version

Summary of OsREG652 (All List)

OrganismOryza sativa  
IDOsREG652  
SequenceGTCCCTCA  
Annotation  
PPDB MotifGGGACCC  function unknown  
PLACE Motif 
Total Entry Count1587  

Entry Sequences (1587 entries)

LocusGene modelSequenceDescription
Os01g0104800AK067602TGAGGGACSas10/Utp3 family protein. 
J013109E04TGAGGGACNONE 
J033057M05TGAGGGACNONE 
J043021M24TGAGGGACNONE 
J090014N05TGAGGGACNONE 
J090077H23TGAGGGACNONE 
J090084H08TGAGGGACNONE 
Os01g0131600006-030-A03TGAGGGACNONE 
006-049-C10TGAGGGACNONE 
006-054-E02TGAGGGACNONE 
011-035-H02TGAGGGACNONE 
011-036-E04TGAGGGACNONE 
012-047-C08TGAGGGACNONE 
012-079-F08TGAGGGACNONE 
012-097-C02TGAGGGACNONE 
012-100-A07TGAGGGACNONE 
013-015-H05TGAGGGACNONE 
013-047-A03TGAGGGACNONE 
013-051-B05TGAGGGACNONE 
013-061-G02TGAGGGACNONE 
013-077-H02TGAGGGACNONE 
015-005-D04TGAGGGACNONE 
015-064-B06TGAGGGACNONE 
015-072-D02TGAGGGACNONE 
016-073-E09TGAGGGACNONE 
016-088-H03TGAGGGACNONE 
AK062063TGAGGGACNONE 
AK101133TGAGGGACSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277TGAGGGACNONE 
AK119645TGAGGGACNONE 
AY341828TGAGGGACNONE 
J013036O08TGAGGGACNONE 
J013037M17TGAGGGACNONE 
J013039B11TGAGGGACNONE 
J013039L20TGAGGGACNONE 
J013047B20TGAGGGACNONE 
J013048E23TGAGGGACNONE 
J013051E12TGAGGGACNONE 
J013051F12TGAGGGACNONE 
J013056B05TGAGGGACNONE 
J013057N24TGAGGGACNONE 
J013064D21TGAGGGACNONE 
J013065G24TGAGGGACNONE 
J013075L13TGAGGGACNONE 
J013075L24TGAGGGACNONE 
J013092F04TGAGGGACNONE 
J013092F10TGAGGGACNONE 
J013092M16TGAGGGACNONE 
J013096K06TGAGGGACNONE 
J013111F10TGAGGGACNONE 
J013120B17TGAGGGACNONE 
J013120P07TGAGGGACNONE 
J013122F18TGAGGGACNONE 
J013122H23TGAGGGACNONE 
J013126I15TGAGGGACNONE 
J013126L17TGAGGGACNONE 
J013129C15TGAGGGACNONE 
J013146A04TGAGGGACNONE 
J013146A06TGAGGGACNONE 
J013153F01TGAGGGACNONE 
J013156O06TGAGGGACNONE 
J013162D05TGAGGGACNONE 
J023008N04TGAGGGACNONE 
J023010D06TGAGGGACNONE 
J023011I23TGAGGGACNONE 
J023023I15TGAGGGACNONE 
J023025C08TGAGGGACNONE 
J023029H02TGAGGGACNONE 
J023033C18TGAGGGACNONE 
J023037D21TGAGGGACNONE 
J023049F17TGAGGGACNONE 
J023052B15TGAGGGACNONE 
J023061D03TGAGGGACNONE 
J023062M01TGAGGGACNONE 
J023089D24TGAGGGACNONE 
J023109J20TGAGGGACNONE 
J023109M21TGAGGGACNONE 
J023120N04TGAGGGACNONE 
J023122A04TGAGGGACNONE 
J023134F23TGAGGGACNONE 
J023149E20TGAGGGACNONE 
J033022A12TGAGGGACNONE 
J033022C04TGAGGGACNONE 
J033024K06TGAGGGACNONE 
J033026F23TGAGGGACNONE 
J033029J19TGAGGGACNONE 
J033040H20TGAGGGACNONE 
J033042P21TGAGGGACNONE 
J033043F14TGAGGGACNONE 
J033044G11TGAGGGACNONE 
J033052L10TGAGGGACNONE 
J033052O03TGAGGGACNONE 
J033052P03TGAGGGACNONE 
J033079B20TGAGGGACNONE 
J033089D21TGAGGGACNONE 
J033094P04TGAGGGACNONE 
J033103N02TGAGGGACNONE 
J033110J19TGAGGGACNONE 
J033114E17TGAGGGACNONE 
J033115K04TGAGGGACNONE 
J033119I06TGAGGGACNONE 
J033121L10TGAGGGACNONE 
J033123H14TGAGGGACNONE 
J033136H10TGAGGGACNONE 
J033139L07TGAGGGACNONE 
J033143G23TGAGGGACNONE 
J043021F16TGAGGGACNONE 
J080304G01TGAGGGACNONE 
J080305H24TGAGGGACNONE 
J080309B11TGAGGGACNONE 
J080315N09TGAGGGACNONE 
J080319J20TGAGGGACNONE 
J090014D01TGAGGGACNONE 
J090067F08TGAGGGACNONE 
J090079P18TGAGGGACNONE 
J090082K13TGAGGGACNONE 
J090093K17TGAGGGACNONE 
J090099G18TGAGGGACNONE 
J100022K14TGAGGGACNONE 
J100052G17TGAGGGACNONE 
Os01g0132700J065063N10TGAGGGACSurfeit locus 5 family protein. 
J065164N24TGAGGGACNONE 
J065167H04TGAGGGACNONE 
J065187N12TGAGGGACNONE 
Os01g0176500AK102552CCCACGTGTCCCTCAConserved hypothetical protein. 
Os01g0239100Os01g0239100TGAGGGACHeat shock protein DnaJ family protein. 
Os01g0239100TGAGGGACCCAHeat shock protein DnaJ family protein. 
Os01g0314300AK073419TGAGGGACUncharacterized domain 2 containing protein. 
AK104939TGAGGGACNONE 
J033044B03TGAGGGACNONE 
J033060E12TGAGGGACNONE 
J043037E21TGAGGGACNONE 
J065019O18TGAGGGACNONE 
J065025P22TGAGGGACNONE 
J065042P06TGAGGGACNONE 
J065074C19TGAGGGACNONE 
J065074E13TGAGGGACNONE 
J065094E05TGAGGGACNONE 
J065108N08TGAGGGACNONE 
J065134L13TGAGGGACNONE 
J065152N24TGAGGGACNONE 
J065162N24TGAGGGACNONE 
J065170P16TGAGGGACNONE 
J065177M20TGAGGGACNONE 
J065187N01TGAGGGACNONE 
J075012N12TGAGGGACNONE 
J075046C17TGAGGGACNONE 
J075055N06TGAGGGACNONE 
J075141H03TGAGGGACNONE 
J075150M11TGAGGGACNONE 
J090005B16TGAGGGACNONE 
J090079L11TGAGGGACNONE 
J100039F16TGAGGGACNONE 
Os01g0324400AK102854TGAGGGACNONE 
AK111299TGAGGGACNONE 
J033032A11TGAGGGACNONE 
J033110L02TGAGGGACNONE 
Os01g0500600AK067312GTCCCTCAHypothetical protein. 
J013045G13GTCCCTCANONE 
J013104N03GTCCCTCANONE 
J033050D02GTCCCTCANONE 
Os01g0558900AK058447TGAGGGACHypothetical protein. 
Os01g0604100AK099765GTCCCTCAUspA domain containing protein. 
J013094O21GTCCCTCANONE 
Os01g0605700AK099440TGAGGGACMtN3 and saliva related transmembrane protein family protein. 
J080001K02TGAGGGACNONE 
J080001P13TGAGGGACNONE 
J080006I22TGAGGGACNONE 
J080008F09TGAGGGACNONE 
J080014M23TGAGGGACNONE 
J080024L07TGAGGGACNONE 
J080035D17TGAGGGACNONE 
J080048D13TGAGGGACNONE 
J080056K03TGAGGGACNONE 
J080058M12TGAGGGACNONE 
J080062B20TGAGGGACNONE 
J080066B09TGAGGGACNONE 
J080069L03TGAGGGACNONE 
J080072P17TGAGGGACNONE 
J080094C01TGAGGGACNONE 
Os01g0653700011-003-E09TGAGGGACNONE 
AK073990TGAGGGACCyclin-like F-box domain containing protein. 
AK120129TGAGGGACNONE 
J033036F18TGAGGGACNONE 
J033072D10TGAGGGACNONE 
J033089B18TGAGGGACNONE 
J033089J09TGAGGGACNONE 
J033136J11TGAGGGACNONE 
J065065E24TGAGGGACNONE 
J090065L03TGAGGGACNONE 
Os01g0694800015-093-H11GTCCCTCANONE 
015-093-H11GTCCCTCANONE 
AK109275GTCCCTCAConserved hypothetical protein. 
AK109275GTCCCTCAConserved hypothetical protein. 
Os01g0706000006-098-D12TGAGGGACNONE 
AK059936TGAGGGACSimilar to RNA polymerase II transcriptional coactivator KELP. 
AK070545TGAGGGACNONE 
AK104192TGAGGGACNONE 
J023055M24TGAGGGACNONE 
J033102J04TGAGGGACNONE 
J065050P18TGAGGGACNONE 
J065076D07TGAGGGACNONE 
J065078O14TGAGGGACNONE 
J065104L13TGAGGGACNONE 
J065115J23TGAGGGACNONE 
J065143P08TGAGGGACNONE 
J065178N17TGAGGGACNONE 
J065179H14TGAGGGACNONE 
J065187J06TGAGGGACNONE 
J075047B18TGAGGGACNONE 
Os01g0706100AK072799TGAGGGACConserved hypothetical protein. 
J013049G14TGAGGGACNONE 
J023136E17TGAGGGACNONE 
Os01g0734000AK108909TGAGGGACSimilar to WRKY DNA binding protein. 
AY341845TGAGGGACNONE 
AY870607TGAGGGACNONE 
Os01g0754000014-081-F07TGAGGGACNONE 
AK063730TGAGGGACConserved hypothetical protein. 
J065219A11TGAGGGACNONE 
J075136N13TGAGGGACNONE 
J100051G01TGAGGGACNONE 
J100053M22TGAGGGACNONE 
Os01g0764900AK066328TGAGGGACNONE 
Os01g0780500AF225922TGAGGGACNONE 
AK068498TGAGGGACSCAMP family protein. 
J013157H06TGAGGGACNONE 
J033088P18TGAGGGACNONE 
Os01g0811100006-061-F11TGAGGGACNONE 
AB026562TGAGGGACNONE 
AK061784TGAGGGACNONE 
AK103541TGAGGGACProteasome subunit alpha type 3 (EC 3.4.25.1) (20S proteasome alpha subunit G) (20S proteasome subunit alpha-7). 
J013020B12TGAGGGACNONE 
J013022J21TGAGGGACNONE 
J013056G19TGAGGGACNONE 
J013060O07TGAGGGACNONE 
J013110I07TGAGGGACNONE 
J013160D19TGAGGGACNONE 
J090035A13TGAGGGACNONE 
Os01g0948100AK111411TGAGGGACERCC4 domain containing protein. 
J090089O16TGAGGGACNONE 
Os01g0973400AK060011TGAGGGACNONE 
AK068879TGAGGGACConserved hypothetical protein 48 family protein. 
AK099210TGAGGGACNONE 
AK104863TGAGGGACNONE 
J013170C09TGAGGGACNONE 
J033106K13TGAGGGACNONE 
J075018P18TGAGGGACNONE 
J075039C18TGAGGGACNONE 
J075104L18TGAGGGACNONE 
Os02g0103800006-046-H11TGAGGGACNONE 
006-060-B05TGAGGGACNONE 
006-097-A09TGAGGGACNONE 
006-102-A10TGAGGGACNONE 
006-104-E11TGAGGGACNONE 
006-112-D09TGAGGGACNONE 
AK061774TGAGGGACNONE 
AK065309TGAGGGACNONE 
AK106213TGAGGGACSimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment). 
J013002O13TGAGGGACNONE 
J013026F06TGAGGGACNONE 
J013037O14TGAGGGACNONE 
J013066N06TGAGGGACNONE 
J013108G22TGAGGGACNONE 
J023050M15TGAGGGACNONE 
J023054B21TGAGGGACNONE 
J023073C23TGAGGGACNONE 
J023086H17TGAGGGACNONE 
J023105A20TGAGGGACNONE 
J065019E16TGAGGGACNONE 
J065064G10TGAGGGACNONE 
J065071C18TGAGGGACNONE 
J065103B02TGAGGGACNONE 
J065153G06TGAGGGACNONE 
J075152G24TGAGGGACNONE 
J075166P04TGAGGGACNONE 
J080001F02TGAGGGACNONE 
J080001M07TGAGGGACNONE 
J080001O05TGAGGGACNONE 
J080003I19TGAGGGACNONE 
J080004C12TGAGGGACNONE 
J080008E17TGAGGGACNONE 
J080008M08TGAGGGACNONE 
J080010H21TGAGGGACNONE 
J080011F22TGAGGGACNONE 
J080012C16TGAGGGACNONE 
J080013D20TGAGGGACNONE 
J080018K15TGAGGGACNONE 
J080020O14TGAGGGACNONE 
J080020P21TGAGGGACNONE 
J080021A07TGAGGGACNONE 
J080021B06TGAGGGACNONE 
J080022G21TGAGGGACNONE 
J080022P14TGAGGGACNONE 
J080023H24TGAGGGACNONE 
J080023M08TGAGGGACNONE 
J080027E08TGAGGGACNONE 
J080027E18TGAGGGACNONE 
J080027O16TGAGGGACNONE 
J080029M22TGAGGGACNONE 
J080034A17TGAGGGACNONE 
J080038G04TGAGGGACNONE 
J080040F13TGAGGGACNONE 
J080040F22TGAGGGACNONE 
J080041L15TGAGGGACNONE 
J080042L04TGAGGGACNONE 
J080042M14TGAGGGACNONE 
J080043C22TGAGGGACNONE 
J080043O09TGAGGGACNONE 
J080045N17TGAGGGACNONE 
J080046N08TGAGGGACNONE 
J080047K11TGAGGGACNONE 
J080047O06TGAGGGACNONE 
J080048H10TGAGGGACNONE 
J080048N03TGAGGGACNONE 
J080050N02TGAGGGACNONE 
J080051A05TGAGGGACNONE 
J080052I20TGAGGGACNONE 
J080053E08TGAGGGACNONE 
J080055P05TGAGGGACNONE 
J080056F15TGAGGGACNONE 
J080056H07TGAGGGACNONE 
J080057M20TGAGGGACNONE 
J080059K09TGAGGGACNONE 
J080059M10TGAGGGACNONE 
J080060B12TGAGGGACNONE 
J080061N09TGAGGGACNONE 
J080062H11TGAGGGACNONE 
J080062M13TGAGGGACNONE 
J080063D14TGAGGGACNONE 
J080063G10TGAGGGACNONE 
J080063H18TGAGGGACNONE 
J080066J23TGAGGGACNONE 
J080067J06TGAGGGACNONE 
J080069I11TGAGGGACNONE 
J080069O22TGAGGGACNONE 
J080070P11TGAGGGACNONE 
J080072D06TGAGGGACNONE 
J080072J22TGAGGGACNONE 
J080075A20TGAGGGACNONE 
J080076F11TGAGGGACNONE 
J080076J24TGAGGGACNONE 
J080076K05TGAGGGACNONE 
J080077O10TGAGGGACNONE 
J080078L19TGAGGGACNONE 
J080080I08TGAGGGACNONE 
J080081J23TGAGGGACNONE 
J080083A17TGAGGGACNONE 
J080085C05TGAGGGACNONE 
J080086G24TGAGGGACNONE 
J080087H02TGAGGGACNONE 
J080089A13TGAGGGACNONE 
J080090K08TGAGGGACNONE 
J080092M01TGAGGGACNONE 
J080095A19TGAGGGACNONE 
J080095B20TGAGGGACNONE 
J100028F13TGAGGGACNONE 
J100040G22TGAGGGACNONE 
Os02g0142060J065137N15GAGACGTGAGGGACGGACSynapsin family protein. 
Os02g0175800009-083-C02TGAGGGACNONE 
009-184-H07TGAGGGACNONE 
009-199-D07TGAGGGACNONE 
AK058292TGAGGGACNONE 
AK120215TGAGGGACConserved hypothetical protein. 
J013040G12TGAGGGACNONE 
J065050N21TGAGGGACNONE 
J065077O07TGAGGGACNONE 
J065102G05TGAGGGACNONE 
J065197A04TGAGGGACNONE 
J075024L24TGAGGGACNONE 
J075038K01TGAGGGACNONE 
J075044L04TGAGGGACNONE 
J075063D23TGAGGGACNONE 
J075079P13TGAGGGACNONE 
J075084G03TGAGGGACNONE 
J075135G07TGAGGGACNONE 
J075148D17TGAGGGACNONE 
J075150F13TGAGGGACNONE 
J075157F06TGAGGGACNONE 
J090054A05TGAGGGACNONE 
J090085O04TGAGGGACNONE 
J100023C04TGAGGGACNONE 
J100023H23TGAGGGACNONE 
J100026A16TGAGGGACNONE 
J100035K13TGAGGGACNONE 
Os02g0194000015-020-A08TGAGGGACNONE 
AK064096TGAGGGACMyb, DNA-binding domain containing protein. 
J090092L06TGAGGGACNONE 
Os02g0215950J090051K07TGAGGGACConserved hypothetical protein. 
Os02g0234700009-036-B03GTCCCTCANONE 
AK062439GTCCCTCAConserved hypothetical protein. 
Os02g0313450009-097-E10GTCCCTCAConserved hypothetical protein. 
J065156J02GTCCCTCANONE 
Os02g0467700AK121672TGAGGGACGlycosyltransferase 28, C-terminal domain containing protein. 
J033068B18TGAGGGACNONE 
J080035D09TGAGGGACNONE 
J080039E21TGAGGGACNONE 
J080054N01TGAGGGACNONE 
J080071C12TGAGGGACNONE 
Os02g0565000AK120665TGAGGGACHomeodomain-like containing protein. 
J100070C12TGAGGGACNONE 
J100074L08TGAGGGACNONE 
Os02g0677700AK119947TGAGGGACNONE 
Os02g0679200AK110789TGAGGGACTetratricopeptide-like helical domain containing protein. 
Os02g0698100009-089-H10TGAGGGACNONE 
AK060614TGAGGGACGalactose oxidase, central domain containing protein. 
J090039P20TGAGGGACNONE 
Os02g0714700AK067734TGAGGGACConserved hypothetical protein. 
Os02g0751600006-048-C01TGAGGGACNONE 
006-059-E07TGAGGGACNONE 
AK060441TGAGGGACNONE 
AK061027TGAGGGACNONE 
AK072946TGAGGGACPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK104401TGAGGGACNONE 
J023150D22TGAGGGACNONE 
J075005E17TGAGGGACNONE 
J075019F10TGAGGGACNONE 
J075047K24TGAGGGACNONE 
J075052B13TGAGGGACNONE 
J075063M19TGAGGGACNONE 
J075136P10TGAGGGACNONE 
J075139E24TGAGGGACNONE 
J075152K11TGAGGGACNONE 
J075161A10TGAGGGACNONE 
J075187F20TGAGGGACNONE 
Os02g0753900J080009I06TGAGGGACNONE 
J080034B10TGAGGGACNONE 
J080045G05TGAGGGACNONE 
J080074J05TGAGGGACNONE 
J080082L14TGAGGGACNONE 
J080083B04TGAGGGACNONE 
J080089A14TGAGGGACNONE 
Os02g0755200AK070699TGAGGGACSimilar to FLOWERING LOCUS D (Fragment). 
J023056I20TGAGGGACNONE 
J065048B13TGAGGGACNONE 
J065128H21TGAGGGACNONE 
J065201E09TGAGGGACNONE 
Os02g0777950J090078H24GTCCCTCAConserved hypothetical protein. 
J090078H24TGAGGGACConserved hypothetical protein. 
J090078H24TGAGGGACConserved hypothetical protein. 
Os02g0782100AK065421TGAGGGACChorismate synthase family protein. 
J065038A03TGAGGGACNONE 
Os02g0796300006-087-C02TGAGGGACNONE 
AK061820TGAGGGACNONE 
AK073025TGAGGGACNONE 
AK119386TGAGGGACSimilar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1) (BTG1 binding factor 1). 
J013033A22TGAGGGACNONE 
J013096K18TGAGGGACNONE 
J023072E02TGAGGGACNONE 
J023113M08TGAGGGACNONE 
J023149N08TGAGGGACNONE 
Os02g0798700AK101070TGAGGGACNeurochondrin family protein. 
AK103079TGAGGGACNONE 
J090045L09TGAGGGACNONE 
Os02g0824900AK073217TGAGGGACNONE 
AK103528TGAGGGACConserved hypothetical protein. 
J090069J01TGAGGGACNONE 
J090081B04TGAGGGACNONE 
Os03g0143000AK073102TGAGGGACCCGSAM (and some other nucleotide) binding motif domain containing protein. 
J033051I24TGAGGGACCCGNONE 
Os03g0143600AB110188TGAGGGACNONE 
AK068424TGAGGGACSimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464TGAGGGACNONE 
AY224545TGAGGGACNONE 
J013154F02TGAGGGACNONE 
Os03g0175600AK059981TGAGGGACSimilar to Nit protein 2 (CUA002). 
Os03g0177000AK071368GTCCCTCAGCN5-related N-acetyltransferase domain containing protein. 
Os03g0197400AK071413TGAGGGACSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905TGAGGGACNONE 
J053023D18TGAGGGACNONE 
Os03g0220700J100064H16TGAGGGACNONE 
Os03g0245800013-094-D06TGAGGGACNONE 
AB020973TGAGGGACNONE 
AK063618TGAGGGACNONE 
AK120045TGAGGGACNONE 
AK120048TGAGGGACSimilar to Heat shock protein 26. 
J075104O17TGAGGGACNONE 
Os03g0251800AK067333TGAGGGACSimilar to Possible OmpA family member precursor. 
AK073337TGAGGGACNONE 
Os03g0271100AB095095TGAGGGACNONE 
AB095095TGAGGGACNONE 
AB095095TGAGGGACNONE 
AK060821TGAGGGACSimilar to Sigma factor SIG2B. 
AK060821TGAGGGACSimilar to Sigma factor SIG2B. 
AK060821TGAGGGACSimilar to Sigma factor SIG2B. 
AK067693TGAGGGACNONE 
AK067693TGAGGGACNONE 
AK067693TGAGGGACNONE 
AK099036TGAGGGACNONE 
AK099036TGAGGGACNONE 
AK099036TGAGGGACNONE 
Os03g0285900AK073348TGAGGGACSimilar to Splicing factor RSZ33. 
J033025D08TGAGGGACNONE 
J033087M12TGAGGGACNONE 
J065008F11TGAGGGACNONE 
J065059C09TGAGGGACNONE 
J065070J11TGAGGGACNONE 
J065076L20TGAGGGACNONE 
J065083M19TGAGGGACNONE 
J065111I06TGAGGGACNONE 
J065112H18TGAGGGACNONE 
J065112J18TGAGGGACNONE 
J065140C08TGAGGGACNONE 
J065180P06TGAGGGACNONE 
J065187G12TGAGGGACNONE 
J065189B14TGAGGGACNONE 
J090042N02TGAGGGACNONE 
J090087M04TGAGGGACNONE 
Os03g0297400AK060653TGAGGGACNONE 
AK061403TGAGGGACNONE 
AK101597TGAGGGACMalonyl CoA-acyl carrier protein transacylase family protein. 
Os03g0312600AK073391TGAGGGACSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0313600AK067474TGAGGGACSimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
Os03g0331600009-025-C11TGAGGGACNONE 
AK063782TGAGGGACConserved hypothetical protein. 
Os03g0338600AK066604TGAGGGACtRNA pseudouridine synthase family protein. 
Os03g0339100AK111641TGAGGGACSimilar to PRL1 protein. 
Os03g0372900AK100417TGAGGGACCCGCyclin-like F-box domain containing protein. 
Os03g0412200AK061834GTCCCTCAConserved hypothetical protein. 
J043024C24GTCCCTCANONE 
J065186M10GTCCCTCANONE 
Os03g0566600011-071-A08TGAGGGACNONE 
AK063379TGAGGGACMethyltransferase FkbM domain containing protein. 
Os03g0566800AK103270TGAGGGACSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18TGAGGGACNONE 
J023136P06TGAGGGACNONE 
J033081A22TGAGGGACNONE 
J033109N12TGAGGGACNONE 
J033124H10TGAGGGACNONE 
J033141B09TGAGGGACNONE 
J090026G23TGAGGGACNONE 
J090077J20TGAGGGACNONE 
Os03g0569800AK070080TGAGGGACProtein prenyltransferase domain containing protein. 
AK120873TGAGGGACNONE 
Os03g0581800009-177-G11TGAGGGACCCGNONE 
AK059201TGAGGGACCCGNONE 
AK121839TGAGGGACCCGHypothetical protein. 
J023022K06TGAGGGACCCGNONE 
J023110K21TGAGGGACCCGNONE 
J033100N18TGAGGGACCCGNONE 
J033120D11TGAGGGACCCGNONE 
J065044P15TGAGGGACCCGNONE 
J065102G22TGAGGGACCCGNONE 
J065149N14TGAGGGACCCGNONE 
J065201L18TGAGGGACCCGNONE 
J065205K10TGAGGGACCCGNONE 
J075035D19TGAGGGACCCGNONE 
J075073E06TGAGGGACCCGNONE 
J075134M11TGAGGGACCCGNONE 
J090004P12TGAGGGACCCGNONE 
J090070H20TGAGGGACCCGNONE 
J090087B04TGAGGGACCCGNONE 
J100028F10TGAGGGACCCGNONE 
J100036M18TGAGGGACCCGNONE 
J100065C24TGAGGGACCCGNONE 
J100080O13TGAGGGACCCGNONE 
Os03g0584300009-018-H09TGAGGGACNONE 
AK105133TGAGGGACProtein of unknown function UPF0136, Transmembrane family protein. 
J065053M11TGAGGGACNONE 
Os03g0588200011-005-E04TGAGGGACNONE 
AK120221TGAGGGACFrigida-like family protein. 
J100086E17TGAGGGACNONE 
Os03g0681900006-042-F08TGAGGGACNONE 
009-043-F12TGAGGGACNONE 
AK061750TGAGGGACNONE 
AK062094TGAGGGACSimilar to RGP-3 (Fragment). 
J033034F01TGAGGGACNONE 
J033131F11TGAGGGACNONE 
J033143N03TGAGGGACNONE 
Os03g0703000006-041-G10TGAGGGACNONE 
006-105-H09TGAGGGACNONE 
011-081-D12TGAGGGACNONE 
AK059920TGAGGGACNONE 
J033055L14TGAGGGACNONE 
J065021C12TGAGGGACNONE 
J065132L04TGAGGGACNONE 
J065184C03TGAGGGACNONE 
J090007D24TGAGGGACNONE 
J090008N18TGAGGGACNONE 
J090014H20TGAGGGACNONE 
J090023B02TGAGGGACNONE 
J090024F24TGAGGGACNONE 
J090059I23TGAGGGACNONE 
J090070I22TGAGGGACNONE 
J090081H20TGAGGGACNONE 
J090094K11TGAGGGACNONE 
Os03g0704400AK101297TGAGGGACProtein kinase domain containing protein. 
AK101297TGAGGGACProtein kinase domain containing protein. 
J033033I19TGAGGGACNONE 
J033033I19TGAGGGACNONE 
J090009M06TGAGGGACNONE 
J090009M06TGAGGGACNONE 
Os03g0721700AK106706TGAGGGACProtein of unknown function DUF569 family protein. 
Os03g0725000AK059294TGAGGGACNONE 
J043026H11TGAGGGACNONE 
J065187O06TGAGGGACNONE 
J090066M23TGAGGGACNONE 
Os03g0793100AK067897GTCCCTCAGlycosyl transferase, family 43 protein. 
J033125G24GTCCCTCANONE 
J065132N21GTCCCTCANONE 
Os03g0796600003-113-D10TGAGGGACGCGTGTCCCTCANONE 
011-076-B12TGAGGGACGCGTGTCCCTCANONE 
AK105257TGAGGGACGCGTGTCCCTCAProtein of unknown function DUF506, plant family protein. 
J075105C03TGAGGGACGCGTGTCCCTCANONE 
J080036O17TGAGGGACGCGTGTCCCTCANONE 
J080064E16TGAGGGACGCGTGTCCCTCANONE 
J080069E03TGAGGGACGCGTGTCCCTCANONE 
J080079E23TGAGGGACGCGTGTCCCTCANONE 
J090036H20TGAGGGACGCGTGTCCCTCANONE 
J100029L10TGAGGGACGCGTGTCCCTCANONE 
J100055G09TGAGGGACGCGTGTCCCTCANONE 
Os03g0801800AK067130TGAGGGACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J090079D17TGAGGGACNONE 
J090087F23TGAGGGACNONE 
Os03g0806800003-102-E03GTCCCTCANONE 
009-036-G10GTCCCTCANONE 
AK061623GTCCCTCAConserved hypothetical protein. 
AK120337GTCCCTCANONE 
J013059N15GTCCCTCANONE 
J013059P10GTCCCTCANONE 
J013059P11GTCCCTCANONE 
Os03g0845700009-075-D05TGAGGGACNONE 
AK062622TGAGGGACSimilar to RPB17 (Fragment). 
J065068H03TGAGGGACNONE 
J065075A18TGAGGGACNONE 
J065118C19TGAGGGACNONE 
J075001B15TGAGGGACNONE 
J075048D11TGAGGGACNONE 
J075056D01TGAGGGACNONE 
J075092P03TGAGGGACNONE 
J075111I04TGAGGGACNONE 
Os03g0860600AK071828TGAGGGACSimilar to 2-oxoglutarate-dependent oxygenase. 
AK071828TGAGGGACSimilar to 2-oxoglutarate-dependent oxygenase. 
J023118E08TGAGGGACNONE 
J023118E08TGAGGGACNONE 
J100032J11TGAGGGACNONE 
J100032J11TGAGGGACNONE 
Os04g0258900009-146-B02TGAGGGACNONE 
AK062983TGAGGGACCyclin-like F-box domain containing protein. 
Os04g0320200012-089-H09TGAGGGACNONE 
AK069513TGAGGGACUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK104028TGAGGGACNONE 
AK119256TGAGGGACNONE 
J023020H09TGAGGGACNONE 
J065112F21TGAGGGACNONE 
J100036M07TGAGGGACNONE 
Os04g0405500011-007-D12CGCGTCGCGTCCCTCANONE 
AK063263CGCGTCGCGTCCCTCAConserved hypothetical protein. 
J065166G19CGCGTCGCGTCCCTCANONE 
J075180M09CGCGTCGCGTCCCTCANONE 
Os04g0430100009-125-A01TGAGGGACNONE 
AK102190TGAGGGACSimilar to 40S ribosomal protein S10-1. 
J033087A06TGAGGGACNONE 
J053032M06TGAGGGACNONE 
J065033D05TGAGGGACNONE 
J065045D15TGAGGGACNONE 
J065045K10TGAGGGACNONE 
J065049N05TGAGGGACNONE 
J065064N09TGAGGGACNONE 
J065068F17TGAGGGACNONE 
J065088F17TGAGGGACNONE 
J065104N22TGAGGGACNONE 
J065117B19TGAGGGACNONE 
J065119O12TGAGGGACNONE 
J065134G24TGAGGGACNONE 
J065150G16TGAGGGACNONE 
J065176C03TGAGGGACNONE 
J065212M23TGAGGGACNONE 
J075009P18TGAGGGACNONE 
J075019G06TGAGGGACNONE 
J075037H14TGAGGGACNONE 
J075057C13TGAGGGACNONE 
J075100E14TGAGGGACNONE 
J075120I16TGAGGGACNONE 
J075130F07TGAGGGACNONE 
J075156M16TGAGGGACNONE 
J100043J03TGAGGGACNONE 
Os04g0479000AK106344TGAGGGACSimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0496600AK065058TGAGGGACConserved hypothetical protein. 
J013001J09TGAGGGACNONE 
J013037C18TGAGGGACNONE 
J013126H05TGAGGGACNONE 
J090062G17TGAGGGACNONE 
Os04g0502300009-116-F02TGAGGGACNONE 
009-130-H06TGAGGGACNONE 
AK120520TGAGGGACSimilar to 40S ribosomal protein S11. 
J013124K01TGAGGGACNONE 
J023102F03TGAGGGACNONE 
J033094F17TGAGGGACNONE 
J053054C22TGAGGGACNONE 
J065024N13TGAGGGACNONE 
J065083J18TGAGGGACNONE 
J065132O14TGAGGGACNONE 
J065156M09TGAGGGACNONE 
J065176N15TGAGGGACNONE 
J065208H08TGAGGGACNONE 
J075054B03TGAGGGACNONE 
J090053E20TGAGGGACNONE 
J100075B09TGAGGGACNONE 
J100089H12TGAGGGACNONE 
Os04g0566900AK072344TGAGGGACConserved hypothetical protein. 
Os04g0589200AK068571TGAGGGACConserved hypothetical protein. 
AK102463TGAGGGACNONE 
J075083K10TGAGGGACNONE 
Os04g0598000013-056-C01TGAGGGACNONE 
AK121673TGAGGGACConserved hypothetical protein. 
J013055M22TGAGGGACNONE 
J023038C06TGAGGGACNONE 
J033068C09TGAGGGACNONE 
J075026L16TGAGGGACNONE 
J075099K14TGAGGGACNONE 
J075121B18TGAGGGACNONE 
J075156K08TGAGGGACNONE 
J075190I04TGAGGGACNONE 
J080315E20TGAGGGACNONE 
J090049E09TGAGGGACNONE 
J100024F09TGAGGGACNONE 
J100041H21TGAGGGACNONE 
J100073L07TGAGGGACNONE 
J100077K04TGAGGGACNONE 
J100080P09TGAGGGACNONE 
J100087E22TGAGGGACNONE 
Os04g0607200J065082C16TGAGGGACNONE 
J065167I02TGAGGGACNONE 
Os04g0626400006-050-B09TGAGGGACNONE 
006-072-C12TGAGGGACNONE 
006-092-C11TGAGGGACNONE 
AK059851TGAGGGACCalycin-like family protein. 
AK100069TGAGGGACNONE 
AK104062TGAGGGACNONE 
AK104663TGAGGGACNONE 
Os04g0670800AK073170TGAGGGACNONE 
Os04g0690866014-091-B08GTCCCTCAConserved hypothetical protein. 
J065085H18GTCCCTCANONE 
J065099J05GTCCCTCANONE 
J065194D12GTCCCTCANONE 
J065197H01GTCCCTCANONE 
Os05g0129400AK102359GTCCCTCAAnkyrin repeat containing protein. 
J033091I05GTCCCTCANONE 
Os05g0139200AK108058TGAGGGACCyclin-like F-box domain containing protein. 
Os05g0190500004-013-C07GTCCCTCANONE 
009-077-A01GTCCCTCANONE 
009-158-G03GTCCCTCANONE 
009-186-C08GTCCCTCANONE 
AK060968GTCCCTCANONE 
AK104246GTCCCTCANONE 
AK104460GTCCCTCANONE 
AK104519GTCCCTCANONE 
AK109335GTCCCTCASimilar to Acid phosphatase. 
Os05g0194550J075140P14GTCCCTCAConserved hypothetical protein. 
Os05g0220900AK109172TGAGGGACNONE 
AK109456TGAGGGACPrefoldin domain containing protein. 
Os05g0243300AK108395TGAGGGACSimilar to 50S ribosomal protein L13. 
J090098J16TGAGGGACNONE 
J100042H03TGAGGGACNONE 
J100088D02TGAGGGACNONE 
Os05g0316200AK060608TGAGGGACNONE 
AK101705TGAGGGACConserved hypothetical protein. 
AK111481TGAGGGACNONE 
Os05g0325200J090038J19TGAGGGACCyclin-like domain containing protein. 
Os05g0365500AK072352TGAGGGACProtein prenyltransferase domain containing protein. 
J043027P13TGAGGGACNONE 
Os05g0377000Os05g0377000TGAGGGACSimilar to Acyl carrier protein (ACP). 
Os05g0392801J090025K15GTCCCTCAConserved hypothetical protein. 
J090053E06GTCCCTCANONE 
Os05g0401300009-111-H03GTCCCTCANONE 
AK060678GTCCCTCATwin-arginine translocation pathway signal domain containing protein. 
Os05g0422900AK073629TGAGGGACConserved hypothetical protein. 
J023126I07TGAGGGACNONE 
J023143K12TGAGGGACNONE 
J033051N08TGAGGGACNONE 
J033128I04TGAGGGACNONE 
J065067M02TGAGGGACNONE 
J080312N05TGAGGGACNONE 
J100032G23TGAGGGACNONE 
Os05g0423701J100057H19GTCCCTCAGlycoside hydrolase, family 9 protein. 
Os05g0440100015-006-F06TGAGGGACNONE 
015-076-D04TGAGGGACNONE 
AK073094TGAGGGACNONE 
AK102786TGAGGGACHistone deacetylase superfamily protein. 
J033107M16TGAGGGACNONE 
Os05g0553700006-100-D08TGAGGGACNONE 
AK099747TGAGGGACNONE 
AK101606TGAGGGACNONE 
AK103396TGAGGGACSimilar to Syntaxin 71 (AtSYP71). 
J033022M23TGAGGGACNONE 
J090086G01TGAGGGACNONE 
Os05g0555300009-032-C03TGAGGGACNONE 
009-125-E08TGAGGGACNONE 
009-149-C12TGAGGGACNONE 
009-172-C01TGAGGGACNONE 
AK062890TGAGGGACFerredoxin domain containing protein. 
AK062997TGAGGGACNONE 
Os05g0565000AK102673TGAGGGACSimilar to 60S ribosomal protein L18a-1. 
J033102C12TGAGGGACNONE 
J033124C13TGAGGGACNONE 
J043003L04TGAGGGACNONE 
J043006N08TGAGGGACNONE 
Os05g0583400AK101992TGAGGGACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit). 
Os06g0102600J065187I04TGAGGGACHypothetical protein. 
Os06g0136700AK065081TGAGGGACSteroid nuclear receptor, ligand-binding domain containing protein. 
J013001L08TGAGGGACNONE 
J013039I03TGAGGGACNONE 
Os06g0174350J043034B05GTCCCTCAConserved hypothetical protein. 
Os06g0226000J065039K05GTCCCTCANONE 
J065055N12GTCCCTCANONE 
J065068D18GTCCCTCANONE 
J065108A17GTCCCTCANONE 
J065192L08GTCCCTCANONE 
Os06g0245600Os06g0245600GTCCCTCAphosphotransferase system, PEP-utilising enzyme, N-terminal domain containing protein. 
Os06g0285400AK105829GTCCCTCANONE 
Os06g0324000AK109614GTCCCTCAConserved hypothetical protein. 
AK109614GTCCCTCAConserved hypothetical protein. 
Os06g0482200AK119703TGAGGGACThioredoxin fold domain containing protein. 
J065014B11TGAGGGACNONE 
J065055E22TGAGGGACNONE 
J065092L13TGAGGGACNONE 
J065113E21TGAGGGACNONE 
J065191D11TGAGGGACNONE 
J065214F18TGAGGGACNONE 
J075104E18TGAGGGACNONE 
J075149O19TGAGGGACNONE 
J075170I11TGAGGGACNONE 
Os06g0556300AK063985TGAGGGACCyclin-like F-box domain containing protein. 
AK101552TGAGGGACNONE 
Os06g0560400AK103575TGAGGGACNONE 
AK108074TGAGGGACProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0595900AK066655TGAGGGACCCGTranscription elongation factor S-II, central region domain containing protein. 
J075022F02TGAGGGACCCGNONE 
J075055H13TGAGGGACCCGNONE 
J075188H14TGAGGGACCCGNONE 
Os06g0610300009-078-D07GTCCCTCANONE 
AK062635GTCCCTCAConserved hypothetical protein. 
Os06g0647900AK073750TGAGGGACConserved hypothetical protein. 
J033029K17TGAGGGACNONE 
J033070L21TGAGGGACNONE 
Os06g0664400Os06g0664400TGAGGGACHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os06g0667600AK058606TGAGGGACNONE 
AK071621TGAGGGACSimilar to Glycine decarboxylase complex H-protein. 
J023101D03TGAGGGACNONE 
J033095E17TGAGGGACNONE 
J065020B16TGAGGGACNONE 
Os07g0112600AK109561GTCCCTCAConserved hypothetical protein. 
Os07g0158300006-049-G04TGAGGGACNONE 
AK099188TGAGGGACNONE 
AK104773TGAGGGACNONE 
J013106F16TGAGGGACNONE 
J013123H22TGAGGGACNONE 
J023029J02TGAGGGACNONE 
J023029J03TGAGGGACNONE 
J033138N08TGAGGGACNONE 
J075011F05TGAGGGACNONE 
J075022F10TGAGGGACNONE 
J075071L13TGAGGGACNONE 
J075094B08TGAGGGACNONE 
J075119B21TGAGGGACNONE 
J075140L02TGAGGGACNONE 
J075199O21TGAGGGACNONE 
J080001I17TGAGGGACNONE 
J080005M04TGAGGGACNONE 
J080011P17TGAGGGACNONE 
J080026B14TGAGGGACNONE 
J080026C12TGAGGGACNONE 
J080030N16TGAGGGACNONE 
J080035K23TGAGGGACNONE 
J080039J22TGAGGGACNONE 
J080045D04TGAGGGACNONE 
J080050C06TGAGGGACNONE 
J080050K14TGAGGGACNONE 
J080051I09TGAGGGACNONE 
J080053F18TGAGGGACNONE 
J080053G10TGAGGGACNONE 
J080055F05TGAGGGACNONE 
J080057E22TGAGGGACNONE 
J080058F17TGAGGGACNONE 
J080063C18TGAGGGACNONE 
J080065E02TGAGGGACNONE 
J080066E06TGAGGGACNONE 
J080067O05TGAGGGACNONE 
J080068N15TGAGGGACNONE 
J080071O04TGAGGGACNONE 
J080074A20TGAGGGACNONE 
J080074E14TGAGGGACNONE 
J080074L05TGAGGGACNONE 
J080075E08TGAGGGACNONE 
J080075H07TGAGGGACNONE 
J080077D04TGAGGGACNONE 
J080077N15TGAGGGACNONE 
J080078A07TGAGGGACNONE 
J080079H22TGAGGGACNONE 
J080080F20TGAGGGACNONE 
J080080M22TGAGGGACNONE 
J080081K09TGAGGGACNONE 
J080081L04TGAGGGACNONE 
J080090K09TGAGGGACNONE 
J080093O13TGAGGGACNONE 
J080094A18TGAGGGACNONE 
J080094E10TGAGGGACNONE 
J080094H06TGAGGGACNONE 
J080096I21TGAGGGACNONE 
J100081A19TGAGGGACNONE 
Os07g0272800AK107279TGAGGGACHypothetical protein. 
J065124H15TGAGGGACNONE 
Os07g0481000AK071382GTCCCTCASimilar to Pollen-specific kinase partner protein. 
AK101192GTCCCTCANONE 
J023056G13GTCCCTCANONE 
J023106H11GTCCCTCANONE 
J033030H11GTCCCTCANONE 
J033074F11GTCCCTCANONE 
J033130I21GTCCCTCANONE 
J065023H20GTCCCTCANONE 
J065079P18GTCCCTCANONE 
J065121D13GTCCCTCANONE 
J065217L07GTCCCTCANONE 
Os07g0561500J090084P16TGAGGGACGlucose/ribitol dehydrogenase family protein. 
J090084P16TGAGGGACGlucose/ribitol dehydrogenase family protein. 
Os07g0578600AK067155TGAGGGACSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065TGAGGGACNONE 
Os07g0589400AK072501TGAGGGACQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617TGAGGGACNONE 
AK104756TGAGGGACNONE 
Os07g0597625J065130O18CGGGTCCCTCAD-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein. 
J065166J07CGGGTCCCTCANONE 
Os07g0598500AK073214TGAGGGACProtein prenyltransferase domain containing protein. 
J065192M24TGAGGGACNONE 
J100039G03TGAGGGACNONE 
Os07g0618500AK068210TGAGGGACNONE 
AK068975TGAGGGACSimilar to Dihydropterin pyrophosphokinase /dihydropteroate synthase precursor (EC 2.5.1.15). 
J013147H17TGAGGGACNONE 
J013170L10TGAGGGACNONE 
J023061I07TGAGGGACNONE 
J043024N01TGAGGGACNONE 
Os07g0621201J065152G13GTCCCTCAConserved hypothetical protein. 
Os08g0139100006-027-E12TGAGGGACNONE 
006-089-E06TGAGGGACNONE 
006-113-G02TGAGGGACNONE 
AK061429TGAGGGACNONE 
AK099590TGAGGGACSimilar to DAG protein, chloroplast precursor. 
AK104727TGAGGGACNONE 
J013043H11TGAGGGACNONE 
J013049N13TGAGGGACNONE 
J065079F01TGAGGGACNONE 
J065122N24TGAGGGACNONE 
J065142J24TGAGGGACNONE 
J065193N03TGAGGGACNONE 
J075041I21TGAGGGACNONE 
J075145E04TGAGGGACNONE 
Os08g0305000AK102896TGAGGGACNONE 
AK107492TGAGGGACHypothetical protein. 
Os08g0366100AK061882GTCCCTCANONE 
AK120339GTCCCTCASimilar to Endothelial differentiation-related factor 1 (EDF-1) (Multiprotein bridging factor 1) (MBF1). 
J013060M10GTCCCTCANONE 
J023135H23GTCCCTCANONE 
J033095L23GTCCCTCANONE 
J065010L09GTCCCTCANONE 
J065016A02GTCCCTCANONE 
J065041H14GTCCCTCANONE 
J065043F09GTCCCTCANONE 
J065045E03GTCCCTCANONE 
J065058F23GTCCCTCANONE 
J065075L19GTCCCTCANONE 
J065078N12GTCCCTCANONE 
J065105J19GTCCCTCANONE 
J065162I03GTCCCTCANONE 
J065164D10GTCCCTCANONE 
J065170B05GTCCCTCANONE 
J075039K19GTCCCTCANONE 
J075039M06GTCCCTCANONE 
J075057L17GTCCCTCANONE 
J075059F17GTCCCTCANONE 
J075109J04GTCCCTCANONE 
J075120B14GTCCCTCANONE 
J075153I11GTCCCTCANONE 
J075156C19GTCCCTCANONE 
J075166J20GTCCCTCANONE 
J090052H04GTCCCTCANONE 
J100051E13GTCCCTCANONE 
J100057L03GTCCCTCANONE 
J100059G23GTCCCTCANONE 
Os08g0386300AK059323TGAGGGACNONE 
AK070379TGAGGGACCytochrome b5 domain containing protein. 
J023054P20TGAGGGACNONE 
J033089H01TGAGGGACNONE 
J065013I01TGAGGGACNONE 
J065212E17TGAGGGACNONE 
J080317O15TGAGGGACNONE 
J090018O07TGAGGGACNONE 
Os08g0416100AK070406TGAGGGACDEAD/DEAH box helicase, N-terminal domain containing protein. 
AY644647TGAGGGACNONE 
Os08g0416250J075097B22GTCCCTCAHypothetical protein. 
J075120J07GTCCCTCANONE 
J075179K03GTCCCTCANONE 
Os08g0416400AK064144TGAGGGACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0427900AK103217TGAGGGACSimilar to Hin19 (Fragment). 
AK109208TGAGGGACNONE 
J080005C08TGAGGGACNONE 
J080010B10TGAGGGACNONE 
J080013C21TGAGGGACNONE 
J080022L12TGAGGGACNONE 
J080029C08TGAGGGACNONE 
J080029G09TGAGGGACNONE 
J080035L14TGAGGGACNONE 
J080040M20TGAGGGACNONE 
J080043M18TGAGGGACNONE 
J080045K15TGAGGGACNONE 
J080048I17TGAGGGACNONE 
J080051P16TGAGGGACNONE 
J080053L16TGAGGGACNONE 
J080059P14TGAGGGACNONE 
J080063E13TGAGGGACNONE 
J080075N18TGAGGGACNONE 
J080077E05TGAGGGACNONE 
J080080H23TGAGGGACNONE 
J080081L16TGAGGGACNONE 
J080083F17TGAGGGACNONE 
J080085C23TGAGGGACNONE 
J080086A12TGAGGGACNONE 
J080088N06TGAGGGACNONE 
J080092G10TGAGGGACNONE 
J080093F04TGAGGGACNONE 
J080094C03TGAGGGACNONE 
J090032L12TGAGGGACNONE 
Os08g0465300AK108076GTCCCTCAConserved hypothetical protein. 
Os08g0486100AK059217TGAGGGACSimilar to Potential copper-transporting ATPase PAA1 (EC 3.6.3.4). 
Os08g0486200012-094-G01TGAGGGACNONE 
015-022-G01TGAGGGACNONE 
AK064030TGAGGGACSimilar to Splicing factor SC35. 
AK103676TGAGGGACNONE 
J023034B03TGAGGGACNONE 
J033126D21TGAGGGACNONE 
J033136B19TGAGGGACNONE 
J043004H03TGAGGGACNONE 
J080009E16TGAGGGACNONE 
J080020G22TGAGGGACNONE 
J080029L21TGAGGGACNONE 
J080033M18TGAGGGACNONE 
J080043H20TGAGGGACNONE 
J080046N23TGAGGGACNONE 
J080055K10TGAGGGACNONE 
J080059P19TGAGGGACNONE 
J080060G22TGAGGGACNONE 
J080064L15TGAGGGACNONE 
J080065D19TGAGGGACNONE 
J080065J06TGAGGGACNONE 
J080074L14TGAGGGACNONE 
J080076H14TGAGGGACNONE 
J080079A08TGAGGGACNONE 
J080092D09TGAGGGACNONE 
J080093D19TGAGGGACNONE 
J080093F01TGAGGGACNONE 
J080095L16TGAGGGACNONE 
J090073P10TGAGGGACNONE 
Os08g0521400006-047-C11TGAGGGACNONE 
016-014-E07TGAGGGACNONE 
AK070148TGAGGGACNONE 
AK101704TGAGGGACZinc finger, RanBP2-type domain containing protein. 
AK105045TGAGGGACNONE 
J013108K14TGAGGGACNONE 
J013129E16TGAGGGACNONE 
J013159M23TGAGGGACNONE 
J023041G22TGAGGGACNONE 
J033060G13TGAGGGACNONE 
J033060J15TGAGGGACNONE 
J065120J24TGAGGGACNONE 
J065160I01TGAGGGACNONE 
J065179A16TGAGGGACNONE 
J065189K04TGAGGGACNONE 
J090032O15TGAGGGACNONE 
J090045A18TGAGGGACNONE 
J090060B21TGAGGGACNONE 
J090086F23TGAGGGACNONE 
J090098O22TGAGGGACNONE 
J100018K20TGAGGGACNONE 
J100048P22TGAGGGACNONE 
J100052I06TGAGGGACNONE 
Os08g0533700AK073691TGAGGGACConserved hypothetical protein. 
J033060E01TGAGGGACNONE 
J033111N06TGAGGGACNONE 
J053025N12TGAGGGACNONE 
J053080P18TGAGGGACNONE 
J053098H09TGAGGGACNONE 
J090076L19TGAGGGACNONE 
J100056A18TGAGGGACNONE 
Os09g0298500009-037-H05GTCCCTCANONE 
015-032-F11GTCCCTCANONE 
AK062446GTCCCTCANONE 
AK064311GTCCCTCAZinc finger, RING-type domain containing protein. 
Os09g0401200AK063980TGAGGGACSimilar to HSP associated protein like. 
AK063980TGAGGGACCCASimilar to HSP associated protein like. 
Os09g0412900014-003-F10TGAGGGACNONE 
AK102254TGAGGGACProtein prenyltransferase domain containing protein. 
AK102867TGAGGGACNONE 
J033088H22TGAGGGACNONE 
Os09g0413100009-081-A09TGAGGGACNONE 
AK062649TGAGGGACConserved hypothetical protein. 
J065188L14TGAGGGACNONE 
Os09g0448100AK070293TGAGGGACCyclin-like F-box domain containing protein. 
AK070628TGAGGGACNONE 
J023050H06TGAGGGACNONE 
J053091I22TGAGGGACNONE 
J065051I11TGAGGGACNONE 
J065066L13TGAGGGACNONE 
Os09g0450700AK067088GTCCCTCAConserved hypothetical protein. 
J013094N24GTCCCTCANONE 
J033034O19GTCCCTCANONE 
J065019O16GTCCCTCANONE 
J065080P17GTCCCTCANONE 
J065082O14GTCCCTCANONE 
Os09g0471900AK073815TGAGGGACBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0482400012-003-B01TGAGGGACNONE 
012-008-B05TGAGGGACNONE 
012-010-C09TGAGGGACNONE 
012-080-B07TGAGGGACNONE 
012-083-G11TGAGGGACNONE 
012-089-D09TGAGGGACNONE 
012-091-C01TGAGGGACNONE 
015-053-A11TGAGGGACNONE 
AB111810TGAGGGACSimilar to Heat shock protein 82. 
J033032D17TGAGGGACNONE 
J033124F14TGAGGGACNONE 
J065054M12TGAGGGACNONE 
J065085K18TGAGGGACNONE 
J065103F22TGAGGGACNONE 
J065120O18TGAGGGACNONE 
J065122B08TGAGGGACNONE 
J065127I15TGAGGGACNONE 
J065128C06TGAGGGACNONE 
J065130N10TGAGGGACNONE 
J065152D21TGAGGGACNONE 
J065207P17TGAGGGACNONE 
J065208E07TGAGGGACNONE 
J075011C19TGAGGGACNONE 
J075020E07TGAGGGACNONE 
J075079G06TGAGGGACNONE 
J075092D22TGAGGGACNONE 
J080042F22TGAGGGACNONE 
J080057N10TGAGGGACNONE 
J080059D14TGAGGGACNONE 
J090009E01TGAGGGACNONE 
J090016L14TGAGGGACNONE 
J090026O14TGAGGGACNONE 
J090030D09TGAGGGACNONE 
J090030E13TGAGGGACNONE 
J090044D22TGAGGGACNONE 
J090047O17TGAGGGACNONE 
J090065K19TGAGGGACNONE 
J090066J12TGAGGGACNONE 
J090068D04TGAGGGACNONE 
J090074B12TGAGGGACNONE 
J090078L24TGAGGGACNONE 
J090083A07TGAGGGACNONE 
J090091E02TGAGGGACNONE 
J090093F23TGAGGGACNONE 
J090095K09TGAGGGACNONE 
J100021G05TGAGGGACNONE 
J100022I18TGAGGGACNONE 
J100028G20TGAGGGACNONE 
J100035E22TGAGGGACNONE 
J100037I09TGAGGGACNONE 
J100039L12TGAGGGACNONE 
J100041O10TGAGGGACNONE 
J100045N10TGAGGGACNONE 
J100049H24TGAGGGACNONE 
J100057E17TGAGGGACNONE 
J100058H08TGAGGGACNONE 
J100063D02TGAGGGACNONE 
J100064E04TGAGGGACNONE 
J100068D15TGAGGGACNONE 
J100069J01TGAGGGACNONE 
J100070E03TGAGGGACNONE 
J100074G01TGAGGGACNONE 
J100080C21TGAGGGACNONE 
J100082M08TGAGGGACNONE 
J100086E08TGAGGGACNONE 
Os09g0489800AK106880TGAGGGACHypothetical protein. 
AK119382TGAGGGACNONE 
Os09g0495200AK102989TGAGGGACConserved hypothetical protein. 
J075062H18TGAGGGACNONE 
J075098G06TGAGGGACNONE 
Os09g0497400AK058354TGAGGGACNONE 
AK068677TGAGGGACProtein of unknown function DUF850, transmembrane eukaryotic family protein. 
J013159B19TGAGGGACNONE 
J023011D22TGAGGGACNONE 
J023081K05TGAGGGACNONE 
J033060O14TGAGGGACNONE 
J075020I08TGAGGGACNONE 
J075034J03TGAGGGACNONE 
J075049M15TGAGGGACNONE 
J075065K02TGAGGGACNONE 
J075099L06TGAGGGACNONE 
Os09g0521700014-005-C08GTCCCTCANONE 
AK063628GTCCCTCASimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507GTCCCTCANONE 
Os09g0571400AK103109GTCCCTCACyclophilin 1. 
J023011A12GTCCCTCANONE 
J033119A20GTCCCTCANONE 
J053034N16GTCCCTCANONE 
J053045N23GTCCCTCANONE 
J053052J12GTCCCTCANONE 
J053052K04GTCCCTCANONE 
J053099M15GTCCCTCANONE 
J065071H23GTCCCTCANONE 
J065131B16GTCCCTCANONE 
J075003F19GTCCCTCANONE 
J075116F02GTCCCTCANONE 
J075126G05GTCCCTCANONE 
J075145E09GTCCCTCANONE 
J075149O22GTCCCTCANONE 
J075163A09GTCCCTCANONE 
J075194A09GTCCCTCANONE 
L29471GTCCCTCANONE 
Os11g0148000AK108267GTCCCTCASodium/calcium exchanger membrane region domain containing protein. 
J065051O11GTCCCTCANONE 
J065110G12GTCCCTCANONE 
Os11g0157100012-010-F03TGAGGGACNONE 
J013028H01TGAGGGACNONE 
J013061L19TGAGGGACNONE 
J033044L03TGAGGGACNONE 
J033064P09TGAGGGACNONE 
J033076A10TGAGGGACNONE 
J033076K22TGAGGGACNONE 
J033084J05TGAGGGACNONE 
J033145A22TGAGGGACNONE 
J033148L19TGAGGGACNONE 
J065027P20TGAGGGACNONE 
J065085D16TGAGGGACNONE 
J065091L03TGAGGGACNONE 
J065195C18TGAGGGACNONE 
J090018N23TGAGGGACNONE 
J090048A10TGAGGGACNONE 
J090048M03TGAGGGACNONE 
J090066L11TGAGGGACNONE 
J090075G16TGAGGGACNONE 
J090083G23TGAGGGACNONE 
J090087E24TGAGGGACNONE 
J090096H16TGAGGGACNONE 
Os11g0229100AK105557GTCCCTCAConserved hypothetical protein. 
AK105557GTCCCTCAConserved hypothetical protein. 
Os11g0448400AB095094TGAGGGACSimilar to Sigma factor SIG2A. 
J075053H03TGAGGGACNONE 
J075062F23TGAGGGACNONE 
J090029D08TGAGGGACNONE 
Os11g0481600AK109900TGAGGGACConserved hypothetical protein. 
Os11g0550900015-031-H10TGAGGGACNONE 
015-031-H10TGAGGGACNONE 
AK106291TGAGGGACConserved hypothetical protein. 
AK106291TGAGGGACConserved hypothetical protein. 
Os11g0585100AK107496GTCCCTCAConserved hypothetical protein. 
J065184E24GTCCCTCANONE 
Os11g0602600006-046-H02TGAGGGACNONE 
006-046-H02TGAGGGACNONE 
006-056-H08TGAGGGACNONE 
006-056-H08TGAGGGACNONE 
009-116-D05TGAGGGACNONE 
009-116-D05TGAGGGACNONE 
AK072671TGAGGGACSimilar to 40S ribosomal protein S9. 
AK072671TGAGGGACSimilar to 40S ribosomal protein S9. 
AK104660TGAGGGACNONE 
AK104660TGAGGGACNONE 
J023134P20TGAGGGACNONE 
J023134P20TGAGGGACNONE 
J023141O13TGAGGGACNONE 
J023141O13TGAGGGACNONE 
J033066I15TGAGGGACNONE 
J033066I15TGAGGGACNONE 
J033076A08TGAGGGACNONE 
J033076A08TGAGGGACNONE 
J033150J23TGAGGGACNONE 
J033150J23TGAGGGACNONE 
J065114P19TGAGGGACNONE 
J065114P19TGAGGGACNONE 
J065176B01TGAGGGACNONE 
J065176B01TGAGGGACNONE 
J065207H21TGAGGGACNONE 
J065207H21TGAGGGACNONE 
J080301L21TGAGGGACNONE 
J080301L21TGAGGGACNONE 
J080308A08TGAGGGACNONE 
J080308A08TGAGGGACNONE 
J080318K23TGAGGGACNONE 
J080318K23TGAGGGACNONE 
J080319F17TGAGGGACNONE 
J080319F17TGAGGGACNONE 
J080319I10TGAGGGACNONE 
J080319I10TGAGGGACNONE 
J090028C08TGAGGGACNONE 
J090028C08TGAGGGACNONE 
J090051I24TGAGGGACNONE 
J090051I24TGAGGGACNONE 
J090053L21TGAGGGACNONE 
J090053L21TGAGGGACNONE 
J090069C20TGAGGGACNONE 
J090069C20TGAGGGACNONE 
J100017G08TGAGGGACNONE 
J100017G08TGAGGGACNONE 
J100042B06TGAGGGACNONE 
J100042B06TGAGGGACNONE 
J100045G24TGAGGGACNONE 
J100045G24TGAGGGACNONE 
J100050J19TGAGGGACNONE 
J100050J19TGAGGGACNONE 
J100052D23TGAGGGACNONE 
J100052D23TGAGGGACNONE 
J100053M03TGAGGGACNONE 
J100053M03TGAGGGACNONE 
J100056D08TGAGGGACNONE 
J100056D08TGAGGGACNONE 
J100066B19TGAGGGACNONE 
J100066B19TGAGGGACNONE 
J100071N23TGAGGGACNONE 
J100071N23TGAGGGACNONE 
J100074H01TGAGGGACNONE 
J100074H01TGAGGGACNONE 
J100074H19TGAGGGACNONE 
J100074H19TGAGGGACNONE 
J100077C06TGAGGGACNONE 
J100077C06TGAGGGACNONE 
Os11g0640000Os11g0640000TGAGGGACNB-ARC domain containing protein. 
Os11g0703900011-004-D05TGAGGGACNONE 
011-014-C03TGAGGGACNONE 
011-016-C01TGAGGGACNONE 
011-017-B04TGAGGGACNONE 
011-017-E09TGAGGGACNONE 
011-019-E12TGAGGGACNONE 
011-021-H12TGAGGGACNONE 
011-025-H02TGAGGGACNONE 
011-027-B09TGAGGGACNONE 
011-039-G07TGAGGGACNONE 
011-044-G07TGAGGGACNONE 
011-046-F11TGAGGGACNONE 
011-070-F02TGAGGGACNONE 
011-071-A07TGAGGGACNONE 
011-082-A03TGAGGGACNONE 
011-086-B09TGAGGGACNONE 
011-092-C04TGAGGGACNONE 
012-006-F02TGAGGGACNONE 
012-011-G08TGAGGGACNONE 
012-026-C06TGAGGGACNONE 
012-026-G06TGAGGGACNONE 
012-028-E05TGAGGGACNONE 
012-040-A05TGAGGGACNONE 
012-045-C01TGAGGGACNONE 
012-046-A10TGAGGGACNONE 
012-047-H09TGAGGGACNONE 
012-059-A12TGAGGGACNONE 
012-072-D06TGAGGGACNONE 
012-073-D05TGAGGGACNONE 
012-076-D08TGAGGGACNONE 
012-079-G05TGAGGGACNONE 
012-080-A04TGAGGGACNONE 
012-080-E01TGAGGGACNONE 
012-083-C03TGAGGGACNONE 
012-083-G06TGAGGGACNONE 
012-086-G02TGAGGGACNONE 
012-091-A07TGAGGGACNONE 
012-094-G10TGAGGGACNONE 
012-098-A07TGAGGGACNONE 
012-100-G04TGAGGGACNONE 
015-001-A11TGAGGGACNONE 
015-033-E01TGAGGGACNONE 
015-047-F12TGAGGGACNONE 
015-054-E05TGAGGGACNONE 
015-063-H02TGAGGGACNONE 
015-075-E10TGAGGGACNONE 
015-086-F05TGAGGGACNONE 
016-031-A08TGAGGGACNONE 
016-053-A03TGAGGGACNONE 
016-054-C09TGAGGGACNONE 
016-079-C08TGAGGGACNONE 
AK065431TGAGGGACHeat shock protein 70. 
AK119255TGAGGGACNONE 
J013021C12TGAGGGACNONE 
J013021C17TGAGGGACNONE 
J023027B08TGAGGGACNONE 
J023078A21TGAGGGACNONE 
J023097M06TGAGGGACNONE 
J023100O04TGAGGGACNONE 
J023107B17TGAGGGACNONE 
J023108L24TGAGGGACNONE 
J023109L05TGAGGGACNONE 
J033022M22TGAGGGACNONE 
J033023K21TGAGGGACNONE 
J033031L11TGAGGGACNONE 
J033034H10TGAGGGACNONE 
J033037B16TGAGGGACNONE 
J033037F16TGAGGGACNONE 
J033037H07TGAGGGACNONE 
J033046E22TGAGGGACNONE 
J033050N12TGAGGGACNONE 
J033064F10TGAGGGACNONE 
J033064N10TGAGGGACNONE 
J033066O09TGAGGGACNONE 
J033068H01TGAGGGACNONE 
J033068J07TGAGGGACNONE 
J033070B10TGAGGGACNONE 
J033070G13TGAGGGACNONE 
J033073O13TGAGGGACNONE 
J033075B07TGAGGGACNONE 
J033079L15TGAGGGACNONE 
J033081J06TGAGGGACNONE 
J033086G13TGAGGGACNONE 
J033086N07TGAGGGACNONE 
J033086O05TGAGGGACNONE 
J033091A15TGAGGGACNONE 
J033091D05TGAGGGACNONE 
J033094C12TGAGGGACNONE 
J033099P03TGAGGGACNONE 
J033107L09TGAGGGACNONE 
J033108D16TGAGGGACNONE 
J033109E12TGAGGGACNONE 
J033109K14TGAGGGACNONE 
J033112P22TGAGGGACNONE 
J033116F12TGAGGGACNONE 
J033116K01TGAGGGACNONE 
J033118F19TGAGGGACNONE 
J033121J10TGAGGGACNONE 
J033126H04TGAGGGACNONE 
J033131G17TGAGGGACNONE 
J033131L05TGAGGGACNONE 
J033136A08TGAGGGACNONE 
J033136H22TGAGGGACNONE 
J033143F01TGAGGGACNONE 
J065040M10TGAGGGACNONE 
J065046F17TGAGGGACNONE 
J065048G20TGAGGGACNONE 
J065071N06TGAGGGACNONE 
J065084I24TGAGGGACNONE 
J065171B01TGAGGGACNONE 
J065191J21TGAGGGACNONE 
J065199I20TGAGGGACNONE 
J075076C02TGAGGGACNONE 
J090002P12TGAGGGACNONE 
J090003A11TGAGGGACNONE 
J090003H11TGAGGGACNONE 
J090009M22TGAGGGACNONE 
J090009O11TGAGGGACNONE 
J090014N09TGAGGGACNONE 
J090015A18TGAGGGACNONE 
J090016E16TGAGGGACNONE 
J090016I07TGAGGGACNONE 
J090017O07TGAGGGACNONE 
J090019E10TGAGGGACNONE 
J090020D24TGAGGGACNONE 
J090021M16TGAGGGACNONE 
J090022F13TGAGGGACNONE 
J090023H03TGAGGGACNONE 
J090024E15TGAGGGACNONE 
J090024G19TGAGGGACNONE 
J090026J19TGAGGGACNONE 
J090030E20TGAGGGACNONE 
J090030I15TGAGGGACNONE 
J090032F04TGAGGGACNONE 
J090033N22TGAGGGACNONE 
J090033O19TGAGGGACNONE 
J090036F08TGAGGGACNONE 
J090039A13TGAGGGACNONE 
J090042N07TGAGGGACNONE 
J090043C15TGAGGGACNONE 
J090043N09TGAGGGACNONE 
J090053J10TGAGGGACNONE 
J090054F14TGAGGGACNONE 
J090057N12TGAGGGACNONE 
J090061P13TGAGGGACNONE 
J090062F17TGAGGGACNONE 
J090065H15TGAGGGACNONE 
J090067P11TGAGGGACNONE 
J090068M09TGAGGGACNONE 
J090069E24TGAGGGACNONE 
J090069K16TGAGGGACNONE 
J090070N07TGAGGGACNONE 
J090072M09TGAGGGACNONE 
J090075I24TGAGGGACNONE 
J090075M04TGAGGGACNONE 
J090077D24TGAGGGACNONE 
J090080M17TGAGGGACNONE 
J090080O14TGAGGGACNONE 
J090081C12TGAGGGACNONE 
J090084N21TGAGGGACNONE 
J090084O21TGAGGGACNONE 
J090087J18TGAGGGACNONE 
J090092L17TGAGGGACNONE 
J090097A08TGAGGGACNONE 
J100017E24TGAGGGACNONE 
J100018K11TGAGGGACNONE 
J100019A16TGAGGGACNONE 
J100023I23TGAGGGACNONE 
J100024D07TGAGGGACNONE 
J100025H12TGAGGGACNONE 
J100027K19TGAGGGACNONE 
J100028C23TGAGGGACNONE 
J100029A14TGAGGGACNONE 
J100029O19TGAGGGACNONE 
J100030I09TGAGGGACNONE 
J100030J16TGAGGGACNONE 
J100031C01TGAGGGACNONE 
J100031N06TGAGGGACNONE 
J100033H04TGAGGGACNONE 
J100034L20TGAGGGACNONE 
J100036K13TGAGGGACNONE 
J100039M02TGAGGGACNONE 
J100040J01TGAGGGACNONE 
J100042O21TGAGGGACNONE 
J100042P20TGAGGGACNONE 
J100047K22TGAGGGACNONE 
J100049B16TGAGGGACNONE 
J100052M10TGAGGGACNONE 
J100053B05TGAGGGACNONE 
J100053B20TGAGGGACNONE 
J100055I11TGAGGGACNONE 
J100056A13TGAGGGACNONE 
J100057C08TGAGGGACNONE 
J100057N11TGAGGGACNONE 
J100057P07TGAGGGACNONE 
J100059E16TGAGGGACNONE 
J100063N14TGAGGGACNONE 
J100069H01TGAGGGACNONE 
J100071C17TGAGGGACNONE 
J100071K09TGAGGGACNONE 
J100077D07TGAGGGACNONE 
J100078P22TGAGGGACNONE 
J100080F11TGAGGGACNONE 
J100081L07TGAGGGACNONE 
J100083B10TGAGGGACNONE 
J100083K17TGAGGGACNONE 
J100085B22TGAGGGACNONE 
J100085L21TGAGGGACNONE 
J100086B11TGAGGGACNONE 
J100087E06TGAGGGACNONE 
J100087P07TGAGGGACNONE 
J100089H24TGAGGGACNONE 
Os12g0109600AK107606TGAGGGACProtein of unknown function DUF1677, Oryza sativa family protein. 
J053026B13TGAGGGACNONE 
J053033C09TGAGGGACNONE 
J053059G21TGAGGGACNONE 
J053071A13TGAGGGACNONE 
J075007L19TGAGGGACNONE 
J075071J20TGAGGGACNONE 
J075110F18TGAGGGACNONE 
Os12g0115900AK058318TGAGGGACElongation factor P/YeiP family protein. 
J065078K17TGAGGGACNONE 
J065102G03TGAGGGACNONE 
J065122B14TGAGGGACNONE 
J065122C10TGAGGGACNONE 
J065134I23TGAGGGACNONE 
J065176B12TGAGGGACNONE 
Os12g0118400009-027-G04GTCCCTCANONE 
009-129-H07GTCCCTCANONE 
AK062407GTCCCTCANONE 
AK111804GTCCCTCASimilar to Inwardly rectifying potassium channel subunit. 
J065081E04GTCCCTCANONE 
J090095O18GTCCCTCANONE 
Os12g0175400009-157-A08GTCCCTCANONE 
011-089-A10GTCCCTCANONE 
AK063027GTCCCTCANONE 
D88618GTCCCTCAHomeodomain-like containing protein. 
Os12g0233500Os12g0233500GTCCCTCANONE 
Os12g0279600AK070295TGAGGGACExodeoxyribonuclease III xth family protein. 
Os12g0294100AK111535TGAGGGACWD40-like domain containing protein. 
J013030D09TGAGGGACNONE 
J013153J16TGAGGGACNONE 
J033079N17TGAGGGACNONE 
J090002M14TGAGGGACNONE 
J090071M08TGAGGGACNONE 
J090090E07TGAGGGACNONE 
Os12g0403800AK059940TGAGGGACNONE 
AK064189TGAGGGACExoribonuclease domain containing protein. 
Os12g0409600AK105494TGAGGGACHypothetical protein. 
Os12g0572400016-084-F04TGAGGGACNONE 
AK065531TGAGGGACSimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03TGAGGGACNONE 
J013034H02TGAGGGACNONE 
J033117N05TGAGGGACNONE 
J065027L09TGAGGGACNONE 
J065037D09TGAGGGACNONE 
J065197I09TGAGGGACNONE 
J090045C01TGAGGGACNONE 
J100031E11TGAGGGACNONE 
Os12g0604800AK073324TGAGGGACTetratricopeptide-like helical domain containing protein. 
Os12g0609800AK101303TGAGGGACCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01TGAGGGACNONE 
J033033K21TGAGGGACNONE 
J033082L13TGAGGGACNONE 
J043034M20TGAGGGACNONE 
J065137J24TGAGGGACNONE 
J065141A11TGAGGGACNONE 
J065217H09TGAGGGACNONE 
Os12g0641500AK065733TGAGGGACNONE 
AK120333TGAGGGACNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.