version

Summary of OsREG653 (All List)

OrganismOryza sativa  
IDOsREG653  
SequenceGTGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1877  

Entry Sequences (1877 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683AAAAGCCCATTAGTGGCCCAATANONE 
AK100613AAAAGCCCATTAGTGGCCCAATASimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
Os01g0131600006-030-A03GTGGCCCACCCGNONE 
006-049-C10GTGGCCCACCCGNONE 
006-054-E02GTGGCCCACCCGNONE 
011-035-H02GTGGCCCACCCGNONE 
011-036-E04GTGGCCCACCCGNONE 
012-047-C08GTGGCCCACCCGNONE 
012-079-F08GTGGCCCACCCGNONE 
012-097-C02GTGGCCCACCCGNONE 
012-100-A07GTGGCCCACCCGNONE 
013-015-H05GTGGCCCACCCGNONE 
013-047-A03GTGGCCCACCCGNONE 
013-051-B05GTGGCCCACCCGNONE 
013-061-G02GTGGCCCACCCGNONE 
013-077-H02GTGGCCCACCCGNONE 
015-005-D04GTGGCCCACCCGNONE 
015-064-B06GTGGCCCACCCGNONE 
015-072-D02GTGGCCCACCCGNONE 
016-073-E09GTGGCCCACCCGNONE 
016-088-H03GTGGCCCACCCGNONE 
AK062063GTGGCCCACCCGNONE 
AK101133GTGGCCCACCCGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277GTGGCCCACCCGNONE 
AK119645GTGGCCCACCCGNONE 
AY341828GTGGCCCACCCGNONE 
J013036O08GTGGCCCACCCGNONE 
J013037M17GTGGCCCACCCGNONE 
J013039B11GTGGCCCACCCGNONE 
J013039L20GTGGCCCACCCGNONE 
J013047B20GTGGCCCACCCGNONE 
J013048E23GTGGCCCACCCGNONE 
J013051E12GTGGCCCACCCGNONE 
J013051F12GTGGCCCACCCGNONE 
J013056B05GTGGCCCACCCGNONE 
J013057N24GTGGCCCACCCGNONE 
J013064D21GTGGCCCACCCGNONE 
J013065G24GTGGCCCACCCGNONE 
J013075L13GTGGCCCACCCGNONE 
J013075L24GTGGCCCACCCGNONE 
J013092F04GTGGCCCACCCGNONE 
J013092F10GTGGCCCACCCGNONE 
J013092M16GTGGCCCACCCGNONE 
J013096K06GTGGCCCACCCGNONE 
J013111F10GTGGCCCACCCGNONE 
J013120B17GTGGCCCACCCGNONE 
J013120P07GTGGCCCACCCGNONE 
J013122F18GTGGCCCACCCGNONE 
J013122H23GTGGCCCACCCGNONE 
J013126I15GTGGCCCACCCGNONE 
J013126L17GTGGCCCACCCGNONE 
J013129C15GTGGCCCACCCGNONE 
J013146A04GTGGCCCACCCGNONE 
J013146A06GTGGCCCACCCGNONE 
J013153F01GTGGCCCACCCGNONE 
J013156O06GTGGCCCACCCGNONE 
J013162D05GTGGCCCACCCGNONE 
J023008N04GTGGCCCACCCGNONE 
J023010D06GTGGCCCACCCGNONE 
J023011I23GTGGCCCACCCGNONE 
J023023I15GTGGCCCACCCGNONE 
J023025C08GTGGCCCACCCGNONE 
J023029H02GTGGCCCACCCGNONE 
J023033C18GTGGCCCACCCGNONE 
J023037D21GTGGCCCACCCGNONE 
J023049F17GTGGCCCACCCGNONE 
J023052B15GTGGCCCACCCGNONE 
J023061D03GTGGCCCACCCGNONE 
J023062M01GTGGCCCACCCGNONE 
J023089D24GTGGCCCACCCGNONE 
J023109J20GTGGCCCACCCGNONE 
J023109M21GTGGCCCACCCGNONE 
J023120N04GTGGCCCACCCGNONE 
J023122A04GTGGCCCACCCGNONE 
J023134F23GTGGCCCACCCGNONE 
J023149E20GTGGCCCACCCGNONE 
J033022A12GTGGCCCACCCGNONE 
J033022C04GTGGCCCACCCGNONE 
J033024K06GTGGCCCACCCGNONE 
J033026F23GTGGCCCACCCGNONE 
J033029J19GTGGCCCACCCGNONE 
J033040H20GTGGCCCACCCGNONE 
J033042P21GTGGCCCACCCGNONE 
J033043F14GTGGCCCACCCGNONE 
J033044G11GTGGCCCACCCGNONE 
J033052L10GTGGCCCACCCGNONE 
J033052O03GTGGCCCACCCGNONE 
J033052P03GTGGCCCACCCGNONE 
J033079B20GTGGCCCACCCGNONE 
J033089D21GTGGCCCACCCGNONE 
J033094P04GTGGCCCACCCGNONE 
J033103N02GTGGCCCACCCGNONE 
J033110J19GTGGCCCACCCGNONE 
J033114E17GTGGCCCACCCGNONE 
J033115K04GTGGCCCACCCGNONE 
J033119I06GTGGCCCACCCGNONE 
J033121L10GTGGCCCACCCGNONE 
J033123H14GTGGCCCACCCGNONE 
J033136H10GTGGCCCACCCGNONE 
J033139L07GTGGCCCACCCGNONE 
J033143G23GTGGCCCACCCGNONE 
J043021F16GTGGCCCACCCGNONE 
J080304G01GTGGCCCACCCGNONE 
J080305H24GTGGCCCACCCGNONE 
J080309B11GTGGCCCACCCGNONE 
J080315N09GTGGCCCACCCGNONE 
J080319J20GTGGCCCACCCGNONE 
J090014D01GTGGCCCACCCGNONE 
J090067F08GTGGCCCACCCGNONE 
J090079P18GTGGCCCACCCGNONE 
J090082K13GTGGCCCACCCGNONE 
J090093K17GTGGCCCACCCGNONE 
J090099G18GTGGCCCACCCGNONE 
J100022K14GTGGCCCACCCGNONE 
J100052G17GTGGCCCACCCGNONE 
Os01g0132700J065063N10GTGGCCCAAGSurfeit locus 5 family protein. 
J065164N24GTGGCCCAAGNONE 
J065167H04GTGGCCCAAGNONE 
J065187N12GTGGCCCAAGNONE 
Os01g0156300AK107993CCGTGGGCCACACGTCTCSimilar to Cappuccino protein. 
Os01g0158000AK058679AGTTGGGCCACACGNONE 
AK103127AGTTGGGCCACACGImportin alpha-2 subunit. 
D78504AGTTGGGCCACACGNONE 
Os01g0175400AK102191AATGGGCCACAnkyrin repeat containing protein. 
Os01g0191800AK061360GTGGCCCATGNONE 
Os01g0235500AK121404GTGGCCCAAAConserved hypothetical protein. 
J023043C04GTGGCCCAAANONE 
J023059J21GTGGCCCAAANONE 
J023110N17GTGGCCCAAANONE 
J023132B02GTGGCCCAAANONE 
J023134M19GTGGCCCAAANONE 
Os01g0270100006-096-H09ATATGGGCCACNONE 
009-009-C10ATATGGGCCACNONE 
009-054-E06ATATGGGCCACNONE 
014-085-F09ATATGGGCCACNONE 
AK073275ATATGGGCCACNONE 
AK104155ATATGGGCCACNONE 
AK119511ATATGGGCCACSimilar to Cysteine protease inhibitor. 
J033025K21ATATGGGCCACNONE 
J075065H10ATATGGGCCACNONE 
J075143G10ATATGGGCCACNONE 
J100059J02ATATGGGCCACNONE 
Os01g0352100AK072222GCGTGGGCCAC2OG-Fe(II) oxygenase domain containing protein. 
Os01g0369500AK100805CCATGGGCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
J023121K24CCATGGGCCACNONE 
Os01g0633400AK108988TTGGCCCATCGTGGCCCAGTACBS domain containing protein. 
Os01g0689900AK064656CGTGTGGCCCACTNONE 
AK102164CGTGTGGCCCACTProtein kinase-like domain containing protein. 
J033043D15CGTGTGGCCCACTNONE 
J033060J20CGTGTGGCCCACTNONE 
J033086H03CGTGTGGCCCACTNONE 
J033117B10CGTGTGGCCCACTNONE 
J053023O03CGTGTGGCCCACTNONE 
J053055P21CGTGTGGCCCACTNONE 
J053078A20CGTGTGGCCCACTNONE 
J053082K03CGTGTGGCCCACTNONE 
J053086A16CGTGTGGCCCACTNONE 
J080027C22CGTGTGGCCCACTNONE 
J080062G19CGTGTGGCCCACTNONE 
J080065M03CGTGTGGCCCACTNONE 
J100068P17CGTGTGGCCCACTNONE 
Os01g0690800AK066430CGTGTGGCCCACTProtein kinase-like domain containing protein. 
AK073248CGTGTGGCCCACTNONE 
J065001D22CGTGTGGCCCACTNONE 
J065116J04CGTGTGGCCCACTNONE 
J100044K03CGTGTGGCCCACTNONE 
Os01g0692100J043022J20GTGGCCCAATGlutathione S-transferase, N-terminal domain containing protein. 
J100032K22GTGGCCCAATNONE 
Os01g0719250AK105184GCTGGGCCACConserved hypothetical protein. 
Os01g0730500AK100064GTGGCCCAGASimilar to Ferredoxin (Bacterial type ferredoxin family). 
Os01g0748100AK071261GTGGCCCAAGCTGGGCCTAHypothetical protein. 
J023084C08GTGGCCCAAGCTGGGCCTANONE 
J065058A07GTGGCCCAAGCTGGGCCTANONE 
Os01g0760600011-038-B09CTTGGGCCACNONE 
AB110193CTTGGGCCACNONE 
AK103133CTTGGGCCACNONE 
AK104829CTTGGGCCACNONE 
D14673CTTGGGCCACNONE 
J023110C16CTTGGGCCACNONE 
J033028M22CTTGGGCCACNONE 
J033038A21CTTGGGCCACNONE 
J033044D24CTTGGGCCACNONE 
J033095C16CTTGGGCCACNONE 
J090003F07CTTGGGCCACNONE 
J090009P10CTTGGGCCACNONE 
J090023K01CTTGGGCCACNONE 
J090033G02CTTGGGCCACNONE 
J090037I22CTTGGGCCACNONE 
J090038A17CTTGGGCCACNONE 
J090048K09CTTGGGCCACNONE 
J090069N01CTTGGGCCACNONE 
J090078C19CTTGGGCCACNONE 
J090089P15CTTGGGCCACNONE 
J090093D07CTTGGGCCACNONE 
J090095H01CTTGGGCCACNONE 
J100057J03CTTGGGCCACNONE 
Os01g0764800AK102809CGTGTGGGCCACSimilar to Nt-gh3 deduced protein. 
Os01g0810100AK071916GTTGGGCCACACGRibonuclease III domain containing protein. 
AK099056GTTGGGCCACACGNONE 
AK104320GTTGGGCCACACGNONE 
Os01g0830500006-117-F06GTGGCCCACCACNONE 
AK061475GTGGCCCACCACNONE 
AK105801GTGGCCCACCAC2OG-Fe(II) oxygenase domain containing protein. 
J065168H17GTGGCCCACCACNONE 
J065211O10GTGGCCCACCACNONE 
Os01g0842600AK100245GTGGCCCATGGSimilar to AAA-metalloprotease FtsH. 
Os01g0855600003-004-C02GTGGCCCACACGNONE 
016-023-G11GTGGCCCACACGNONE 
AK099776GTGGCCCACACGSimilar to Hs1pro-1 protein. 
AY224522GTGGCCCACACGNONE 
J013095E24GTGGCCCACACGNONE 
J023041J04GTGGCCCACACGNONE 
J065130B09GTGGCCCACACGNONE 
J075031B02GTGGCCCACACGNONE 
J075069H11GTGGCCCACACGNONE 
J100026O10GTGGCCCACACGNONE 
J100050J01GTGGCCCACACGNONE 
J100052G04GTGGCCCACACGNONE 
J100053D07GTGGCCCACACGNONE 
J100054K16GTGGCCCACACGNONE 
J100067A06GTGGCCCACACGNONE 
J100067G01GTGGCCCACACGNONE 
J100088C18GTGGCCCACACGNONE 
Os01g0870100AK067564GTGGCCCACGGGProtein of unknown function DUF1012 family protein. 
AK072312GTGGCCCACGGGNONE 
AK103428GTGGCCCACGGGNONE 
Os01g0871800AK064787GTGGCCCAGTTNONE 
AK067087GTGGCCCAGTTTGF-beta receptor, type I/II extracellular region family protein. 
AK120109GTGGCCCAGTTNONE 
J013023O17GTGGCCCAGTTNONE 
J013108P12GTGGCCCAGTTNONE 
J013110E18GTGGCCCAGTTNONE 
J013110E22GTGGCCCAGTTNONE 
J013132E24GTGGCCCAGTTNONE 
J013160C03GTGGCCCAGTTNONE 
Os01g0896400AK107067CGTGTGGCCCACCCGConserved hypothetical protein. 
Os01g0916300011-018-B12TATGGGCCACNONE 
AK063922TATGGGCCACSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107TATGGGCCACNONE 
AK121061TATGGGCCACNONE 
AK121997TATGGGCCACNONE 
J033118P14TATGGGCCACNONE 
J065002N16TATGGGCCACNONE 
J065079B04TATGGGCCACNONE 
J065102J07TATGGGCCACNONE 
J065128F16TATGGGCCACNONE 
J065184D11TATGGGCCACNONE 
J065186A07TATGGGCCACNONE 
J075115C07TATGGGCCACNONE 
J075147C04TATGGGCCACNONE 
Os01g0916700Os01g0916700ATTGGGCCATTGGGCCACConserved hypothetical protein. 
Os01g0937300AK062872CCATGGGCCACNONE 
AK062872TGTGGGCCACNONE 
J033136K12CCATGGGCCACNONE 
J033136K12TGTGGGCCACNONE 
J053048E20CCATGGGCCACNONE 
J053048E20TGTGGGCCACNONE 
J053088K08CCATGGGCCACNONE 
J053088K08TGTGGGCCACNONE 
J065011G23CCATGGGCCACNONE 
J065011G23TGTGGGCCACNONE 
J065202J09CCATGGGCCACNONE 
J065202J09TGTGGGCCACNONE 
Os01g0969100AK070623GGAGTGGGCCACNAD-dependent epimerase/dehydratase family protein. 
Os01g0976600AK072971GTGGCCCAATSimilar to Methlytransferase, UbiE/COQ5 family. 
J023148G18GTGGCCCAATNONE 
J075095H03GTGGCCCAATNONE 
J090089M19GTGGCCCAATNONE 
Os01g0978100005-013-E01GTGGCCCAAGNONE 
011-026-E02GTGGCCCAAGNONE 
011-064-C01GTGGCCCAAGNONE 
AK065007GTGGCCCAAGNONE 
AK065652GTGGCCCAAGSimilar to Cysteine synthase, mitochondrial precursor (EC 2.5.1.47) (O- acetylserine sulfhydrylase) (O-acetylserine (Thiol)-lyase) (CSase C) (CS-C) (OAS-TL C) (AtCS-C). 
AK099217GTGGCCCAAGNONE 
AK104704GTGGCCCAAGNONE 
J013001E19GTGGCCCAAGNONE 
J013034J22GTGGCCCAAGNONE 
J013037A05GTGGCCCAAGNONE 
J013038D12GTGGCCCAAGNONE 
J013043A14GTGGCCCAAGNONE 
J013044E11GTGGCCCAAGNONE 
J013058F11GTGGCCCAAGNONE 
J013059C10GTGGCCCAAGNONE 
J013059E23GTGGCCCAAGNONE 
J013071O13GTGGCCCAAGNONE 
J013072D12GTGGCCCAAGNONE 
J013096G01GTGGCCCAAGNONE 
J013110E17GTGGCCCAAGNONE 
J013130A19GTGGCCCAAGNONE 
J013158G08GTGGCCCAAGNONE 
J023037H20GTGGCCCAAGNONE 
J023038G11GTGGCCCAAGNONE 
J023042A17GTGGCCCAAGNONE 
J023045C21GTGGCCCAAGNONE 
J023052H13GTGGCCCAAGNONE 
J023055O19GTGGCCCAAGNONE 
J023065I12GTGGCCCAAGNONE 
J023087I12GTGGCCCAAGNONE 
J023114D12GTGGCCCAAGNONE 
J023126P03GTGGCCCAAGNONE 
J023132E20GTGGCCCAAGNONE 
J023133N04GTGGCCCAAGNONE 
J023134C14GTGGCCCAAGNONE 
J033039O20GTGGCCCAAGNONE 
J033067L02GTGGCCCAAGNONE 
J033094O10GTGGCCCAAGNONE 
J043017P11GTGGCCCAAGNONE 
J043036C15GTGGCCCAAGNONE 
J053090I03GTGGCCCAAGNONE 
J065013F14GTGGCCCAAGNONE 
J065019J10GTGGCCCAAGNONE 
J065036E05GTGGCCCAAGNONE 
J065040L23GTGGCCCAAGNONE 
J065050A13GTGGCCCAAGNONE 
J065089D03GTGGCCCAAGNONE 
J065193N04GTGGCCCAAGNONE 
J080011O20GTGGCCCAAGNONE 
J080015K08GTGGCCCAAGNONE 
J080022G05GTGGCCCAAGNONE 
J080027N24GTGGCCCAAGNONE 
J080032G19GTGGCCCAAGNONE 
J080046A18GTGGCCCAAGNONE 
J080046B08GTGGCCCAAGNONE 
J080051L24GTGGCCCAAGNONE 
J080053C23GTGGCCCAAGNONE 
J080054I20GTGGCCCAAGNONE 
J080074J03GTGGCCCAAGNONE 
J080080M04GTGGCCCAAGNONE 
J080080P15GTGGCCCAAGNONE 
J080086L08GTGGCCCAAGNONE 
J090019O07GTGGCCCAAGNONE 
J090033L11GTGGCCCAAGNONE 
J090036M14GTGGCCCAAGNONE 
J100054D04GTGGCCCAAGNONE 
J100064M06GTGGCCCAAGNONE 
Os02g0103800006-046-H11GTGGCCCATGANONE 
006-060-B05GTGGCCCATGANONE 
006-097-A09GTGGCCCATGANONE 
006-102-A10GTGGCCCATGANONE 
006-104-E11GTGGCCCATGANONE 
006-112-D09GTGGCCCATGANONE 
AK061774GTGGCCCATGANONE 
AK065309GTGGCCCATGANONE 
AK106213GTGGCCCATGASimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment). 
J013002O13GTGGCCCATGANONE 
J013026F06GTGGCCCATGANONE 
J013037O14GTGGCCCATGANONE 
J013066N06GTGGCCCATGANONE 
J013108G22GTGGCCCATGANONE 
J023050M15GTGGCCCATGANONE 
J023054B21GTGGCCCATGANONE 
J023073C23GTGGCCCATGANONE 
J023086H17GTGGCCCATGANONE 
J023105A20GTGGCCCATGANONE 
J065019E16GTGGCCCATGANONE 
J065064G10GTGGCCCATGANONE 
J065071C18GTGGCCCATGANONE 
J065103B02GTGGCCCATGANONE 
J065153G06GTGGCCCATGANONE 
J075152G24GTGGCCCATGANONE 
J075166P04GTGGCCCATGANONE 
J080001F02GTGGCCCATGANONE 
J080001M07GTGGCCCATGANONE 
J080001O05GTGGCCCATGANONE 
J080003I19GTGGCCCATGANONE 
J080004C12GTGGCCCATGANONE 
J080008E17GTGGCCCATGANONE 
J080008M08GTGGCCCATGANONE 
J080010H21GTGGCCCATGANONE 
J080011F22GTGGCCCATGANONE 
J080012C16GTGGCCCATGANONE 
J080013D20GTGGCCCATGANONE 
J080018K15GTGGCCCATGANONE 
J080020O14GTGGCCCATGANONE 
J080020P21GTGGCCCATGANONE 
J080021A07GTGGCCCATGANONE 
J080021B06GTGGCCCATGANONE 
J080022G21GTGGCCCATGANONE 
J080022P14GTGGCCCATGANONE 
J080023H24GTGGCCCATGANONE 
J080023M08GTGGCCCATGANONE 
J080027E08GTGGCCCATGANONE 
J080027E18GTGGCCCATGANONE 
J080027O16GTGGCCCATGANONE 
J080029M22GTGGCCCATGANONE 
J080034A17GTGGCCCATGANONE 
J080038G04GTGGCCCATGANONE 
J080040F13GTGGCCCATGANONE 
J080040F22GTGGCCCATGANONE 
J080041L15GTGGCCCATGANONE 
J080042L04GTGGCCCATGANONE 
J080042M14GTGGCCCATGANONE 
J080043C22GTGGCCCATGANONE 
J080043O09GTGGCCCATGANONE 
J080045N17GTGGCCCATGANONE 
J080046N08GTGGCCCATGANONE 
J080047K11GTGGCCCATGANONE 
J080047O06GTGGCCCATGANONE 
J080048H10GTGGCCCATGANONE 
J080048N03GTGGCCCATGANONE 
J080050N02GTGGCCCATGANONE 
J080051A05GTGGCCCATGANONE 
J080052I20GTGGCCCATGANONE 
J080053E08GTGGCCCATGANONE 
J080055P05GTGGCCCATGANONE 
J080056F15GTGGCCCATGANONE 
J080056H07GTGGCCCATGANONE 
J080057M20GTGGCCCATGANONE 
J080059K09GTGGCCCATGANONE 
J080059M10GTGGCCCATGANONE 
J080060B12GTGGCCCATGANONE 
J080061N09GTGGCCCATGANONE 
J080062H11GTGGCCCATGANONE 
J080062M13GTGGCCCATGANONE 
J080063D14GTGGCCCATGANONE 
J080063G10GTGGCCCATGANONE 
J080063H18GTGGCCCATGANONE 
J080066J23GTGGCCCATGANONE 
J080067J06GTGGCCCATGANONE 
J080069I11GTGGCCCATGANONE 
J080069O22GTGGCCCATGANONE 
J080070P11GTGGCCCATGANONE 
J080072D06GTGGCCCATGANONE 
J080072J22GTGGCCCATGANONE 
J080075A20GTGGCCCATGANONE 
J080076F11GTGGCCCATGANONE 
J080076J24GTGGCCCATGANONE 
J080076K05GTGGCCCATGANONE 
J080077O10GTGGCCCATGANONE 
J080078L19GTGGCCCATGANONE 
J080080I08GTGGCCCATGANONE 
J080081J23GTGGCCCATGANONE 
J080083A17GTGGCCCATGANONE 
J080085C05GTGGCCCATGANONE 
J080086G24GTGGCCCATGANONE 
J080087H02GTGGCCCATGANONE 
J080089A13GTGGCCCATGANONE 
J080090K08GTGGCCCATGANONE 
J080092M01GTGGCCCATGANONE 
J080095A19GTGGCCCATGANONE 
J080095B20GTGGCCCATGANONE 
J100028F13GTGGCCCATGANONE 
J100040G22GTGGCCCATGANONE 
Os02g0146700AK105609TTTTGGGCCACSimilar to PSMD2 subunit (Fragment). 
AK119490TTTTGGGCCACNONE 
AK121963TTTTGGGCCACNONE 
Os02g0177500009-106-B06AAATGGGCTGTGGCCCATCGNONE 
AK062715AAATGGGCTGTGGCCCATCGSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
J065049F10AAATGGGCTGTGGCCCATCGNONE 
J065063L16AAATGGGCTGTGGCCCATCGNONE 
J065102P06AAATGGGCTGTGGCCCATCGNONE 
J065137A16AAATGGGCTGTGGCCCATCGNONE 
J065212M11AAATGGGCTGTGGCCCATCGNONE 
Os02g0190950J075001E02GTGGCCCACCCConserved hypothetical protein. 
J075117E23GTGGCCCACCCNONE 
J075117F23GTGGCCCACCCNONE 
J075144M12GTGGCCCACCCNONE 
J075145H10GTGGCCCACCCNONE 
J075186B15GTGGCCCACCCNONE 
Os02g0288200AK073147GTGGCCCATTTNONE 
Os02g0289700009-196-H06GTGGCCCAATANONE 
009-196-H06GTGGCCCAATAGTGTGGGCNONE 
014-005-D09GTGGCCCAATANONE 
014-005-D09GTGGCCCAATAGTGTGGGCNONE 
AK063231GTGGCCCAATASimilar to Glyceraldehyde-3-phosphate dehydrogenase, testis-specific (EC 1.2.1.12) (Spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase-2) (GAPDH-2). 
AK063231GTGGCCCAATAGTGTGGGCSimilar to Glyceraldehyde-3-phosphate dehydrogenase, testis-specific (EC 1.2.1.12) (Spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase-2) (GAPDH-2). 
Os02g0467200014-053-H06GTGGCCCATTNONE 
AK063704GTGGCCCATTConserved hypothetical protein. 
J065197J05GTGGCCCATTNONE 
Os02g0499300AK106994CTGGCCCACCAACCGTGGGCCACConserved hypothetical protein. 
Os02g0543200AK100963GTGGCCCAAGCyclin-like F-box domain containing protein. 
Os02g0564100006-072-A11CCGTGGGCCACNONE 
AK073526CCGTGGGCCACSimilar to EL3 protein. 
AK105951CCGTGGGCCACNONE 
J100045C15CCGTGGGCCACNONE 
Os02g0566000AK059295ATTGGGCCACGTGGCGConserved hypothetical protein. 
J065115K07ATTGGGCCACGTGGCGNONE 
Os02g0580900AK120486GTGGCCCAAAATGF-beta receptor, type I/II extracellular region family protein. 
J100082N03GTGGCCCAAAANONE 
Os02g0591800AK060611ATATGGGCCGTGGTGGCCCATTBrix domain containing protein. 
AK102534ATATGGGCCGTGGTGGCCCATTNONE 
J075057H08ATATGGGCCGTGGTGGCCCATTNONE 
J075179P18ATATGGGCCGTGGTGGCCCATTNONE 
J080011H01ATATGGGCCGTGGTGGCCCATTNONE 
J080018E14ATATGGGCCGTGGTGGCCCATTNONE 
J080026N17ATATGGGCCGTGGTGGCCCATTNONE 
J080047A13ATATGGGCCGTGGTGGCCCATTNONE 
J080049C17ATATGGGCCGTGGTGGCCCATTNONE 
J080050G07ATATGGGCCGTGGTGGCCCATTNONE 
J080064D10ATATGGGCCGTGGTGGCCCATTNONE 
J080080A03ATATGGGCCGTGGTGGCCCATTNONE 
J080080G20ATATGGGCCGTGGTGGCCCATTNONE 
J080080I03ATATGGGCCGTGGTGGCCCATTNONE 
J080081H12ATATGGGCCGTGGTGGCCCATTNONE 
J080090K07ATATGGGCCGTGGTGGCCCATTNONE 
J080092O06ATATGGGCCGTGGTGGCCCATTNONE 
J080096B07ATATGGGCCGTGGTGGCCCATTNONE 
J080097M08ATATGGGCCGTGGTGGCCCATTNONE 
Os02g0593500AK067498GCTGGGCCACPhosphate transporter family protein. 
AK104702GCTGGGCCACNONE 
Os02g0601500016-057-F12GTGGCCCATTANONE 
J075091F02GTGGCCCATTACytochrome P450 family protein. 
Os02g0626100003-107-B06CAGGTGGGCCACGCGTCGCGNONE 
AK120127CAGGTGGGCCACGCGTCGCGNONE 
Os02g0655300006-024-H05CCATGGGCCACNONE 
006-032-G04CCATGGGCCACNONE 
006-045-F03CCATGGGCCACNONE 
006-076-D04CCATGGGCCACNONE 
006-086-C09CCATGGGCCACNONE 
006-104-C07CCATGGGCCACNONE 
AK061544CCATGGGCCACNONE 
AK103778CCATGGGCCACNONE 
AK106107CCATGGGCCACNONE 
AK120006CCATGGGCCACNONE 
AY363174CCATGGGCCACSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21CCATGGGCCACNONE 
J065021C16CCATGGGCCACNONE 
J065182F01CCATGGGCCACNONE 
J075063I18CCATGGGCCACNONE 
J075151E01CCATGGGCCACNONE 
J075198K18CCATGGGCCACNONE 
J090026M06CCATGGGCCACNONE 
J090081H02CCATGGGCCACNONE 
J100061E20CCATGGGCCACNONE 
Os02g0665400AK073914CTTGGGCCACNONE 
AK073914TCATGGGCCACNONE 
AK109787CTTGGGCCACNONE 
AK109787TCATGGGCCACNONE 
AK120141CTTGGGCCACSimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
AK120141TCATGGGCCACSimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19CTTGGGCCACNONE 
J065021I19TCATGGGCCACNONE 
J075165B08CTTGGGCCACNONE 
J075165B08TCATGGGCCACNONE 
J075177B03CTTGGGCCACNONE 
J075177B03TCATGGGCCACNONE 
J075191K02CTTGGGCCACNONE 
J075191K02TCATGGGCCACNONE 
J090051I12CTTGGGCCACNONE 
J090051I12TCATGGGCCACNONE 
J090057E21CTTGGGCCACNONE 
J090057E21TCATGGGCCACNONE 
J090058E01CTTGGGCCACNONE 
J090058E01TCATGGGCCACNONE 
J090087C06CTTGGGCCACNONE 
J090087C06TCATGGGCCACNONE 
J100025K07CTTGGGCCACNONE 
J100025K07TCATGGGCCACNONE 
J100026I21CTTGGGCCACNONE 
J100026I21TCATGGGCCACNONE 
J100041E12CTTGGGCCACNONE 
J100041E12TCATGGGCCACNONE 
J100083B01CTTGGGCCACNONE 
J100083B01TCATGGGCCACNONE 
Os02g0686300AK066567GTGGCCCATCTConserved hypothetical protein. 
Os02g0697200015-013-B10ATTGGGCCACNONE 
AK059475ATTGGGCCACNONE 
AK102993ATTGGGCCACConserved hypothetical protein. 
J033079I18ATTGGGCCACNONE 
J033082A14ATTGGGCCACNONE 
J065047H08ATTGGGCCACNONE 
J065131M14ATTGGGCCACNONE 
Os02g0725100AK071759ACTGACAGGTGTGGCCCACTNONE 
Os02g0729400J075028G02GTGGCCCAGANONE 
Os02g0741100AK068712TGTGGGCCACSimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK071144TGTGGGCCACNONE 
J065056A02TGTGGGCCACNONE 
J065212F10TGTGGGCCACNONE 
J080005J10TGTGGGCCACNONE 
J080013A11TGTGGGCCACNONE 
J080015E01TGTGGGCCACNONE 
J080022G23TGTGGGCCACNONE 
J080025C13TGTGGGCCACNONE 
J080026P14TGTGGGCCACNONE 
J080027D22TGTGGGCCACNONE 
J080027G13TGTGGGCCACNONE 
J080027L23TGTGGGCCACNONE 
J080027N23TGTGGGCCACNONE 
J080028F21TGTGGGCCACNONE 
J080028J18TGTGGGCCACNONE 
J080028P22TGTGGGCCACNONE 
J080038P04TGTGGGCCACNONE 
J080042M11TGTGGGCCACNONE 
J080043B19TGTGGGCCACNONE 
J080045J23TGTGGGCCACNONE 
J080047B06TGTGGGCCACNONE 
J080052F04TGTGGGCCACNONE 
J080057F01TGTGGGCCACNONE 
J080057G03TGTGGGCCACNONE 
J080060H12TGTGGGCCACNONE 
J080061L12TGTGGGCCACNONE 
J080062J17TGTGGGCCACNONE 
J080062M22TGTGGGCCACNONE 
J080072C01TGTGGGCCACNONE 
J080075F01TGTGGGCCACNONE 
J080076A09TGTGGGCCACNONE 
J080076I01TGTGGGCCACNONE 
J080077D01TGTGGGCCACNONE 
J080077F19TGTGGGCCACNONE 
J080079L19TGTGGGCCACNONE 
J080088B03TGTGGGCCACNONE 
J080090J15TGTGGGCCACNONE 
J080092J21TGTGGGCCACNONE 
J080095J12TGTGGGCCACNONE 
J090012C05TGTGGGCCACNONE 
J090039K19TGTGGGCCACNONE 
J090078L12TGTGGGCCACNONE 
Os02g0773200AK108499ACTGGGCCACUniversal stress protein (Usp) family protein. 
J075062A04ACTGGGCCACNONE 
J075150C10ACTGGGCCACNONE 
J090086A09ACTGGGCCACNONE 
Os02g0792800AK105616GCGTGGGCCACSimilar to Rieske iron-sulfur protein Tic55 precursor. 
AK120704GCGTGGGCCACNONE 
J075134O14GCGTGGGCCACNONE 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0795200AK059349AACTGGGCCACConserved hypothetical protein. 
Os02g0795900012-075-B04AATGGGCCACCGCACNONE 
AK105305AATGGGCCACCGCACSimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21AATGGGCCACCGCACNONE 
Os02g0796900009-121-E06AAATGGGCCACNONE 
D29725AAATGGGCCACSimilar to 60S ribosomal protein L39. 
J075016N24AAATGGGCCACNONE 
J075085F03AAATGGGCCACNONE 
J075147P11AAATGGGCCACNONE 
J075180E16AAATGGGCCACNONE 
J075182A19AAATGGGCCACNONE 
Os02g0798300AK120999GTGGCCCATGAConserved hypothetical protein. 
Os02g0812500AK106918GTGGCGTGGGCCACCyclin-like F-box domain containing protein. 
Os02g0814300AK111376ATTTGGGCCACCytochrome c, monohaem domain containing protein. 
J065063I24ATTTGGGCCACNONE 
Os03g0139000006-059-C06GTATGGGCCACNONE 
009-055-F07GTATGGGCCACNONE 
AK060973GTATGGGCCACConserved hypothetical protein. 
AK103850GTATGGGCCACNONE 
Os03g0151800AK064955CGCGTGGGCCACNONE 
AK098874CGCGTGGGCCACNONE 
AK098980CGCGTGGGCCACNONE 
AK099712CGCGTGGGCCACNONE 
AK099889CGCGTGGGCCACNONE 
AK121641CGCGTGGGCCACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05CGCGTGGGCCACNONE 
J013001D04CGCGTGGGCCACNONE 
J013121O12CGCGTGGGCCACNONE 
Os03g0159700012-100-B09GTGACGTGTGGCCCATACNONE 
AK063559GTGACGTGTGGCCCATACProtein prenyltransferase domain containing protein. 
J065197I24GTGACGTGTGGCCCATACNONE 
J090089G20GTGACGTGTGGCCCATACNONE 
Os03g0232500AK110980TTTTGGGCCACGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TTTTGGGCCACNONE 
Os03g0249200009-103-B08GTGGCCCACACNONE 
AK069944GTGGCCCACACClass I peptide chain release factor domain containing protein. 
J065166E13GTGGCCCACACNONE 
Os03g0249900AK058379ATATGGGCCACConserved hypothetical protein. 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
Os03g0275700AK111329GTGGCCCACGCConserved hypothetical protein. 
Os03g0275900AK109303GTGGCCCACTNONE 
AK121978GTGGCCCACTSimilar to Spotted leaf protein 11 (Spotted leaf11) (Cell death-related protein SPL11). 
Os03g0277000AK100522GTGGCCCACGGSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0284500012-066-D02GTGGCCCACATGTCAGTGNONE 
AK105295GTGGCCCACATGTCAGTGNONE 
AK121300GTGGCCCACATGTCAGTGHAD-superfamily subfamily IIA hydrolase, CECR5 protein. 
Os03g0284600AK110712CACTGACATGTGGGCCACThioredoxin fold domain containing protein. 
Os03g0302700006-099-F12ATTGGGCCACNONE 
AK112010ATTGGGCCACZinc finger, RING-type domain containing protein. 
AK121656ATTGGGCCACNONE 
J075090A19ATTGGGCCACNONE 
J075148M06ATTGGGCCACNONE 
Os03g0310800009-126-C10CACGTGGGCCACNONE 
009-156-D02CACGTGGGCCACNONE 
AK058663CACGTGGGCCACNONE 
AK099476CACGTGGGCCACSimilar to Hypersensitive reaction associated Ca2+-binding protein. 
J065084G15CACGTGGGCCACNONE 
J075046C12CACGTGGGCCACNONE 
J075058D24CACGTGGGCCACNONE 
J075151M03CACGTGGGCCACNONE 
J075151M04CACGTGGGCCACNONE 
J075153I20CACGTGGGCCACNONE 
J075167J05CACGTGGGCCACNONE 
J075179G06CACGTGGGCCACNONE 
J100025I19CACGTGGGCCACNONE 
J100025L21CACGTGGGCCACNONE 
J100029C06CACGTGGGCCACNONE 
J100068E24CACGTGGGCCACNONE 
J100070F10CACGTGGGCCACNONE 
J100083H23CACGTGGGCCACNONE 
J100089H10CACGTGGGCCACNONE 
Os03g0321800006-065-G02GTGGCCCATTTNONE 
AK061075GTGGCCCATTTNONE 
AK111447GTGGCCCATTTSimilar to WRKY transcription factor 55. 
J065122E07GTGGCCCATTTNONE 
J065187N05GTGGCCCATTTNONE 
J065214K09GTGGCCCATTTNONE 
J090050M01GTGGCCCATTTNONE 
Os03g0324900014-018-F11GTGGCCCATGANONE 
AK068144GTGGCCCATGAZinc finger, RING-type domain containing protein. 
Os03g0342900006-032-D01AGGTGGGCCACCCCACGTGNONE 
006-033-E10AGGTGGGCCACCCCACGTGNONE 
006-051-G06AGGTGGGCCACCCCACGTGNONE 
006-053-E05AGGTGGGCCACCCCACGTGNONE 
006-056-B05AGGTGGGCCACCCCACGTGNONE 
006-058-F04AGGTGGGCCACCCCACGTGNONE 
006-059-E05AGGTGGGCCACCCCACGTGNONE 
006-060-F10AGGTGGGCCACCCCACGTGNONE 
006-104-D12AGGTGGGCCACCCCACGTGNONE 
009-129-C12AGGTGGGCCACCCCACGTGNONE 
AK060136AGGTGGGCCACCCCACGTGNONE 
AK060980AGGTGGGCCACCCCACGTGNONE 
AK064815AGGTGGGCCACCCCACGTGDormancyauxin associated family protein. 
AK104244AGGTGGGCCACCCCACGTGNONE 
AK104391AGGTGGGCCACCCCACGTGNONE 
AK104590AGGTGGGCCACCCCACGTGNONE 
AK104744AGGTGGGCCACCCCACGTGNONE 
AK106100AGGTGGGCCACCCCACGTGNONE 
J013000E10AGGTGGGCCACCCCACGTGNONE 
J075027O22AGGTGGGCCACCCCACGTGNONE 
J075052J03AGGTGGGCCACCCCACGTGNONE 
J075066E15AGGTGGGCCACCCCACGTGNONE 
J075095C17AGGTGGGCCACCCCACGTGNONE 
J075118N05AGGTGGGCCACCCCACGTGNONE 
J075187K22AGGTGGGCCACCCCACGTGNONE 
J090026L04AGGTGGGCCACCCCACGTGNONE 
J090059G16AGGTGGGCCACCCCACGTGNONE 
J100055P20AGGTGGGCCACCCCACGTGNONE 
J100062A10AGGTGGGCCACCCCACGTGNONE 
J100068G20AGGTGGGCCACCCCACGTGNONE 
Os03g0345100AK065579TATTGGGCCACRad9 family protein. 
J100033H02TATTGGGCCACNONE 
Os03g0360500009-103-B05ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK059166ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK101285ATTTGGGCCCAAAGTGGCCCAGTProtein of unknown function DUF1077 family protein. 
J033061G19ATTTGGGCCCAAAGTGGCCCAGTNONE 
J065169P12ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075104C18ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075166G07ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075170J04ATTTGGGCCCAAAGTGGCCCAGTNONE 
Os03g0405000AK070839GTGGCCCAATReticulon family protein. 
Os03g0607200013-002-F05GCGTGGGCCACNONE 
013-021-H08GCGTGGGCCACNONE 
013-038-E10GCGTGGGCCACNONE 
014-009-E05GCGTGGGCCACNONE 
014-034-H01GCGTGGGCCACNONE 
014-038-A08GCGTGGGCCACNONE 
014-072-G08GCGTGGGCCACNONE 
014-083-B06GCGTGGGCCACNONE 
014-088-G10GCGTGGGCCACNONE 
AK070268GCGTGGGCCACGibberellin regulated protein family protein. 
J023044E14GCGTGGGCCACNONE 
J065199F02GCGTGGGCCACNONE 
J075001C09GCGTGGGCCACNONE 
J075019F02GCGTGGGCCACNONE 
J075061J21GCGTGGGCCACNONE 
J075068G03GCGTGGGCCACNONE 
J075126F10GCGTGGGCCACNONE 
J075153F19GCGTGGGCCACNONE 
J080305I04GCGTGGGCCACNONE 
J080307F24GCGTGGGCCACNONE 
J080312E23GCGTGGGCCACNONE 
J080315M20GCGTGGGCCACNONE 
J080317E18GCGTGGGCCACNONE 
J090043I11GCGTGGGCCACNONE 
Os03g0646300AK069229GTGGCCCATGTSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0698900013-074-A08TCGTGGGCCACGTCNONE 
AK073303TCGTGGGCCACGTCAlkaline phytoceramidase family protein. 
AK103953TCGTGGGCCACGTCNONE 
J033024P22TCGTGGGCCACGTCNONE 
J065194N16TCGTGGGCCACGTCNONE 
J065195O11TCGTGGGCCACGTCNONE 
J075020F03TCGTGGGCCACGTCNONE 
J075032P18TCGTGGGCCACGTCNONE 
J075037H13TCGTGGGCCACGTCNONE 
J075147I01TCGTGGGCCACGTCNONE 
J075187B13TCGTGGGCCACGTCNONE 
J100043G08TCGTGGGCCACGTCNONE 
J100060L06TCGTGGGCCACGTCNONE 
J100063O21TCGTGGGCCACGTCNONE 
J100066O13TCGTGGGCCACGTCNONE 
J100072K20TCGTGGGCCACGTCNONE 
J100083G21TCGTGGGCCACGTCNONE 
J100085D07TCGTGGGCCACGTCNONE 
Os03g0701700011-034-E06CCCGTGGGCCACNONE 
AF013979CCCGTGGGCCACNONE 
AK065161CCCGTGGGCCACSimilar to Ethylene receptor. 
AK067813CCCGTGGGCCACNONE 
J013002C04CCCGTGGGCCACNONE 
J013035M07CCCGTGGGCCACNONE 
J013049B10CCCGTGGGCCACNONE 
J013065F11CCCGTGGGCCACNONE 
J013072K18CCCGTGGGCCACNONE 
J013073P08CCCGTGGGCCACNONE 
J013098F08CCCGTGGGCCACNONE 
J013154M13CCCGTGGGCCACNONE 
J023001H02CCCGTGGGCCACNONE 
J023003D16CCCGTGGGCCACNONE 
J023014P17CCCGTGGGCCACNONE 
J023036A22CCCGTGGGCCACNONE 
J023038N01CCCGTGGGCCACNONE 
J023042E11CCCGTGGGCCACNONE 
J023058O05CCCGTGGGCCACNONE 
J023084D05CCCGTGGGCCACNONE 
J023088O17CCCGTGGGCCACNONE 
J023138O11CCCGTGGGCCACNONE 
J023147A10CCCGTGGGCCACNONE 
J033029G18CCCGTGGGCCACNONE 
J033031N13CCCGTGGGCCACNONE 
J033090D09CCCGTGGGCCACNONE 
J033091I06CCCGTGGGCCACNONE 
J033096B20CCCGTGGGCCACNONE 
J033101A19CCCGTGGGCCACNONE 
J033135D03CCCGTGGGCCACNONE 
J043001L13CCCGTGGGCCACNONE 
J043020A13CCCGTGGGCCACNONE 
J053071K24CCCGTGGGCCACNONE 
J053092L14CCCGTGGGCCACNONE 
J053099F19CCCGTGGGCCACNONE 
J065009P22CCCGTGGGCCACNONE 
J065046A22CCCGTGGGCCACNONE 
J065099K22CCCGTGGGCCACNONE 
J065112O22CCCGTGGGCCACNONE 
J065119K11CCCGTGGGCCACNONE 
J065212B11CCCGTGGGCCACNONE 
J090022A11CCCGTGGGCCACNONE 
J090054F15CCCGTGGGCCACNONE 
J090076B20CCCGTGGGCCACNONE 
J090099M22CCCGTGGGCCACNONE 
J100032L01CCCGTGGGCCACNONE 
J100065H13CCCGTGGGCCACNONE 
Os03g0709000009-027-F11GTGGCCCAATANONE 
009-147-F02GTGGCCCAATANONE 
015-068-A04GTGGCCCAATANONE 
AK062406GTGGCCCAATAMembrane-associated proteins in eicosanoid and glutathione metabolism (MAPEG) family protein. 
Os03g0726900AK072553GGCCCGTTTGGGCCACConserved hypothetical protein. 
AK100280GGCCCGTTTGGGCCACNONE 
Os03g0746000AK073682GTGGCCCATTGGGCTGAConserved hypothetical protein. 
AK111472GTGGCCCATTGGGCTGANONE 
J090083F05GTGGCCCATTGGGCTGANONE 
Os03g0746600AK069559ACGTGGGCCACWD40-like domain containing protein. 
AK069559TAATGGGCCACWD40-like domain containing protein. 
J023141K22ACGTGGGCCACNONE 
J023141K22TAATGGGCCACNONE 
Os03g0757900011-060-H04GTGGCCCATGGNONE 
011-082-B10GTGGCCCATGGNONE 
012-053-F12GTGGCCCATGGNONE 
013-029-C07GTGGCCCATGGNONE 
AK098880GTGGCCCATGGSimilar to UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UDP-Glc dehydrogenase) (UDP-GlcDH) (UDPGDH). 
J023009B02GTGGCCCATGGNONE 
J023085H11GTGGCCCATGGNONE 
J023135M18GTGGCCCATGGNONE 
J023147P04GTGGCCCATGGNONE 
J033072J22GTGGCCCATGGNONE 
J033128J06GTGGCCCATGGNONE 
Os03g0758700AK106620GTGGCCCAACAWD40-like domain containing protein. 
Os03g0769600AK100054CCATGGGCCACResB-like family protein. 
Os03g0776900AK107941TATTGGGCCACATGGGCCTCSimilar to DNAJ protein-like. 
J053100E14TATTGGGCCACATGGGCCTCNONE 
J075111A12TATTGGGCCACATGGGCCTCNONE 
Os03g0793100AK067897GTTTGGGCCACGlycosyl transferase, family 43 protein. 
J033125G24GTTTGGGCCACNONE 
J065132N21GTTTGGGCCACNONE 
Os03g0811800AK063320ACTGGGCCACTAATGGGCTTGGRibosomal protein L36 family protein. 
J065094F18ACTGGGCCACTAATGGGCTTGGNONE 
J090029B04ACTGGGCCACTAATGGGCTTGGNONE 
Os03g0829100AK072669CCTGGGCCACSimilar to Soluble epoxide hydrolase. 
J013073C22CCTGGGCCACNONE 
J033067O15CCTGGGCCACNONE 
J065021D04CCTGGGCCACNONE 
J065102E20CCTGGGCCACNONE 
Os03g0846400AK067706CGATGGGCCACNONE 
AK070549CGATGGGCCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0852000009-105-G08TGTGGGCCACNONE 
AK063830TGTGGGCCACNONE 
AK100922TGTGGGCCACConserved hypothetical protein. 
J023133O06TGTGGGCCACNONE 
Os03g0855600006-029-G09GTGGCCCATGGNONE 
006-033-E02GTGGCCCATGGNONE 
006-069-G07GTGGCCCATGGNONE 
006-083-A02GTGGCCCATGGNONE 
006-098-H04GTGGCCCATGGNONE 
009-054-C04GTGGCCCATGGNONE 
AK060030GTGGCCCATGGNONE 
AK061467GTGGCCCATGGConserved hypothetical protein. 
AK067858GTGGCCCATGGNONE 
AK106030GTGGCCCATGGNONE 
J013123A10GTGGCCCATGGNONE 
J065001I24GTGGCCCATGGNONE 
J065015N21GTGGCCCATGGNONE 
J065016H07GTGGCCCATGGNONE 
J065040A05GTGGCCCATGGNONE 
J065040F01GTGGCCCATGGNONE 
J065066G17GTGGCCCATGGNONE 
J065077I09GTGGCCCATGGNONE 
J065099M22GTGGCCCATGGNONE 
J065135B13GTGGCCCATGGNONE 
J065144H19GTGGCCCATGGNONE 
J065146I03GTGGCCCATGGNONE 
J065169E02GTGGCCCATGGNONE 
J065177D21GTGGCCCATGGNONE 
J065189L20GTGGCCCATGGNONE 
J065207H13GTGGCCCATGGNONE 
J065210D24GTGGCCCATGGNONE 
J065212I03GTGGCCCATGGNONE 
J075007E21GTGGCCCATGGNONE 
J075013H07GTGGCCCATGGNONE 
J075023K06GTGGCCCATGGNONE 
J075031D23GTGGCCCATGGNONE 
J075038K09GTGGCCCATGGNONE 
J075084C08GTGGCCCATGGNONE 
J075098K20GTGGCCCATGGNONE 
J090028E04GTGGCCCATGGNONE 
J090031E20GTGGCCCATGGNONE 
J090042F06GTGGCCCATGGNONE 
J090049L05GTGGCCCATGGNONE 
J090086G03GTGGCCCATGGNONE 
J090096J04GTGGCCCATGGNONE 
J100035O03GTGGCCCATGGNONE 
J100053H24GTGGCCCATGGNONE 
J100056L17GTGGCCCATGGNONE 
J100058K06GTGGCCCATGGNONE 
J100059G09GTGGCCCATGGNONE 
J100081C15GTGGCCCATGGNONE 
Os04g0445100014-052-B04GTGGCCCACGANONE 
AK063700GTGGCCCACGASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0445200009-034-A06ATCTGGGCCACNONE 
AK062427ATCTGGGCCACProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720ATCTGGGCCACNONE 
J065022E20ATCTGGGCCACNONE 
J065062D16ATCTGGGCCACNONE 
J065081I02ATCTGGGCCACNONE 
J065087C10ATCTGGGCCACNONE 
J065116N16ATCTGGGCCACNONE 
J065132F10ATCTGGGCCACNONE 
J065140F18ATCTGGGCCACNONE 
J065143M22ATCTGGGCCACNONE 
J065158K17ATCTGGGCCACNONE 
J065162D07ATCTGGGCCACNONE 
J065207H19ATCTGGGCCACNONE 
J075155B20ATCTGGGCCACNONE 
J075167E24ATCTGGGCCACNONE 
J075178B19ATCTGGGCCACNONE 
J080301D22ATCTGGGCCACNONE 
J080301J15ATCTGGGCCACNONE 
J080308J02ATCTGGGCCACNONE 
Os04g0462900006-094-A02AATGGGCCACCACCTGTCNONE 
006-097-F05AATGGGCCACCACCTGTCNONE 
009-129-A10AATGGGCCACCACCTGTCNONE 
015-042-F07AATGGGCCACCACCTGTCNONE 
AK058481AATGGGCCACCACCTGTCNONE 
AK059483AATGGGCCACCACCTGTCNONE 
AK061324AATGGGCCACCACCTGTCNONE 
AK099100AATGGGCCACCACCTGTCNONE 
AK102579AATGGGCCACCACCTGTCNONE 
AK106322AATGGGCCACCACCTGTCSimilar to Prohibitin. 
J065059J20AATGGGCCACCACCTGTCNONE 
J065085I02AATGGGCCACCACCTGTCNONE 
J065118N23AATGGGCCACCACCTGTCNONE 
J065208K24AATGGGCCACCACCTGTCNONE 
J075053B14AATGGGCCACCACCTGTCNONE 
J075097M22AATGGGCCACCACCTGTCNONE 
J075184B07AATGGGCCACCACCTGTCNONE 
J075194A15AATGGGCCACCACCTGTCNONE 
J080315G03AATGGGCCACCACCTGTCNONE 
J090088H19AATGGGCCACCACCTGTCNONE 
Os04g0531300016-006-E10TGGTGGGCCACNONE 
AK072647TGGTGGGCCACDihydrouridine synthase, DuS family protein. 
AK103911TGGTGGGCCACNONE 
J013038P22TGGTGGGCCACNONE 
J023130D01TGGTGGGCCACNONE 
J033150P13TGGTGGGCCACNONE 
J043026L14TGGTGGGCCACNONE 
J065049A08TGGTGGGCCACNONE 
J065215C17TGGTGGGCCACNONE 
Os04g0556300009-065-A04CGCGTGGGCCACACGNONE 
009-124-C05CGCGTGGGCCACACGNONE 
AK062772CGCGTGGGCCACACGGlutathione peroxidase. 
AY100689CGCGTGGGCCACACGNONE 
J065008N06CGCGTGGGCCACACGNONE 
J065012C13CGCGTGGGCCACACGNONE 
J065017J06CGCGTGGGCCACACGNONE 
J065033M15CGCGTGGGCCACACGNONE 
J065086O21CGCGTGGGCCACACGNONE 
J065102K04CGCGTGGGCCACACGNONE 
J065141D21CGCGTGGGCCACACGNONE 
J065159K20CGCGTGGGCCACACGNONE 
J065164C12CGCGTGGGCCACACGNONE 
J065170F10CGCGTGGGCCACACGNONE 
J065181F20CGCGTGGGCCACACGNONE 
J065205N07CGCGTGGGCCACACGNONE 
J065209N21CGCGTGGGCCACACGNONE 
J075001M12CGCGTGGGCCACACGNONE 
J075007D22CGCGTGGGCCACACGNONE 
J075026H04CGCGTGGGCCACACGNONE 
J075042O08CGCGTGGGCCACACGNONE 
J075044G20CGCGTGGGCCACACGNONE 
J075057D10CGCGTGGGCCACACGNONE 
J075096L23CGCGTGGGCCACACGNONE 
J075104K12CGCGTGGGCCACACGNONE 
J075119H14CGCGTGGGCCACACGNONE 
J075136C14CGCGTGGGCCACACGNONE 
J075172D01CGCGTGGGCCACACGNONE 
J075184M01CGCGTGGGCCACACGNONE 
J075186E06CGCGTGGGCCACACGNONE 
J075192M08CGCGTGGGCCACACGNONE 
J080006D18CGCGTGGGCCACACGNONE 
J080044G16CGCGTGGGCCACACGNONE 
J080087G15CGCGTGGGCCACACGNONE 
J100021I05CGCGTGGGCCACACGNONE 
J100039D10CGCGTGGGCCACACGNONE 
J100073B05CGCGTGGGCCACACGNONE 
J100074M12CGCGTGGGCCACACGNONE 
Os04g0610500006-115-C07AATGGGCCACNONE 
AK066289AATGGGCCACPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817AATGGGCCACNONE 
J013096N09AATGGGCCACNONE 
J023054I11AATGGGCCACNONE 
J023121P20AATGGGCCACNONE 
J053039O20AATGGGCCACNONE 
J053071L20AATGGGCCACNONE 
J053088H23AATGGGCCACNONE 
J053096J03AATGGGCCACNONE 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
Os04g0640800AK065522GTGGCCCACGTGProgrammed cell death protein 2, C-terminal domain containing protein. 
AK065522GTGGCCCAGAProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0665700013-084-D06GTGGCCCAAAGCCCAAGNONE 
AK121951GTGGCCCAAAGCCCAAGZinc finger, CCCH-type domain containing protein. 
J013020L20GTGGCCCAAAGCCCAAGNONE 
J033034K12GTGGCCCAAAGCCCAAGNONE 
J033107K04GTGGCCCAAAGCCCAAGNONE 
J065044C03GTGGCCCAAAGCCCAAGNONE 
J065103I10GTGGCCCAAAGCCCAAGNONE 
J065106P15GTGGCCCAAAGCCCAAGNONE 
J075061O20GTGGCCCAAAGCCCAAGNONE 
J075091P11GTGGCCCAAAGCCCAAGNONE 
J075095A18GTGGCCCAAAGCCCAAGNONE 
J075117C22GTGGCCCAAAGCCCAAGNONE 
J075166B22GTGGCCCAAAGCCCAAGNONE 
J075198L04GTGGCCCAAAGCCCAAGNONE 
J090032K13GTGGCCCAAAGCCCAAGNONE 
J090045E22GTGGCCCAAAGCCCAAGNONE 
Os05g0111200009-033-A06ACGCGTGGGCCACNONE 
AK101693ACGCGTGGGCCACSimilar to Amino acid selective channel protein. 
J065006E13ACGCGTGGGCCACNONE 
J075001D12ACGCGTGGGCCACNONE 
J075005J18ACGCGTGGGCCACNONE 
J075009L08ACGCGTGGGCCACNONE 
J075012M21ACGCGTGGGCCACNONE 
J075019K17ACGCGTGGGCCACNONE 
J075020D07ACGCGTGGGCCACNONE 
J075041D11ACGCGTGGGCCACNONE 
J075051C03ACGCGTGGGCCACNONE 
J075060C05ACGCGTGGGCCACNONE 
J075079N09ACGCGTGGGCCACNONE 
J075094B04ACGCGTGGGCCACNONE 
J075108E08ACGCGTGGGCCACNONE 
J075115G05ACGCGTGGGCCACNONE 
J075147L21ACGCGTGGGCCACNONE 
J075161G12ACGCGTGGGCCACNONE 
J075168J11ACGCGTGGGCCACNONE 
J075168L11ACGCGTGGGCCACNONE 
J075174F22ACGCGTGGGCCACNONE 
Os05g0122700J065185N19GCCACGTGGCCCAACTNONE 
J065188N05GCCACGTGGCCCAACTNONE 
J065198E09GCCACGTGGCCCAACTNONE 
J065215H08GCCACGTGGCCCAACTSimilar to Low-temperature induced protein lt101.2. 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0152400Os05g0152400AAATGGGCCACGlycosyl transferase, family 14 protein. 
Os05g0182800AK121273TAATGGGCCAAGTGGCCCAATGlutamyl-tRNA synthetase, class Ic family protein. 
Os05g0198700Os05g0198700TTTGGGCCACREX1 DNA Repair family protein. 
Os05g0350500013-071-D05GTGGCCCACCCNONE 
AF020787GTGGCCCACCCNONE 
AK061712GTGGCCCACCCNONE 
AK102897GTGGCCCACCCProliferation-associated protein 1 family protein. 
J033060G23GTGGCCCACCCNONE 
J033112P14GTGGCCCACCCNONE 
J033127J04GTGGCCCACCCNONE 
J090015L18GTGGCCCACCCNONE 
J090047K03GTGGCCCACCCNONE 
J090097J17GTGGCCCACCCNONE 
Os05g0395300AK066212GTGGCCCACCCProtein of unknown function DUF21 domain containing protein. 
Os05g0415600AK065818GTGGCCCACAAACTGGGCCCTNONE 
J013042K21GTGGCCCACAAACTGGGCCCTNONE 
J013114E15GTGGCCCACAAACTGGGCCCTNONE 
J013131H02GTGGCCCACAAACTGGGCCCTNONE 
J023041G06GTGGCCCACAAACTGGGCCCTNONE 
J100037M21GTGGCCCACAAACTGGGCCCTNONE 
Os05g0417200AK071955ATTTGGGCCACAATGGGCCTTGCGGGCCThioredoxin-like fold domain containing protein. 
AK071955TAATGGGCCACGATGGGCCTTThioredoxin-like fold domain containing protein. 
Os05g0429700AK069203GTGGCCCACANONE 
AK103559GTGGCCCACAC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0451300AK108341AGTGGGCCACCTCGCCCGGCCCAACCConserved hypothetical protein. 
Os05g0456000AK058420GCGTGGGCGTGTGGCCCAAAAMitochondrial glycoprotein family protein. 
AK102036GCGTGGGCGTGTGGCCCAAAANONE 
J065066F02GCGTGGGCGTGTGGCCCAAAANONE 
Os05g0456300006-096-G05GTGGCCCATGGNONE 
006-108-F09GTGGCCCATGGNONE 
AK061843GTGGCCCATGGNONE 
AK068616GTGGCCCATGGSimilar to Aldose reductase. 
J013156J23GTGGCCCATGGNONE 
J023080O21GTGGCCCATGGNONE 
J043031L21GTGGCCCATGGNONE 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0486200009-099-B03CCTGGGCCACNONE 
AK121022CCTGGGCCACConserved hypothetical protein. 
J023049I09CCTGGGCCACNONE 
J033029N07CCTGGGCCACNONE 
J075074I18CCTGGGCCACNONE 
Os05g0496500011-012-D10ATTGGGCCACNONE 
AK073261ATTGGGCCACSimilar to Latex-abundant protein. 
AY224533ATTGGGCCACNONE 
Os05g0506000AF031609CGTGTGGCCCATCGNONE 
AK062012CGTGTGGCCCATCGNONE 
AK098900CGTGTGGCCCATCGNONE 
AK122090CGTGTGGCCCATCGSimilar to MS5-like protein (Fragment). 
J013002B13CGTGTGGCCCATCGNONE 
J023149G13CGTGTGGCCCATCGNONE 
J033123O20CGTGTGGCCCATCGNONE 
J080315O17CGTGTGGCCCATCGNONE 
Os05g0521700AK070182ATTGGGCCACGTGGCGConserved hypothetical protein. 
J013170O04ATTGGGCCACGTGGCGNONE 
J023045H17ATTGGGCCACGTGGCGNONE 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
Os05g0545500AK101095AACTGGGCCACConserved hypothetical protein. 
AK119499AACTGGGCCACNONE 
Os05g0564400006-023-A05GTGGCCCAACCNONE 
AK073075GTGGCCCAACCSimilar to GTP-binding protein. 
AK109344GTGGCCCAACCNONE 
Os05g0566500AK073468CGTGTGGGCCACNONE 
AK099052CGTGTGGGCCACSimilar to Initiation factor 3d (Fragment). 
AK104093CGTGTGGGCCACNONE 
J090025I18CGTGTGGGCCACNONE 
Os05g0568600009-024-B09GTGGCCCACCNONE 
009-024-B09GTGGCCCACCTNONE 
AK063781GTGGCCCACCProtein of unknown function DUF1645 family protein. 
AK063781GTGGCCCACCTProtein of unknown function DUF1645 family protein. 
J080049H14GTGGCCCACCNONE 
J080049H14GTGGCCCACCTNONE 
J080062M08GTGGCCCACCNONE 
J080062M08GTGGCCCACCTNONE 
J080064I07GTGGCCCACCNONE 
J080064I07GTGGCCCACCTNONE 
J080068A12GTGGCCCACCNONE 
J080068A12GTGGCCCACCTNONE 
J080086J10GTGGCCCACCNONE 
J080086J10GTGGCCCACCTNONE 
Os05g0571400009-019-B04GTGGCCCAGATNONE 
009-043-H02GTGGCCCAGATNONE 
AK062369GTGGCCCAGATConserved hypothetical protein. 
Os05g0589000AK061980GTGGCCCACCANONE 
AK099181GTGGCCCACCAConserved hypothetical protein. 
Os06g0103200011-003-H09TGTTGGGCCACCAACNONE 
011-017-H05TGTTGGGCCACCAACNONE 
011-027-G08TGTTGGGCCACCAACNONE 
011-059-F08TGTTGGGCCACCAACNONE 
AK103757TGTTGGGCCACCAACTransferase family protein. 
J033143E17TGTTGGGCCACCAACNONE 
Os06g0128400AK064390GTGGCCCACCNONE 
AK121983GTGGCCCACCWD40-like domain containing protein. 
Os06g0130000AK064427GTGGCCCACTNONE 
AK070084GTGGCCCACTNONE 
AK119321GTGGCCCACTSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment). 
Os06g0246500AK105105ATCTGGGCCACSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0291600AK100261GACACGTGGGCCACSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
J023063D14GACACGTGGGCCACNONE 
J090041B12GACACGTGGGCCACNONE 
Os06g0320500004-013-F05GATCCGACGTGGCCCAATNONE 
006-021-B06GATCCGACGTGGCCCAATNONE 
006-021-D12GATCCGACGTGGCCCAATNONE 
006-022-A12GATCCGACGTGGCCCAATNONE 
006-024-B10GATCCGACGTGGCCCAATNONE 
006-029-F07GATCCGACGTGGCCCAATNONE 
006-029-H12GATCCGACGTGGCCCAATNONE 
006-031-A05GATCCGACGTGGCCCAATNONE 
006-033-C03GATCCGACGTGGCCCAATNONE 
006-036-B12GATCCGACGTGGCCCAATNONE 
006-048-C08GATCCGACGTGGCCCAATNONE 
006-050-F03GATCCGACGTGGCCCAATNONE 
006-051-C12GATCCGACGTGGCCCAATNONE 
006-054-C03GATCCGACGTGGCCCAATNONE 
006-057-D12GATCCGACGTGGCCCAATNONE 
006-067-F01GATCCGACGTGGCCCAATNONE 
006-071-G12GATCCGACGTGGCCCAATNONE 
006-072-G11GATCCGACGTGGCCCAATNONE 
006-072-H01GATCCGACGTGGCCCAATNONE 
006-081-E02GATCCGACGTGGCCCAATNONE 
006-082-A11GATCCGACGTGGCCCAATNONE 
006-084-A04GATCCGACGTGGCCCAATNONE 
006-085-C08GATCCGACGTGGCCCAATNONE 
006-086-D03GATCCGACGTGGCCCAATNONE 
006-088-B05GATCCGACGTGGCCCAATNONE 
006-088-G02GATCCGACGTGGCCCAATNONE 
006-092-G10GATCCGACGTGGCCCAATNONE 
006-094-D11GATCCGACGTGGCCCAATNONE 
006-094-E04GATCCGACGTGGCCCAATNONE 
006-103-G12GATCCGACGTGGCCCAATNONE 
006-106-G08GATCCGACGTGGCCCAATNONE 
006-111-E06GATCCGACGTGGCCCAATNONE 
006-114-C07GATCCGACGTGGCCCAATNONE 
006-115-A04GATCCGACGTGGCCCAATNONE 
006-117-G11GATCCGACGTGGCCCAATNONE 
006-118-G09GATCCGACGTGGCCCAATNONE 
009-010-F03GATCCGACGTGGCCCAATNONE 
009-076-G01GATCCGACGTGGCCCAATNONE 
009-134-E10GATCCGACGTGGCCCAATNONE 
009-193-D07GATCCGACGTGGCCCAATNONE 
AF094776GATCCGACGTGGCCCAATNONE 
AK060904GATCCGACGTGGCCCAATSimilar to Light-harvesting complex I (Fragment). 
AK098864GATCCGACGTGGCCCAATNONE 
J013001A03GATCCGACGTGGCCCAATNONE 
J013098P14GATCCGACGTGGCCCAATNONE 
J013127B16GATCCGACGTGGCCCAATNONE 
J013169J24GATCCGACGTGGCCCAATNONE 
J023084H23GATCCGACGTGGCCCAATNONE 
J023093F05GATCCGACGTGGCCCAATNONE 
J033041I05GATCCGACGTGGCCCAATNONE 
J065196G15GATCCGACGTGGCCCAATNONE 
J075019K01GATCCGACGTGGCCCAATNONE 
J075053H16GATCCGACGTGGCCCAATNONE 
J075055M09GATCCGACGTGGCCCAATNONE 
J075099G10GATCCGACGTGGCCCAATNONE 
J075099L23GATCCGACGTGGCCCAATNONE 
J075127I09GATCCGACGTGGCCCAATNONE 
J080001C14GATCCGACGTGGCCCAATNONE 
J080016B11GATCCGACGTGGCCCAATNONE 
J080029C14GATCCGACGTGGCCCAATNONE 
J080029I17GATCCGACGTGGCCCAATNONE 
J080034F13GATCCGACGTGGCCCAATNONE 
J080039E02GATCCGACGTGGCCCAATNONE 
J080040N05GATCCGACGTGGCCCAATNONE 
J080042O17GATCCGACGTGGCCCAATNONE 
J080043N15GATCCGACGTGGCCCAATNONE 
J080056K02GATCCGACGTGGCCCAATNONE 
J080063N15GATCCGACGTGGCCCAATNONE 
J080069H05GATCCGACGTGGCCCAATNONE 
J080070N15GATCCGACGTGGCCCAATNONE 
J080075J22GATCCGACGTGGCCCAATNONE 
J080076F12GATCCGACGTGGCCCAATNONE 
J080086G05GATCCGACGTGGCCCAATNONE 
J090046G07GATCCGACGTGGCCCAATNONE 
J090059H01GATCCGACGTGGCCCAATNONE 
J090099C09GATCCGACGTGGCCCAATNONE 
J100028E12GATCCGACGTGGCCCAATNONE 
J100048J04GATCCGACGTGGCCCAATNONE 
J100054O05GATCCGACGTGGCCCAATNONE 
J100062C09GATCCGACGTGGCCCAATNONE 
J100075C17GATCCGACGTGGCCCAATNONE 
J100075C23GATCCGACGTGGCCCAATNONE 
J100075I23GATCCGACGTGGCCCAATNONE 
Os06g0498900AK065724GCCACGTGGCCCAATGTP-binding protein, HSR1-related domain containing protein. 
Os06g0539066J065210J16GTGGCCCAAAConserved hypothetical protein. 
Os06g0545800J023014L13CATGGGCCACNONE 
J023019D15CATGGGCCACNONE 
J023031O10CATGGGCCACNONE 
J023041K05CATGGGCCACNONE 
J023044D07CATGGGCCACNONE 
J023054D06CATGGGCCACNONE 
J023088I12CATGGGCCACNONE 
J023093O06CATGGGCCACNONE 
J023105M09CATGGGCCACNONE 
J023109C07CATGGGCCACSimilar to Exopolygalacturonase precursor (EC 3.2.1.67) (ExoPG) (Pectinase) (Galacturan 1,4-alpha-galacturonidase). 
J023135P03CATGGGCCACNONE 
Os06g0606800AK066355ACGTGGGCCACTargeting for Xklp2 family protein. 
AK106565ACGTGGGCCACNONE 
J013067N05ACGTGGGCCACNONE 
J023127B01ACGTGGGCCACNONE 
J033023J04ACGTGGGCCACNONE 
J033025J18ACGTGGGCCACNONE 
J033032A15ACGTGGGCCACNONE 
J033079F03ACGTGGGCCACNONE 
J033115D22ACGTGGGCCACNONE 
J033119N01ACGTGGGCCACNONE 
J033138G24ACGTGGGCCACNONE 
J033149E08ACGTGGGCCACNONE 
J033150A09ACGTGGGCCACNONE 
J043024B06ACGTGGGCCACNONE 
J065028O13ACGTGGGCCACNONE 
J065070C05ACGTGGGCCACNONE 
J065175H22ACGTGGGCCACNONE 
J090008L08ACGTGGGCCACNONE 
J090009M07ACGTGGGCCACNONE 
J090039L01ACGTGGGCCACNONE 
J090049A02ACGTGGGCCACNONE 
J090050A11ACGTGGGCCACNONE 
J090051G16ACGTGGGCCACNONE 
J090062P20ACGTGGGCCACNONE 
J090073P12ACGTGGGCCACNONE 
J090076B19ACGTGGGCCACNONE 
J090084I23ACGTGGGCCACNONE 
J090088N05ACGTGGGCCACNONE 
J100037J10ACGTGGGCCACNONE 
J100043B06ACGTGGGCCACNONE 
J100058C13ACGTGGGCCACNONE 
J100089N01ACGTGGGCCACNONE 
Os06g0647900AK073750CCAGCCCAGATGGGCCACConserved hypothetical protein. 
J033029K17CCAGCCCAGATGGGCCACNONE 
J033070L21CCAGCCCAGATGGGCCACNONE 
Os06g0663600AK100787GTGGCCCATCCEndonuclease V family protein. 
Os06g0682300009-098-E01GTGGCCCACGGNONE 
009-134-F09GTGGCCCACGGNONE 
009-137-E02GTGGCCCACGGNONE 
009-198-E05GTGGCCCACGGNONE 
AK062934GTGGCCCACGGHypothetical protein. 
J075053E04GTGGCCCACGGNONE 
Os06g0694100011-036-G03ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein. 
AK073594ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J033051C12ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J065102I24ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
Os06g0707200006-022-G09GCTGGGCCACNONE 
AK059411GCTGGGCCACNONE 
AK071568GCTGGGCCACProtein of unknown function DUF563 family protein. 
J065101E21GCTGGGCCACNONE 
Os06g0708200J013149K22CTGACAGGTGGGCCACNONE 
J053032C24CTGACAGGTGGGCCACNONE 
J053037F13CTGACAGGTGGGCCACNONE 
J053037L10CTGACAGGTGGGCCACNONE 
J053043J18CTGACAGGTGGGCCACNONE 
J053098E09CTGACAGGTGGGCCACNONE 
J075036L07CTGACAGGTGGGCCACNONE 
J075057O05CTGACAGGTGGGCCACNONE 
J090092L13CTGACAGGTGGGCCACNONE 
Os06g0730900AK062118GTGGCCCATGGNONE 
AK064963GTGGCCCATGGPeptidase A22B, minor histocompatibility antigen H13 family protein. 
AK065172GTGGCCCATGGNONE 
AK099361GTGGCCCATGGNONE 
Os07g0112600AK109561GTGGCCCAGCCConserved hypothetical protein. 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0127500009-139-F12ATTTGGGCCACGTGNONE 
AK062949ATTTGGGCCACGTGSimilar to PR-1a pathogenesis related protein (Hv-1a) precursor. 
J100077L01ATTTGGGCCACGTGNONE 
Os07g0142600009-115-C09TATTGGGCCACNONE 
AK062842TATTGGGCCACConserved hypothetical protein. 
Os07g0154300009-070-E08AGTGGGCCACNONE 
009-077-E01AGTGGGCCACNONE 
009-196-F05AGTGGGCCACNONE 
AK105386AGTGGGCCACConserved hypothetical protein. 
AK122093AGTGGGCCACNONE 
J033124K14AGTGGGCCACNONE 
J075006I22AGTGGGCCACNONE 
J075185G02AGTGGGCCACNONE 
J090039C02AGTGGGCCACNONE 
Os07g0205000009-018-A12GTGGCCCAAACNONE 
AK103963GTGGCCCAAACNONE 
AK121368GTGGCCCAAACNONE 
J023001M20GTGGCCCAAACNONE 
J023125I03GTGGCCCAAACNONE 
J053034L22GTGGCCCAAACNONE 
J065078A21GTGGCCCAAACNONE 
J065089G24GTGGCCCAAACNONE 
J065096G23GTGGCCCAAACNONE 
J065103N06GTGGCCCAAACNONE 
J065146J22GTGGCCCAAACNONE 
J065159K18GTGGCCCAAACNONE 
J065204L04GTGGCCCAAACNONE 
J065207N07GTGGCCCAAACNONE 
J065208E24GTGGCCCAAACNONE 
J075057F19GTGGCCCAAACNONE 
J075058K01GTGGCCCAAACNONE 
J075072H13GTGGCCCAAACNONE 
J080003D08GTGGCCCAAACNONE 
J080025F02GTGGCCCAAACNONE 
Os07g0410300AK108503ATCTGGGCCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os07g0419800J080309B06GAGGCGTGGGCCACNONE 
Os07g0438800AK060412GTGGCCCAGGNONE 
AK100065GTGGCCCAGGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195GTGGCCCAGGNONE 
AY224478GTGGCCCAGGNONE 
J013160O05GTGGCCCAGGNONE 
J023030C05GTGGCCCAGGNONE 
J033025O04GTGGCCCAGGNONE 
J033121P15GTGGCCCAGGNONE 
J043034I23GTGGCCCAGGNONE 
J065022N01GTGGCCCAGGNONE 
J065022N02GTGGCCCAGGNONE 
J065023M01GTGGCCCAGGNONE 
J065101G13GTGGCCCAGGNONE 
J075058P13GTGGCCCAGGNONE 
J075186K10GTGGCCCAGGNONE 
J075199F17GTGGCCCAGGNONE 
Os07g0469100009-036-F03TTGTGGGCTCGTGGGCCACNONE 
009-126-D06TTGTGGGCTCGTGGGCCACNONE 
009-190-A01TTGTGGGCTCGTGGGCCACNONE 
AK061626TTGTGGGCTCGTGGGCCACNONE 
AK120365TTGTGGGCTCGTGGGCCACSimilar to Thylakoid membrane phosphoprotein 14 kDa, chloroplast precursor. 
J013068P10TTGTGGGCTCGTGGGCCACNONE 
J053066C23TTGTGGGCTCGTGGGCCACNONE 
J065011K15TTGTGGGCTCGTGGGCCACNONE 
J065053E15TTGTGGGCTCGTGGGCCACNONE 
J065167F21TTGTGGGCTCGTGGGCCACNONE 
J075065G04TTGTGGGCTCGTGGGCCACNONE 
J075146A09TTGTGGGCTCGTGGGCCACNONE 
Os07g0499900AK109745ACATGGGCCAAGTTGGGCCACCyclin-like F-box domain containing protein. 
Os07g0513200015-004-B02TATGGGCCACNONE 
AK101410TATGGGCCACNONE 
AK106227TATGGGCCACNONE 
AK119451TATGGGCCACProtein prenyltransferase domain containing protein. 
Os07g0564400Os07g0564400GTGGCCCAGTTNucleic acid-binding, OB-fold domain containing protein. 
Os07g0594400J065137M02ACGTGGGCTTGGGCCACGGGCCGAConserved hypothetical protein. 
J065218E03ACGTGGGCTTGGGCCACGGGCCGANONE 
Os07g0595700003-103-G05CGATGGGCCACACGNONE 
AK108488CGATGGGCCACACGConserved hypothetical protein. 
J065136O05CGATGGGCCACACGNONE 
Os07g0595800011-069-G09CGTGTGGCCCATCGNONE 
AK066349CGTGTGGCCCATCGPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05CGTGTGGCCCATCGNONE 
Os07g0620200AK099859GTGGCCCAAATHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04GTGGCCCAAATNONE 
Os07g0623300AK070292GGCCGTGGCCCAATSimilar to Splicing factor SC35. 
J023050C05GGCCGTGGCCCAATNONE 
J090025O12GGCCGTGGCCCAATNONE 
Os07g0626100009-127-G03GACAGGTGGGCCACNONE 
AK062899GACAGGTGGGCCACSimilar to 50S ribosomal protein L7/L12. 
Os07g0626300AK100052CCATGGGCCACGGCCCATGTConserved hypothetical protein. 
Os07g0631900AK061072CACTGACAGTGGGCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os07g0633800AK103878TATTGGGCCACConserved hypothetical protein. 
J033025K08TATTGGGCCACNONE 
J033026N04TATTGGGCCACNONE 
J090062M09TATTGGGCCACNONE 
J090087F04TATTGGGCCACNONE 
Os07g0681100AK103917TGTGGGCCACNONE 
Os07g0688100AK101635GTGGCCCACTProtein prenyltransferase domain containing protein. 
J033055B02GTGGCCCACTNONE 
J090013O08GTGGCCCACTNONE 
J090074A17GTGGCCCACTNONE 
Os07g0689300AK068511TCTGGGCCACNONE 
J013153J24TCTGGGCCACNONE 
Os07g0695100AB189039GTGGCCCAGCNONE 
AB189042GTGGCCCAGCNONE 
AK059514GTGGCCCAGCNONE 
AK066112GTGGCCCAGCCheY-like domain containing protein. 
J013051N02GTGGCCCAGCNONE 
J013127M02GTGGCCCAGCNONE 
J023007I05GTGGCCCAGCNONE 
Os08g0119500J080315K03TCTGGGCCACMethyltransferase type 11 domain containing protein. 
Os08g0124000011-023-G08TGATGGGCCACNONE 
AK063293TGATGGGCCACSimilar to Resistance protein candidate (Fragment). 
AK067378TGATGGGCCACNONE 
J090067O21TGATGGGCCACNONE 
Os08g0137250J075030L12GTGGCCCATCTNONE 
J075037O21GTGGCCCATCTNONE 
J075078E23GTGGCCCATCTNONE 
J075079C23GTGGCCCATCTNONE 
J075092K02GTGGCCCATCTNONE 
J075108M04GTGGCCCATCTNONE 
J075112N13GTGGCCCATCTNONE 
J075132M13GTGGCCCATCTNONE 
J075146E07GTGGCCCATCTNONE 
J075159F16GTGGCCCATCTNONE 
J075166M12GTGGCCCATCTNONE 
J075185B10GTGGCCCATCTNONE 
J075193J10GTGGCCCATCTNONE 
Os08g0150800AK101530TGTGGGCCACGTCSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0178100AK101717AATTGGGCCACGGCCCATGAPep3/Vps18/deep orange domain containing protein. 
Os08g0234400J065186B17GGCCGTCCACGTGGCCCAGCConserved hypothetical protein. 
Os08g0316900013-024-A06GTGGCCCAACCNONE 
J033112J20GTGGCCCAACCNONE 
J065025M22GTGGCCCAACCNONE 
J065026E15GTGGCCCAACCNONE 
Os08g0319900AK108030GTGGCCCAACPutative cyclase family protein. 
Os08g0374100006-043-B11TGTGGGCCACNONE 
006-065-D12TGTGGGCCACNONE 
006-071-B11TGTGGGCCACNONE 
006-101-C05TGTGGGCCACNONE 
009-159-A03TGTGGGCCACNONE 
AK070541TGTGGGCCACSimilar to Ubiquitin-conjugating enzyme E2 M (EC 6.3.2.19) (Ubiquitin-protein ligase M) (Ubiquitin carrier protein M) (Nedd8-conjugating enzyme Ubc12). 
AK104158TGTGGGCCACNONE 
AK104511TGTGGGCCACNONE 
J023056A05TGTGGGCCACNONE 
J100059M16TGTGGGCCACNONE 
Os08g0375800AK101199TAATGGGCCACProtein prenyltransferase domain containing protein. 
J033030L22TAATGGGCCACNONE 
Os08g0386300AK059323GTGGCCCACGTGGCNONE 
AK070379GTGGCCCACGTGGCCytochrome b5 domain containing protein. 
J023054P20GTGGCCCACGTGGCNONE 
J033089H01GTGGCCCACGTGGCNONE 
J065013I01GTGGCCCACGTGGCNONE 
J065212E17GTGGCCCACGTGGCNONE 
J080317O15GTGGCCCACGTGGCNONE 
J090018O07GTGGCCCACGTGGCNONE 
Os08g0430700AK101681TGGTGGGCCACSimilar to UVB-resistance protein-like. 
AK102785TGGTGGGCCACNONE 
Os08g0435800AK121712AATTGGGCCCACACGAATGGGCCACSimilar to Lipoate protein ligase-like protein. 
J065121P15AATTGGGCCCACACGAATGGGCCACNONE 
Os08g0461300AK065651GTGGCCCATGTCyclin-like F-box domain containing protein. 
Os08g0490100009-038-D02CGTGGGCCACNONE 
J065152E11CGTGGGCCACSimilar to PBF protein. 
J090050K03CGTGGGCCACNONE 
J090053L01CGTGGGCCACNONE 
Os08g0542100AK058490AACTGGGCCACRibosomal protein L7, eukaryotic form family protein. 
AK058490AACTGGGCCACRibosomal protein L7, eukaryotic form family protein. 
AK101416AACTGGGCCACNONE 
AK101416AACTGGGCCACNONE 
J033037N08AACTGGGCCACNONE 
J033037N08AACTGGGCCACNONE 
J033086B16AACTGGGCCACNONE 
J033086B16AACTGGGCCACNONE 
J043036J02AACTGGGCCACNONE 
J043036J02AACTGGGCCACNONE 
J065137E02AACTGGGCCACNONE 
J065137E02AACTGGGCCACNONE 
J090015L07AACTGGGCCACNONE 
J090015L07AACTGGGCCACNONE 
J100036D02AACTGGGCCACNONE 
J100036D02AACTGGGCCACNONE 
Os08g0558000J080005K14ACATGGGCCACNONE 
Os08g0564100AK063258GTGGCCCATGASimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0101800AK102345GTGGCCCAATWD40-like domain containing protein. 
J090030C23GTGGCCCAATNONE 
Os09g0280600AK070961GTGGGCCACMnd1 family protein. 
J023066B13GTGGGCCACNONE 
Os09g0327300AK059603GTGGCCCAAAASimilar to Plastid 5,10-methylene-tetrahydrofolate dehydrogenase (Fragment). 
J100073E06GTGGCCCAAAANONE 
Os09g0330200AK111018AGTGGGCCACConserved hypothetical protein. 
Os09g0338400AK059171GTGGCCCAGTTNONE 
AK068798GTGGCCCAGTTNONE 
AK072043GTGGCCCAGTTNONE 
AK098947GTGGCCCAGTTSimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0385300AK073247GTGGCCCATGTHypothetical protein. 
AK120455GTGGCCCATGTNONE 
J013104G23GTGGCCCATGTNONE 
J023110A14GTGGCCCATGTNONE 
J033143F07GTGGCCCATGTNONE 
J065036P14GTGGCCCATGTNONE 
J065041I11GTGGCCCATGTNONE 
J065103K11GTGGCCCATGTNONE 
J065138M15GTGGCCCATGTNONE 
J065138P09GTGGCCCATGTNONE 
J065141J20GTGGCCCATGTNONE 
J075063J16GTGGCCCATGTNONE 
J075063K19GTGGCCCATGTNONE 
J075085H08GTGGCCCATGTNONE 
J075093C12GTGGCCCATGTNONE 
J075127N08GTGGCCCATGTNONE 
J075134E09GTGGCCCATGTNONE 
J075166D06GTGGCCCATGTNONE 
J075168K24GTGGCCCATGTNONE 
J075197G05GTGGCCCATGTNONE 
J080034J24GTGGCCCATGTNONE 
Os09g0395400AK109221ATGGCCCATGTGGCCCAAGConserved hypothetical protein. 
J075009I06ATGGCCCATGTGGCCCAAGNONE 
Os09g0441900009-109-C08GTGGCCCACTNONE 
013-033-G05GTGGCCCACTNONE 
AK062809GTGGCCCACTNONE 
AK064043GTGGCCCACTNONE 
J023131I10GTGGCCCACTNONE 
J033032C18GTGGCCCACTNONE 
J033113E20GTGGCCCACTNONE 
Os09g0446200011-092-H04AGTGGGCCACSpc97/Spc98 family protein. 
Os09g0459800AK060764ATATGGGCCACNONE 
AK100324ATATGGGCCACSimilar to ARP protein. 
AK102736ATATGGGCCACNONE 
Os09g0462200AK064734CACGTGGGCCACEsterase/lipase/thioesterase domain containing protein. 
Os09g0462300J065097M23GTGGCCCACGTGEsterase/lipase/thioesterase domain containing protein. 
J065161K12GTGGCCCACGTGNONE 
Os09g0533900003-104-E05GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
012-076-C03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK067774GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK100449GTGGCCCACCACGCCTCGGCCCCACCCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023026E11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023028B20GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023050P11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023052K08GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023075J03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023078E15GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023090P12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023120E01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023142K01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033027K23GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058A09GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058C12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033125A04GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J043040L01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053061D06GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053096N13GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J065193H10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J090075L17GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J100050D10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
Os09g0535300AK071211GTGGCCCAACTXAP5 protein family protein. 
Os11g0106700006-055-F11CCACGTGTGGCCCATCCNONE 
006-099-D08CCACGTGTGGCCCATCCNONE 
009-155-A12CCACGTGTGGCCCATCCNONE 
AF519570CCACGTGTGGCCCATCCNONE 
AK059354CCACGTGTGGCCCATCCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0593100AK070035GTGGCCCAAAProtein of unknown function DUF295 family protein. 
J023038E14GTGGCCCAAANONE 
J100062C21GTGGCCCAAANONE 
Os11g0648000AK066444GCCACGTGGCCCACAGGTGGGTCCCACSimilar to Na+/H+ antiporter. 
AK072026GCCACGTGGCCCACAGGTGGGTCCCACNONE 
Os11g0659500AK068543ACGTGGGCCACSimilar to Acyl-ACP thioesterase (Fragment). 
AK068543ACGTGGGCCACSimilar to Acyl-ACP thioesterase (Fragment). 
J013072O18ACGTGGGCCACNONE 
J013072O18ACGTGGGCCACNONE 
J013097B18ACGTGGGCCACNONE 
J013097B18ACGTGGGCCACNONE 
J013157H03ACGTGGGCCACNONE 
J013157H03ACGTGGGCCACNONE 
J023001D14ACGTGGGCCACNONE 
J023001D14ACGTGGGCCACNONE 
J080311F23ACGTGGGCCACNONE 
J080311F23ACGTGGGCCACNONE 
J090030F08ACGTGGGCCACNONE 
J090030F08ACGTGGGCCACNONE 
J090036B09ACGTGGGCCACNONE 
J090036B09ACGTGGGCCACNONE 
J090045G05ACGTGGGCCACNONE 
J090045G05ACGTGGGCCACNONE 
J100054J10ACGTGGGCCACNONE 
J100054J10ACGTGGGCCACNONE 
Os12g0106000AF370029CCACGTGTGGCCCATCCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571CCACGTGTGGCCCATCCNONE 
AK102242CCACGTGTGGCCCATCCNONE 
AY324879CCACGTGTGGCCCATCCNONE 
J053063M21CCACGTGTGGCCCATCCNONE 
J090080A16CCACGTGTGGCCCATCCNONE 
Os12g0120000011-024-E09GTGGCCCAAANONE 
AK105399GTGGCCCAAAProtein of unknown function DUF936, plant family protein. 
Os12g0292400006-063-H05GTGGCCCACTNONE 
006-083-H03GTGGCCCACTNONE 
006-098-B04GTGGCCCACTNONE 
009-006-G02GTGGCCCACTNONE 
009-018-H03GTGGCCCACTNONE 
009-019-F09GTGGCCCACTNONE 
009-023-G12GTGGCCCACTNONE 
009-028-B05GTGGCCCACTNONE 
009-036-E09GTGGCCCACTNONE 
009-041-D03GTGGCCCACTNONE 
009-068-E01GTGGCCCACTNONE 
009-084-A08GTGGCCCACTNONE 
009-110-B10GTGGCCCACTNONE 
009-113-E12GTGGCCCACTNONE 
009-123-F08GTGGCCCACTNONE 
009-136-D11GTGGCCCACTNONE 
009-144-H09GTGGCCCACTNONE 
009-162-D06GTGGCCCACTNONE 
009-172-G02GTGGCCCACTNONE 
009-174-D05GTGGCCCACTNONE 
009-181-A04GTGGCCCACTNONE 
009-181-F10GTGGCCCACTNONE 
009-184-C01GTGGCCCACTNONE 
009-185-A12GTGGCCCACTNONE 
009-186-F01GTGGCCCACTNONE 
009-188-A04GTGGCCCACTNONE 
009-188-H09GTGGCCCACTNONE 
009-194-A02GTGGCCCACTNONE 
009-194-C12GTGGCCCACTNONE 
014-008-D06GTGGCCCACTNONE 
AK068266GTGGCCCACTSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
AK070257GTGGCCCACTNONE 
J013149A10GTGGCCCACTNONE 
J023042N11GTGGCCCACTNONE 
J065008A06GTGGCCCACTNONE 
J065013C20GTGGCCCACTNONE 
J065013C24GTGGCCCACTNONE 
J065015F19GTGGCCCACTNONE 
J065017A05GTGGCCCACTNONE 
J065017L20GTGGCCCACTNONE 
J065021H14GTGGCCCACTNONE 
J065026K06GTGGCCCACTNONE 
J065028A05GTGGCCCACTNONE 
J065028L01GTGGCCCACTNONE 
J065028P08GTGGCCCACTNONE 
J065029I11GTGGCCCACTNONE 
J065032H19GTGGCCCACTNONE 
J065032K20GTGGCCCACTNONE 
J065035N23GTGGCCCACTNONE 
J065036A21GTGGCCCACTNONE 
J065040B13GTGGCCCACTNONE 
J065043D04GTGGCCCACTNONE 
J065045A20GTGGCCCACTNONE 
J065048G23GTGGCCCACTNONE 
J065049P06GTGGCCCACTNONE 
J065054H13GTGGCCCACTNONE 
J065057M06GTGGCCCACTNONE 
J065058P12GTGGCCCACTNONE 
J065059A12GTGGCCCACTNONE 
J065064J15GTGGCCCACTNONE 
J065066I19GTGGCCCACTNONE 
J065069B20GTGGCCCACTNONE 
J065071O19GTGGCCCACTNONE 
J065073E16GTGGCCCACTNONE 
J065073N04GTGGCCCACTNONE 
J065074L22GTGGCCCACTNONE 
J065075J08GTGGCCCACTNONE 
J065075K04GTGGCCCACTNONE 
J065075L14GTGGCCCACTNONE 
J065078F13GTGGCCCACTNONE 
J065081A10GTGGCCCACTNONE 
J065083H02GTGGCCCACTNONE 
J065083H05GTGGCCCACTNONE 
J065088C07GTGGCCCACTNONE 
J065088D02GTGGCCCACTNONE 
J065096C10GTGGCCCACTNONE 
J065103I09GTGGCCCACTNONE 
J065107N04GTGGCCCACTNONE 
J065108L19GTGGCCCACTNONE 
J065108O06GTGGCCCACTNONE 
J065111D07GTGGCCCACTNONE 
J065112H15GTGGCCCACTNONE 
J065112L15GTGGCCCACTNONE 
J065112M18GTGGCCCACTNONE 
J065113F02GTGGCCCACTNONE 
J065114C11GTGGCCCACTNONE 
J065116E12GTGGCCCACTNONE 
J065119E03GTGGCCCACTNONE 
J065120C19GTGGCCCACTNONE 
J065120H22GTGGCCCACTNONE 
J065121M16GTGGCCCACTNONE 
J065121N17GTGGCCCACTNONE 
J065123E20GTGGCCCACTNONE 
J065127F18GTGGCCCACTNONE 
J065130M04GTGGCCCACTNONE 
J065131N01GTGGCCCACTNONE 
J065134A05GTGGCCCACTNONE 
J065136L05GTGGCCCACTNONE 
J065138D04GTGGCCCACTNONE 
J065138E04GTGGCCCACTNONE 
J065138P10GTGGCCCACTNONE 
J065141E12GTGGCCCACTNONE 
J065142F20GTGGCCCACTNONE 
J065143D19GTGGCCCACTNONE 
J065143N05GTGGCCCACTNONE 
J065146K06GTGGCCCACTNONE 
J065150A10GTGGCCCACTNONE 
J065150J16GTGGCCCACTNONE 
J065151H15GTGGCCCACTNONE 
J065151K19GTGGCCCACTNONE 
J065151P22GTGGCCCACTNONE 
J065154L17GTGGCCCACTNONE 
J065158A20GTGGCCCACTNONE 
J065158C05GTGGCCCACTNONE 
J065161E16GTGGCCCACTNONE 
J065162A22GTGGCCCACTNONE 
J065162K19GTGGCCCACTNONE 
J065165L15GTGGCCCACTNONE 
J065170J09GTGGCCCACTNONE 
J065171J22GTGGCCCACTNONE 
J065172L15GTGGCCCACTNONE 
J065174B07GTGGCCCACTNONE 
J065174D24GTGGCCCACTNONE 
J065175L22GTGGCCCACTNONE 
J065176C04GTGGCCCACTNONE 
J065176K18GTGGCCCACTNONE 
J065180P21GTGGCCCACTNONE 
J065183A09GTGGCCCACTNONE 
J065187E22GTGGCCCACTNONE 
J065192F01GTGGCCCACTNONE 
J065194E23GTGGCCCACTNONE 
J065196A13GTGGCCCACTNONE 
J065196F18GTGGCCCACTNONE 
J065196P03GTGGCCCACTNONE 
J065204P15GTGGCCCACTNONE 
J065207L24GTGGCCCACTNONE 
J065207O18GTGGCCCACTNONE 
J065210B18GTGGCCCACTNONE 
J065210H05GTGGCCCACTNONE 
J065210M24GTGGCCCACTNONE 
J065212F02GTGGCCCACTNONE 
J065219H13GTGGCCCACTNONE 
J075003J22GTGGCCCACTNONE 
J075006N24GTGGCCCACTNONE 
J075007M07GTGGCCCACTNONE 
J075011D05GTGGCCCACTNONE 
J075026I09GTGGCCCACTNONE 
J075030K22GTGGCCCACTNONE 
J075040P09GTGGCCCACTNONE 
J075042L19GTGGCCCACTNONE 
J075043B01GTGGCCCACTNONE 
J075044M04GTGGCCCACTNONE 
J075048H12GTGGCCCACTNONE 
J075049E04GTGGCCCACTNONE 
J075054L07GTGGCCCACTNONE 
J075060D03GTGGCCCACTNONE 
J075064E01GTGGCCCACTNONE 
J075064I24GTGGCCCACTNONE 
J075071L20GTGGCCCACTNONE 
J075075G19GTGGCCCACTNONE 
J075076H14GTGGCCCACTNONE 
J075081E01GTGGCCCACTNONE 
J075089O22GTGGCCCACTNONE 
J075095K19GTGGCCCACTNONE 
J075096L09GTGGCCCACTNONE 
J075105J11GTGGCCCACTNONE 
J075106E16GTGGCCCACTNONE 
J075110A07GTGGCCCACTNONE 
J075116F14GTGGCCCACTNONE 
J075130L19GTGGCCCACTNONE 
J075133I07GTGGCCCACTNONE 
J075137P15GTGGCCCACTNONE 
J075139J03GTGGCCCACTNONE 
J075142L14GTGGCCCACTNONE 
J075144B16GTGGCCCACTNONE 
J075155J18GTGGCCCACTNONE 
J075160O14GTGGCCCACTNONE 
J075161H15GTGGCCCACTNONE 
J075169I05GTGGCCCACTNONE 
J075171J22GTGGCCCACTNONE 
J075179K20GTGGCCCACTNONE 
J075183J01GTGGCCCACTNONE 
J075183O05GTGGCCCACTNONE 
J075184C15GTGGCCCACTNONE 
J075184J21GTGGCCCACTNONE 
J075190G24GTGGCCCACTNONE 
J075196M20GTGGCCCACTNONE 
J080002B08GTGGCCCACTNONE 
J080004M09GTGGCCCACTNONE 
J080008J04GTGGCCCACTNONE 
J080012E01GTGGCCCACTNONE 
J080015L07GTGGCCCACTNONE 
J080017P10GTGGCCCACTNONE 
J080018G20GTGGCCCACTNONE 
J080020F04GTGGCCCACTNONE 
J080021E04GTGGCCCACTNONE 
J080027O08GTGGCCCACTNONE 
J080034C06GTGGCCCACTNONE 
J080034H14GTGGCCCACTNONE 
J080036G10GTGGCCCACTNONE 
J080037C10GTGGCCCACTNONE 
J080038H18GTGGCCCACTNONE 
J080044A19GTGGCCCACTNONE 
J080045I24GTGGCCCACTNONE 
J080050G19GTGGCCCACTNONE 
J080050K24GTGGCCCACTNONE 
J080054F12GTGGCCCACTNONE 
J080059J09GTGGCCCACTNONE 
J080061P18GTGGCCCACTNONE 
J080065O20GTGGCCCACTNONE 
J080068D16GTGGCCCACTNONE 
J080069P21GTGGCCCACTNONE 
J080072D12GTGGCCCACTNONE 
J080079D01GTGGCCCACTNONE 
J080079J23GTGGCCCACTNONE 
J080087B09GTGGCCCACTNONE 
J080091J12GTGGCCCACTNONE 
J080092K11GTGGCCCACTNONE 
J080304A18GTGGCCCACTNONE 
J080309O09GTGGCCCACTNONE 
J080312G11GTGGCCCACTNONE 
J080315B02GTGGCCCACTNONE 
J080315B22GTGGCCCACTNONE 
J080318K05GTGGCCCACTNONE 
J080318M07GTGGCCCACTNONE 
J090003I22GTGGCCCACTNONE 
J090010J03GTGGCCCACTNONE 
J090020J06GTGGCCCACTNONE 
J090032D18GTGGCCCACTNONE 
J090055N15GTGGCCCACTNONE 
J090056P03GTGGCCCACTNONE 
J090057N17GTGGCCCACTNONE 
J090082K17GTGGCCCACTNONE 
J090084M06GTGGCCCACTNONE 
J100039O13GTGGCCCACTNONE 
J100067C07GTGGCCCACTNONE 
J100090J23GTGGCCCACTNONE 
Os12g0299700AK071145ACATGGGCCACConserved hypothetical protein. 
J023082N05ACATGGGCCACNONE 
Os12g0460800J023003J21CACTGACACGTGGGCCACNONE 
Os12g0517100012-071-A03GTGGCCCATCANONE 
AK073020GTGGCCCATCACyclin-like F-box domain containing protein. 
J023149K21GTGGCCCATCANONE 
Os12g0565800AK072828GCTGGGCCACCGCACZinc finger, TTF-type domain containing protein. 
Os12g0623700009-168-F09GTGGCCCATTTNONE 
AK063876GTGGCCCATTTConserved hypothetical protein. 
Os12g0628100AK121150GTGGCCCAGCCSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J023078I07GTGGCCCAGCCNONE 
J075153L01GTGGCCCAGCCNONE 
J100050C05GTGGCCCAGCCNONE 
Os12g0632000J080016B03CCTGGGCCACNONE 
J080071M07CCTGGGCCACNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.