK059937GGTGGGACNONE 
AK102973GGTGGGACConserved hypothetical protein. 
J033115K18GGTGGGACNONE 
J075069J04GGTGGGACNONE 
Os02g0506500AK062572GACAGGTGGGACCNONE 
AK063549GACAGGTGGGACCNONE 
AK101016GACAGGTGGGACCMolybdenum cofactor biosynthesis domain containing protein. 
AK109318GACAGGTGGGACCNONE 
J013000C16GACAGGTGGGACCNONE 
J013155N06GACAGGTGGGACCNONE 
J023067A02GACAGGTGGGACCNONE 
J023149E02GACAGGTGGGACCNONE 
J033033J18GACAGGTGGGACCNONE 
J033051O15GACAGGTGGGACCNONE 
J075034C22GACAGGTGGGACCNONE 
J075054O10GACAGGTGGGACCNONE 
J075108L14GACAGGTGGGACCNONE 
J090043O06GACAGGTGGGACCNONE 
J100024P03GACAGGTGGGACCNONE 
Os02g0530600AK102681GTCCCACCCCCACGBRCT domain containing protein. 
Os02g0534600Os02g0534600GTGGGTCCCACCConserved hypothetical protein. 
Os02g0535400AK111881GGTCCCACCConserved hypothetical protein. 
J033050A01GGTCCCACCNONE 
J065043D01GGTCCCACCNONE 
Os02g0566400AK101019GTCCCACCTGConserved hypothetical protein. 
Os02g0651500AK066333GTCCCACCCCCACTCCNONE 
AK121865GTCCCACCCCCACTCCHypothetical protein. 
J090038J11GTCCCACCCCCACTCCNONE 
Os02g0686700AK111294AGCCCACAGACAGGTGGGACCCGProtein of unknown function DUF581 family protein. 
Os02g0697500AK105680CAGGTGGGACSimilar to Selenium-binding protein-like. 
Os02g0697700AK120209CGGGTGGGACCConserved hypothetical protein. 
J013038N05CGGGTGGGACCNONE 
J013170I01CGGGTGGGACCNONE 
J033144L08CGGGTGGGACCNONE 
J033145L08CGGGTGGGACCNONE 
J043004E24CGGGTGGGACCNONE 
J065032A08CGGGTGGGACCNONE 
J065166F03CGGGTGGGACCNONE 
J075174D13CGGGTGGGACCNONE 
J100019I19CGGGTGGGACCNONE 
J100073F13CGGGTGGGACCNONE 
Os02g0702600AK102549GGTGGGACProtein of unknown function DUF315 domain containing protein. 
AK102962GGTGGGACNONE 
Os02g0733300AK101108TCCAACGGTCCCACCCGSimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4). 
AK105446TCCAACGGTCCCACCCGNONE 
Os02g0753800AK101787CGGGTCCCACCSimilar to Annexin p35. 
Os02g0769200J065031C02GGTCCCACCTGTCNONE 
J065206E04GGTCCCACCTGTCNONE 
Os02g0788600Os02g0788600GGTCCCACCClp, N terminal domain containing protein. 
Os03g0106400AK108687GGTGGGACCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os03g0123300003-131-G09GTCCCACCACNONE 
AK058595GTCCCACCACNONE 
J075056B01GTCCCACCACNONE 
Os03g0130400AK070255GACAGGTGGGACCAdenylate kinase, subfamily protein. 
Os03g0134300AK102053ACGTGTCCCACCACSimilar to ATP phosphoribosyl transferase. 
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0167000AK107307GGTGGGACConserved hypothetical protein. 
J100070K07GGTGGGACNONE 
Os03g0177000AK071368GTGGGTCCCACCGCN5-related N-acetyltransferase domain containing protein. 
Os03g0178300AK121217GTCCCACCEpoxide hydrolase family protein. 
Os03g0213600AK100407GGTGGGACCCACCCGConserved hypothetical protein. 
Os03g0218400AK069202GTGGGTCCCACCSimilar to Hexose transporter. 
AK099306GTGGGTCCCACCNONE 
AY342321GTGGGTCCCACCNONE 
J023066K08GTGGGTCCCACCNONE 
J100032N19GTGGGTCCCACCNONE 
Os03g0275900AK109303GGTGGGACCNONE 
AK121978GGTGGGACCSimilar to Spotted leaf protein 11 (Spotted leaf11) (Cell death-related protein SPL11). 
Os03g0283100006-097-E01GGTCCCACCNONE 
AK061849GGTCCCACCNONE 
AK065887GGTCCCACCSimilar to In2-1 protein. 
J013044J05GGTCCCACCNONE 
J013130I02GGTCCCACCNONE 
J013162M18GGTCCCACCNONE 
J023014O17GGTCCCACCNONE 
J023139N17GGTCCCACCNONE 
Os03g0288101J023001N08GGTCCCACCNONE 
J033068A04GGTCCCACCNONE 
J033111P19GGTCCCACCNONE 
J065131H13GGTCCCACCHypothetical protein. 
Os03g0298900006-028-C11GGTGGGACCCACNONE 
AK060996GGTGGGACCCACHypothetical protein. 
Os03g0343700AK060603GGTGGGACCCACBrix domain containing protein. 
AK102274GGTGGGACCCACNONE 
J033089C06GGTGGGACCCACNONE 
J090089A17GGTGGGACCCACNONE 
Os03g0704200AK071176GCCACGTGGGTCCCACCZinc finger, MYND-type domain containing protein. 
J023083O08GCCACGTGGGTCCCACCNONE 
Os03g0711800AK122108GTCCCACCSimilar to IRE homolog 1 (Fragment). 
Os03g0713100J013039M09GGTCCCACCACNONE 
J023007K01GGTCCCACCACNONE 
J023073H01GGTCCCACCACNONE 
J023087M20GGTCCCACCACNONE 
J023142E01GGTCCCACCACNONE 
J033048E03GGTCCCACCACNONE 
J033048F03GGTCCCACCACSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11GGTCCCACCACNONE 
J033074M20GGTCCCACCACNONE 
J033084M11GGTCCCACCACNONE 
J033091I23GGTCCCACCACNONE 
J033100C08GGTCCCACCACNONE 
J033123K19GGTCCCACCACNONE 
J090006P21GGTCCCACCACNONE 
J090045O16GGTCCCACCACNONE 
J100087M13GGTCCCACCACNONE 
Os03g0780600AK120180TGGGTCCCACCNONE 
D13224TGGGTCCCACCTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18TGGGTCCCACCNONE 
J033022G05TGGGTCCCACCNONE 
J033028A16TGGGTCCCACCNONE 
J033050M08TGGGTCCCACCNONE 
J090053F04TGGGTCCCACCNONE 
J090064E19TGGGTCCCACCNONE 
J090083J24TGGGTCCCACCNONE 
J100024I23TGGGTCCCACCNONE 
Os03g0797700005-001-F11GTCCCACCNONE 
AK061648GTCCCACCConserved hypothetical protein. 
AK098876GTCCCACCNONE 
J013001D18GTCCCACCNONE 
J033070I21GTCCCACCNONE 
J065124F13GTCCCACCNONE 
J065218D02GTCCCACCNONE 
J090080A22GTCCCACCNONE 
J100032P18GTCCCACCNONE 
Os03g0820400009-042-F06ACGCGTCCCACCNONE 
009-046-E08ACGCGTCCCACCNONE 
009-079-B08ACGCGTCCCACCNONE 
009-111-H09ACGCGTCCCACCNONE 
009-150-D10ACGCGTCCCACCNONE 
015-073-H11ACGCGTCCCACCNONE 
AK119690ACGCGTCCCACCSimilar to ZPT2-13. 
AY286473ACGCGTCCCACCNONE 
AY305864ACGCGTCCCACCNONE 
J100051O21ACGCGTCCCACCNONE 
Os03g0861300AK109024GGTGGGACSimilar to Aquaporin. 
Os04g0516900AK108714GTCCCACCConserved hypothetical protein. 
Os04g0558400AK061440GGTCCCACCTGACAGGAcyl-CoA thioesterase family protein. 
AK102197GGTCCCACCTGACAGGNONE 
J013046K23GGTCCCACCTGACAGGNONE 
J013090O17GGTCCCACCTGACAGGNONE 
J033087D05GGTCCCACCTGACAGGNONE 
J065029A16GGTCCCACCTGACAGGNONE 
J065121A13GGTCCCACCTGACAGGNONE 
J090063H18GGTCCCACCTGACAGGNONE 
J100048C18GGTCCCACCTGACAGGNONE 
Os04g0606800009-159-H11GGTCCCACCNONE 
AK072824GGTCCCACCConserved hypothetical protein. 
J033070J06GGTCCCACCNONE 
J033119D03GGTCCCACCNONE 
J100043F05GGTCCCACCNONE 
J100050A01GGTCCCACCNONE 
Os04g0642100011-074-F06TGGGTCCCACCNONE 
J043006J10TGGGTCCCACCSimilar to Microtubule-associated protein EB1. 
J043006P09TGGGTCCCACCNONE 
Os04g0668900AF085174GTCCCACCNONE 
AK067891GTCCCACCSimilar to Plastid terminal oxidase. 
Os05g0119300004-011-B09GTCCCACCNONE 
006-063-A03GTCCCACCNONE 
006-077-E12GTCCCACCNONE 
006-079-E12GTCCCACCNONE 
006-100-B11GTCCCACCNONE 
009-109-A12GTCCCACCNONE 
009-123-C07GTCCCACCNONE 
009-163-D09GTCCCACCNONE 
009-170-D11GTCCCACCNONE 
009-173-C01GTCCCACCNONE 
009-192-E01GTCCCACCNONE 
011-048-G01GTCCCACCNONE 
AK060883GTCCCACCNONE 
AK068289GTCCCACCNONE 
AK071554GTCCCACCNONE 
AK099495GTCCCACCXYPPX repeat containing protein. 
AY348312GTCCCACCNONE 
J013037L16GTCCCACCNONE 
J013088P04GTCCCACCNONE 
J013099D14GTCCCACCNONE 
J013146E19GTCCCACCNONE 
J013147E18GTCCCACCNONE 
J023104E19GTCCCACCNONE 
J023128O20GTCCCACCNONE 
J023132D16GTCCCACCNONE 
J023143E13GTCCCACCNONE 
J033028F15GTCCCACCNONE 
J033133D24GTCCCACCNONE 
J053091M07GTCCCACCNONE 
J075029L15GTCCCACCNONE 
J075097M12GTCCCACCNONE 
J075103J11GTCCCACCNONE 
J075138J10GTCCCACCNONE 
J075172K18GTCCCACCNONE 
J080001C15GTCCCACCNONE 
J080002M13GTCCCACCNONE 
J080009K01GTCCCACCNONE 
J080010N01GTCCCACCNONE 
J080011D23GTCCCACCNONE 
J080013C13GTCCCACCNONE 
J080013M16GTCCCACCNONE 
J080018J02GTCCCACCNONE 
J080020F03GTCCCACCNONE 
J080020G05GTCCCACCNONE 
J080021D05GTCCCACCNONE 
J080030A19GTCCCACCNONE 
J080031A16GTCCCACCNONE 
J080033J23GTCCCACCNONE 
J080035H07GTCCCACCNONE 
J080039M24GTCCCACCNONE 
J080042B16GTCCCACCNONE 
J080043B03GTCCCACCNONE 
J080045G01GTCCCACCNONE 
J080045K17GTCCCACCNONE 
J080047A09GTCCCACCNONE 
J080047I22GTCCCACCNONE 
J080048M14GTCCCACCNONE 
J080049J02GTCCCACCNONE 
J080052C15GTCCCACCNONE 
J080052E11GTCCCACCNONE 
J080052M22GTCCCACCNONE 
J080056O21GTCCCACCNONE 
J080059J04GTCCCACCNONE 
J080059O17GTCCCACCNONE 
J080064N04GTCCCACCNONE 
J080066A03GTCCCACCNONE 
J080066I22GTCCCACCNONE 
J080069C13GTCCCACCNONE 
J080069J03GTCCCACCNONE 
J080069N04GTCCCACCNONE 
J080071A01GTCCCACCNONE 
J080071C03GTCCCACCNONE 
J080071J02GTCCCACCNONE 
J080080D17GTCCCACCNONE 
J080084O06GTCCCACCNONE 
J080085O20GTCCCACCNONE 
J080086H15GTCCCACCNONE 
J080094K06GTCCCACCNONE 
J080095C05GTCCCACCNONE 
J080095G04GTCCCACCNONE 
J080096F03GTCCCACCNONE 
J080096F20GTCCCACCNONE 
J090004H05GTCCCACCNONE 
J090012P10GTCCCACCNONE 
J090021B09GTCCCACCNONE 
J090034M08GTCCCACCNONE 
J090046G21GTCCCACCNONE 
J090055K24GTCCCACCNONE 
J090055L05GTCCCACCNONE 
J090057H17GTCCCACCNONE 
J090082K21GTCCCACCNONE 
J100022A07GTCCCACCNONE 
J100022M02GTCCCACCNONE 
J100069K11GTCCCACCNONE 
J100086C24GTCCCACCNONE 
Os05g0163700AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0169400AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein. 
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
Os05g0300700014-079-G07GGTGGGACCCACNONE 
AK063728GGTGGGACCCACNONE 
AK067846GGTGGGACCCACConserved hypothetical protein. 
Os05g0322900006-057-H12GGTCCCACCTGNONE 
014-051-A08GGTCCCACCTGNONE 
AK063697GGTCCCACCTGNONE 
AK066255GGTCCCACCTGSimilar to WRKY transcription factor 45. 
AK103959GGTCCCACCTGNONE 
AY870611GGTCCCACCTGNONE 
J100068H13GGTCCCACCTGNONE 
Os05g0354400AK065144GGTGGGACCCAProtein of unknown function DUF231, plant domain containing protein. 
Os05g0357200014-046-H09GGTCCCACCNONE 
AK064069GGTCCCACCNONE 
AK072064GGTCCCACCMitochondrial substrate carrier family protein. 
J065038M01GGTCCCACCNONE 
J065121C16GGTCCCACCNONE 
J075173E09GGTCCCACCNONE 
J080307A20GGTCCCACCNONE 
J090046B19GGTCCCACCNONE 
J100033N12GGTCCCACCNONE 
J100036G01GGTCCCACCNONE 
J100057B19GGTCCCACCNONE 
Os05g0358000006-083-G07CGGGTCCCACCNONE 
006-083-G07GTCCCACCACNONE 
AK061141CGGGTCCCACCNONE 
AK061141GTCCCACCACNONE 
AK070900CGGGTCCCACCNONE 
AK070900GTCCCACCACNONE 
AK101263CGGGTCCCACCDrought induced 19 family protein. 
AK101263GTCCCACCACDrought induced 19 family protein. 
J023098C13CGGGTCCCACCNONE 
J023098C13GTCCCACCACNONE 
J033032J06CGGGTCCCACCNONE 
J033032J06GTCCCACCACNONE 
J065014A09CGGGTCCCACCNONE 
J065014A09GTCCCACCACNONE 
J065121L01CGGGTCCCACCNONE 
J065121L01GTCCCACCACNONE 
J065130K19CGGGTCCCACCNONE 
J065130K19GTCCCACCACNONE 
J065208B21CGGGTCCCACCNONE 
J065208B21GTCCCACCACNONE 
J075080G14CGGGTCCCACCNONE 
J075080G14GTCCCACCACNONE 
J075135L01CGGGTCCCACCNONE 
J075135L01GTCCCACCACNONE 
J075180J15CGGGTCCCACCNONE 
J075180J15GTCCCACCACNONE 
Os05g0387600011-059-E01GTCCCACCNONE 
AK105254GTCCCACCNONE 
AK120230GTCCCACCProtein kinase-like domain containing protein. 
Os05g0490000011-076-C07GGTGGGACCCANONE 
015-026-D07GGTGGGACCCANONE 
015-074-A08GGTGGGACCCANONE 
AK064335GGTGGGACCCANONE 
AK101340GGTGGGACCCAKrr1 family protein. 
J033034J18GGTGGGACCCANONE 
Os05g0584900012-044-B12GTCCCACCTGTCNONE 
012-082-A03GTCCCACCTGTCNONE 
AK105309GTCCCACCTGTCC4-dicarboxylate transporter/malic acid transport protein family protein. 
J053069A10GTCCCACCTGTCNONE 
J065070I05GTCCCACCTGTCNONE 
J075096O04GTCCCACCTGTCNONE 
J075136D21GTCCCACCTGTCNONE 
Os06g0103500003-106-F05GGTGGGACNONE 
AK060849GGTGGGACNONE 
AK063051GGTGGGACNONE 
AK098983GGTGGGACNONE 
AK100758GGTGGGACSimilar to Acyl-coenzyme A oxidase 1, peroxisomal (EC 1.3.3.6) (AOX 1) (Long- chain acyl-CoA oxidase) (AtCX1). 
J013025E24GGTGGGACNONE 
J013044A02GGTGGGACNONE 
J013055H14GGTGGGACNONE 
J013060P16GGTGGGACNONE 
J013072I11GGTGGGACNONE 
J013111N01GGTGGGACNONE 
J013156E03GGTGGGACNONE 
J013170E13GGTGGGACNONE 
J023008P06GGTGGGACNONE 
J023013I11GGTGGGACNONE 
J023029P06GGTGGGACNONE 
J023034A11GGTGGGACNONE 
J023036A17GGTGGGACNONE 
J023037E18GGTGGGACNONE 
J023042P07GGTGGGACNONE 
J023075M15GGTGGGACNONE 
J023095G16GGTGGGACNONE 
J023119B01GGTGGGACNONE 
J023119G12GGTGGGACNONE 
J023132L08GGTGGGACNONE 
J023138M18GGTGGGACNONE 
J023145O18GGTGGGACNONE 
J033029D15GGTGGGACNONE 
J033029F17GGTGGGACNONE 
J033029F18GGTGGGACNONE 
J033031K15GGTGGGACNONE 
J033050B08GGTGGGACNONE 
J033067L14GGTGGGACNONE 
J033074E14GGTGGGACNONE 
J033079J08GGTGGGACNONE 
J033089E23GGTGGGACNONE 
J033121B18GGTGGGACNONE 
J033123G01GGTGGGACNONE 
J033138E04GGTGGGACNONE 
J033138K18GGTGGGACNONE 
J033139A16GGTGGGACNONE 
J043012J18GGTGGGACNONE 
J090031C24GGTGGGACNONE 
J100041P08GGTGGGACNONE 
Os06g0125200015-099-F09GGTGGGACNONE 
AK102200GGTGGGACProtein of unknown function DUF581 family protein. 
J033030E04GGTGGGACNONE 
J033058K06GGTGGGACNONE 
J033060O13GGTGGGACNONE 
J033068B04GGTGGGACNONE 
J033087E11GGTGGGACNONE 
J033113N12GGTGGGACNONE 
J065110P15GGTGGGACNONE 
J075174B01GGTGGGACNONE 
Os06g0136900AK107405GTGGGTCCCACCGCACProtein of unknown function DUF296 domain containing protein. 
Os06g0160700012-100-G07GGTGGGACNONE 
AF165890GGTGGGACNONE 
AK109458GGTGGGACSimilar to Starch synthase I, chloroplast precursor (EC 2.4.1.21) (Soluble starch synthase 1) (SSS 1). 
AY299404GGTGGGACNONE 
D16202GGTGGGACNONE 
J033126L01GGTGGGACNONE 
J065192J01GGTGGGACNONE 
J090009J02GGTGGGACNONE 
Os06g0179800AK065817GGTCCCACCACNONE 
AK121252GGTCCCACCACLeucine rich repeat, N-terminal domain containing protein. 
Os06g0213900AK106922GTCGCGTCCCACCConserved hypothetical protein. 
J090028K09GTCGCGTCCCACCNONE 
J100078N13GTCGCGTCCCACCNONE 
Os06g0231300AK073934GGTCCCACCTGTCATCCACCHSP20-like chaperone domain containing protein. 
Os06g0550800J065058J22GGTCCCACCTGConserved hypothetical protein. 
Os06g0551400009-003-D11ACAGGTGGGACCNONE 
011-025-C09ACAGGTGGGACCNONE 
AK066548ACAGGTGGGACCRas-related protein RIC2. 
D13758ACAGGTGGGACCNONE 
J013069H14ACAGGTGGGACCNONE 
J053037J07ACAGGTGGGACCNONE 
J065011J03ACAGGTGGGACCNONE 
J065078L15ACAGGTGGGACCNONE 
J065103H24ACAGGTGGGACCNONE 
J065157A07ACAGGTGGGACCNONE 
J065213P12ACAGGTGGGACCNONE 
J090007P04ACAGGTGGGACCNONE 
J090052N23ACAGGTGGGACCNONE 
Os06g0609900AK109324GGTGGGACCCACConserved hypothetical protein. 
Os06g0713800AK059671GTCCCACCNONE 
AK101018GTCCCACCNONE 
J023149I23GTCCCACCNONE 
X64619GTCCCACCAlpha-amylase isozyme 2A precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
Os06g0714000AK069538CGGGTCCCACCACProtein of unknown function UPF0183 family protein. 
AK069538TGGGTCCCACCACProtein of unknown function UPF0183 family protein. 
J023020A02CGGGTCCCACCACNONE 
J023020A02TGGGTCCCACCACNONE 
J023039H03CGGGTCCCACCACNONE 
J023039H03TGGGTCCCACCACNONE 
J100042E23CGGGTCCCACCACNONE 
J100042E23TGGGTCCCACCACNONE 
J100069N01CGGGTCCCACCACNONE 
J100069N01TGGGTCCCACCACNONE 
J100089L13CGGGTCCCACCACNONE 
J100089L13TGGGTCCCACCACNONE 
Os06g0731700J065089G16GTGGTGGGACNONE 
J065157E16GTGGTGGGACNONE 
Os07g0100200006-022-D06GTCCCACCNONE 
011-025-B06GTCCCACCNONE 
012-069-A07GTCCCACCNONE 
AK060986GTCCCACCNONE 
AK073305GTCCCACCSimilar to PDX1-like protein 4. 
J023055C05GTCCCACCNONE 
J033024J11GTCCCACCNONE 
J065045F14GTCCCACCNONE 
J075097C22GTCCCACCNONE 
Os07g0102100AK066544CAGGTGGGACNONE 
AK099800CAGGTGGGACSimilar to Potassium transporter 1 (OsHAK1). Splice isoform 2. 
Os07g0136300AK064609CGGGTGGGACCConserved hypothetical protein. 
Os07g0185000015-028-H12GACAGGTGGGACNONE 
AK072273GACAGGTGGGACNONE 
AK100930GACAGGTGGGACSimilar to MAP kinase (Ser/Thr kinase). 
J100026K08GACAGGTGGGACNONE 
J100062M04GACAGGTGGGACNONE 
J100073N07GACAGGTGGGACNONE 
J100088M04GACAGGTGGGACNONE 
Os07g0223100006-044-G07CCCACGCGTCCCACCNONE 
006-071-E10CCCACGCGTCCCACCNONE 
006-077-A04CCCACGCGTCCCACCNONE 
009-162-H05CCCACGCGTCCCACCNONE 
J023050M10CCCACGCGTCCCACCNONE 
J023055F05CCCACGCGTCCCACCNONE 
J023060I11CCCACGCGTCCCACCNONE 
J023101M01CCCACGCGTCCCACCNONE 
J065059J21CCCACGCGTCCCACCNONE 
J065087I18CCCACGCGTCCCACCNONE 
J065113L17CCCACGCGTCCCACCNONE 
J065123E19CCCACGCGTCCCACCNONE 
J065137O04CCCACGCGTCCCACCNONE 
J065217M03CCCACGCGTCCCACCNONE 
J090012O14CCCACGCGTCCCACCNONE 
J090014C13CCCACGCGTCCCACCNONE 
J090060C24CCCACGCGTCCCACCNONE 
J100037H14CCCACGCGTCCCACCNONE 
J100060E10CCCACGCGTCCCACCNONE 
J100067L04CCCACGCGTCCCACCNONE 
J100075G09CCCACGCGTCCCACCNONE 
J100077C15CCCACGCGTCCCACCNONE 
Os07g0479300AK120117GGTCCCACCGCCCACCCPeptidase S10, serine carboxypeptidase family protein. 
D17587GGTCCCACCGCCCACCCNONE 
Os07g0513200015-004-B02CGGGTGGGACNONE 
AK101410CGGGTGGGACNONE 
AK106227CGGGTGGGACNONE 
AK119451CGGGTGGGACProtein prenyltransferase domain containing protein. 
Os07g0525400AK121393GTCCCACCRabGAP/TBC domain containing protein. 
J023064H22GTCCCACCNONE 
J023092K07GTCCCACCNONE 
J023129N03GTCCCACCNONE 
J023142K04GTCCCACCNONE 
Os07g0588600AK108320GTGGGTCCCACCZinc finger, C2H2-type domain containing protein. 
Os07g0592200AK099740GACAGGTGGGACCCACGCGPeptidase A1, pepsin family protein. 
AK110717GACAGGTGGGACCCACGCGNONE 
Os07g0597625J065130O18GGTGGGACCCACGTGGCD-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein. 
J065166J07GGTGGGACCCACGTGGCNONE 
Os07g0618400AK111671GTCCCACCNONE 
AK111826GTCCCACCSimilar to Leucine-rich repeat transmembrane protein kinase 1 (Fragment). 
J065217K18GTCCCACCNONE 
Os07g0622900006-108-G01GGTGGGACCNONE 
AK059960GGTGGGACCConserved hypothetical protein. 
J065176B03GGTGGGACCNONE 
J080005P16GGTGGGACCNONE 
J080009F09GGTGGGACCNONE 
J080013F07GGTGGGACCNONE 
J080016L01GGTGGGACCNONE 
J080021K23GGTGGGACCNONE 
J080023D15GGTGGGACCNONE 
J080025D04GGTGGGACCNONE 
J080039C01GGTGGGACCNONE 
J080039G22GGTGGGACCNONE 
J080043K06GGTGGGACCNONE 
J080049H15GGTGGGACCNONE 
J080051K09GGTGGGACCNONE 
J080053I18GGTGGGACCNONE 
J080067C12GGTGGGACCNONE 
J080067G19GGTGGGACCNONE 
J080068L22GGTGGGACCNONE 
J080068M23GGTGGGACCNONE 
J080077I06GGTGGGACCNONE 
J080077J19GGTGGGACCNONE 
J080080A18GGTGGGACCNONE 
J080092J08GGTGGGACCNONE 
Os07g0631900AK061072GTCCCACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os07g0633400AK071894CGGGTGGGTCCCACCACIQ calmodulin-binding region domain containing protein. 
Os07g0633800AK103878GTGGTGGGACConserved hypothetical protein. 
J033025K08GTGGTGGGACNONE 
J033026N04GTGGTGGGACNONE 
J090062M09GTGGTGGGACNONE 
J090087F04GTGGTGGGACNONE 
Os08g0119800AJ437536CAGGTGGGACCCACNONE 
AK060602CAGGTGGGACCCACSimilar to Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine metabolising enzyme) (L-AME) [Contains: Photosystem II protein psbY-1 (psbY-A1); Photosystem II protein psbY-2 (psbY-A2)]. 
AK067636CAGGTGGGACCCACNONE 
AK068273CAGGTGGGACCCACNONE 
J100075K05CAGGTGGGACCCACNONE 
Os08g0128200AK120428GTGGGTCCCACCACConserved hypothetical protein. 
Os08g0316900013-024-A06GTGGGTCCCACCNONE 
J033112J20GTGGGTCCCACCNONE 
J065025M22GTGGGTCCCACCNONE 
J065026E15GTGGGTCCCACCNONE 
Os08g0326600AK065219TGGGTCCCACCTGTCAGSimilar to GMP synthetase. 
Os08g0366100AK061882GGTCCCACCNONE 
AK120339GGTCCCACCSimilar to Endothelial differentiation-related factor 1 (EDF-1) (Multiprotein bridging factor 1) (MBF1). 
J013060M10GGTCCCACCNONE 
J023135H23GGTCCCACCNONE 
J033095L23GGTCCCACCNONE 
J065010L09GGTCCCACCNONE 
J065016A02GGTCCCACCNONE 
J065041H14GGTCCCACCNONE 
J065043F09GGTCCCACCNONE 
J065045E03GGTCCCACCNONE 
J065058F23GGTCCCACCNONE 
J065075L19GGTCCCACCNONE 
J065078N12GGTCCCACCNONE 
J065105J19GGTCCCACCNONE 
J065162I03GGTCCCACCNONE 
J065164D10GGTCCCACCNONE 
J065170B05GGTCCCACCNONE 
J075039K19GGTCCCACCNONE 
J075039M06GGTCCCACCNONE 
J075057L17GGTCCCACCNONE 
J075059F17GGTCCCACCNONE 
J075109J04GGTCCCACCNONE 
J075120B14GGTCCCACCNONE 
J075153I11GGTCCCACCNONE 
J075156C19GGTCCCACCNONE 
J075166J20GGTCCCACCNONE 
J090052H04GGTCCCACCNONE 
J100051E13GGTCCCACCNONE 
J100057L03GGTCCCACCNONE 
J100059G23GGTCCCACCNONE 
Os08g0484200J075096L14GTCCCACCZinc finger, RING-type domain containing protein. 
Os08g0490100009-038-D02CTGACAGGTGGGACCCGNONE 
J065152E11CTGACAGGTGGGACCCGSimilar to PBF protein. 
J090050K03CTGACAGGTGGGACCCGNONE 
J090053L01CTGACAGGTGGGACCCGNONE 
Os08g0511400AK069673CAGGTGGGTCCCACCConserved hypothetical protein. 
J065161H07CAGGTGGGTCCCACCNONE 
Os08g0517300AK069175GTGGGTCCCACCZinc finger, C2H2-type domain containing protein. 
Os08g0524800AK072041GGTCCCACCNONE 
AK099291GGTCCCACCSimilar to TA1 protein (Fragment). 
J065053E08GGTCCCACCNONE 
J065163F15GGTCCCACCNONE 
Os09g0281800AK105291GTCCCACCConserved hypothetical protein. 
Os09g0296800AK066997CGCCACGTGTCCGTCCCACCChlorophyll A-B binding protein family protein. 
Os09g0397200J065178K08GGTCCCACCTGTCConserved hypothetical protein. 
J065178L07GGTCCCACCTGTCNONE 
Os09g0409000AK107676GGTCCCACCTGTCConserved hypothetical protein. 
Os09g0424850J065006K24GTGGGTCCCACCConserved hypothetical protein. 
Os09g0446200011-092-H04GGTCCCACCSpc97/Spc98 family protein. 
Os09g0446800AK061999GTCCCACCAACNONE 
J013049P03GTCCCACCAACNONE 
J013055J11GTCCCACCAACNONE 
J013070P19GTCCCACCAACNONE 
J013072C09GTCCCACCAACNONE 
J013108I17GTCCCACCAACNONE 
J013118L14GTCCCACCAACNONE 
J013123A14GTCCCACCAACNONE 
J013124L24GTCCCACCAACNONE 
J013128P10GTCCCACCAACNONE 
J013134H01GTCCCACCAACNONE 
J013152O16GTCCCACCAACNONE 
J013153N08GTCCCACCAACNONE 
J013157H14GTCCCACCAACNONE 
J013158P14GTCCCACCAACNONE 
J023066A03GTCCCACCAACNONE 
J023086N13GTCCCACCAACNONE 
J023103G22GTCCCACCAACNONE 
J023114B07GTCCCACCAACNONE 
J033071D05GTCCCACCAACNONE 
J033098F14GTCCCACCAACNONE 
J033099H02GTCCCACCAACNONE 
J043017M24GTCCCACCAACNONE 
J090011H01GTCCCACCAACNONE 
J090017C01GTCCCACCAACNONE 
J090029F09GTCCCACCAACNONE 
J090041K03GTCCCACCAACNONE 
Os09g0491788AK073442GGTGGGACCNAD-dependent epimerase/dehydratase family protein. 
J033135E10GGTGGGACCNONE 
Os09g0492700AK101104GTGGTGGGACCSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34) (Fragment). 
U95816GTGGTGGGACCNONE 
Os09g0547500009-006-F11GTGGGTCCCACCNONE 
Os09g0572000J065136G16GTGGGTCCCACCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os11g0109500015-062-C02GGTGGGACCCACNONE 
AK064326GGTGGGACCCACStaphylococcus nuclease (SNase-like) domain containing protein. 
Os11g0181700006-062-E12GTCCCACCNONE 
006-072-B05GTCCCACCNONE 
006-118-G08GTCCCACCNONE 
009-068-A10GTCCCACCNONE 
AK062546GTCCCACCSimilar to Short-chain dehydrogenase Tic32. 
AK065928GTCCCACCNONE 
Os11g0240600015-031-E04GGTCCCACCCGNONE 
016-077-E10GGTCCCACCCGNONE 
AK061589GGTCCCACCCGEsterase/lipase/thioesterase domain containing protein. 
AK120858GGTCCCACCCGNONE 
J075181M24GGTCCCACCCGNONE 
Os11g0442900AK110914GTCCCACCZinc finger, C2H2-type domain containing protein. 
Os11g0527000J065137N17GTGGGTCCCACCTGTCConserved hypothetical protein. 
Os11g0568300016-075-B02GGTGGGACCCACNONE 
AK064398GGTGGGACCCACHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK103282GGTGGGACCCACNONE 
J033124M10GGTGGGACCCACNONE 
J065120I21GGTGGGACCCACNONE 
J065144H16GGTGGGACCCACNONE 
Os11g0672900014-017-A02GGTCCCACCTGTCAGNONE 
AK105350GGTCCCACCTGTCAGProtein of unknown function DUF1645 family protein. 
Os12g0109200AK103380GGTGGGACCCACSimilar to Ca(2+)-dependent nuclease. 
J033127E15GGTGGGACCCACNONE 
J090085H16GGTGGGACCCACNONE 
Os12g0151500AK058389GTGGGTCCCACCACSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865GTGGGTCCCACCACNONE 
Os12g0168000AK065623GGTCCCACCTGTCAGTG5-formyltetrahydrofolate cyclo-ligase family protein. 
AK072953GGTCCCACCTGTCAGTGNONE 
J100024I20GGTCCCACCTGTCAGTGNONE 
Os12g0238100AK064983GGTGGGACCExocyst complex component Sec10 family protein. 
Os12g0270300AK070311GGTCCCACCAACGGCDisease resistance protein family protein. 
AK103036GGTCCCACCAACGGCNONE 
Os12g0460800J023003J21CCCGTGGGTCCCACCNONE 
Os12g0618300AK060811GTCCCACCNONE 
J013109C17GTCCCACCNONE 
J013170J06GTCCCACCNONE 
J023138D11GTCCCACCNONE 
J033024P07GTCCCACCNONE 
J033040I12GTCCCACCNONE 
J075161G03GTCCCACCNONE 
J100025A17GTCCCACCNONE 
J100090G08GTCCCACCNONE 
Os12g0620400015-008-B10GGTGGGACCNONE 
AK059006GGTGGGACCNONE 
AK059973GGTGGGACCNONE 
AK063843GGTGGGACCMethyl-CpG binding domain containing protein. 
AK072503GGTGGGACCNONE 
AK072934GGTGGGACCNONE 
J023126H05GGTGGGACCNONE 
J023131G11GGTGGGACCNONE 
J023146E17GGTGGGACCNONE 
J033064P08GGTGGGACCNONE 
J033095L07GGTGGGACCNONE 
J065101N06GGTGGGACCNONE 
J065186F11GGTGGGACCNONE 
J065215J15GGTGGGACCNONE 
J080049H05GGTGGGACCNONE 
J080059L05GGTGGGACCNONE 
J080061M17GGTGGGACCNONE 
J080063D16GGTGGGACCNONE 
J090012D01GGTGGGACCNONE 
J090023D20GGTGGGACCNONE 
J090040A09GGTGGGACCNONE 
J090044K08GGTGGGACCNONE 
J100019H03GGTGGGACCNONE 
J100054N04GGTGGGACCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.