version

Summary of OsREG654 (All List)

OrganismOryza sativa  
IDOsREG654  
SequenceGTGGGCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2549  

Entry Sequences (2549 entries)

LocusGene modelSequenceDescription
Os01g0131600006-030-A03GTGGCCCACCCGNONE 
006-049-C10GTGGCCCACCCGNONE 
006-054-E02GTGGCCCACCCGNONE 
011-035-H02GTGGCCCACCCGNONE 
011-036-E04GTGGCCCACCCGNONE 
012-047-C08GTGGCCCACCCGNONE 
012-079-F08GTGGCCCACCCGNONE 
012-097-C02GTGGCCCACCCGNONE 
012-100-A07GTGGCCCACCCGNONE 
013-015-H05GTGGCCCACCCGNONE 
013-047-A03GTGGCCCACCCGNONE 
013-051-B05GTGGCCCACCCGNONE 
013-061-G02GTGGCCCACCCGNONE 
013-077-H02GTGGCCCACCCGNONE 
015-005-D04GTGGCCCACCCGNONE 
015-064-B06GTGGCCCACCCGNONE 
015-072-D02GTGGCCCACCCGNONE 
016-073-E09GTGGCCCACCCGNONE 
016-088-H03GTGGCCCACCCGNONE 
AK062063GTGGCCCACCCGNONE 
AK101133GTGGCCCACCCGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277GTGGCCCACCCGNONE 
AK119645GTGGCCCACCCGNONE 
AY341828GTGGCCCACCCGNONE 
J013036O08GTGGCCCACCCGNONE 
J013037M17GTGGCCCACCCGNONE 
J013039B11GTGGCCCACCCGNONE 
J013039L20GTGGCCCACCCGNONE 
J013047B20GTGGCCCACCCGNONE 
J013048E23GTGGCCCACCCGNONE 
J013051E12GTGGCCCACCCGNONE 
J013051F12GTGGCCCACCCGNONE 
J013056B05GTGGCCCACCCGNONE 
J013057N24GTGGCCCACCCGNONE 
J013064D21GTGGCCCACCCGNONE 
J013065G24GTGGCCCACCCGNONE 
J013075L13GTGGCCCACCCGNONE 
J013075L24GTGGCCCACCCGNONE 
J013092F04GTGGCCCACCCGNONE 
J013092F10GTGGCCCACCCGNONE 
J013092M16GTGGCCCACCCGNONE 
J013096K06GTGGCCCACCCGNONE 
J013111F10GTGGCCCACCCGNONE 
J013120B17GTGGCCCACCCGNONE 
J013120P07GTGGCCCACCCGNONE 
J013122F18GTGGCCCACCCGNONE 
J013122H23GTGGCCCACCCGNONE 
J013126I15GTGGCCCACCCGNONE 
J013126L17GTGGCCCACCCGNONE 
J013129C15GTGGCCCACCCGNONE 
J013146A04GTGGCCCACCCGNONE 
J013146A06GTGGCCCACCCGNONE 
J013153F01GTGGCCCACCCGNONE 
J013156O06GTGGCCCACCCGNONE 
J013162D05GTGGCCCACCCGNONE 
J023008N04GTGGCCCACCCGNONE 
J023010D06GTGGCCCACCCGNONE 
J023011I23GTGGCCCACCCGNONE 
J023023I15GTGGCCCACCCGNONE 
J023025C08GTGGCCCACCCGNONE 
J023029H02GTGGCCCACCCGNONE 
J023033C18GTGGCCCACCCGNONE 
J023037D21GTGGCCCACCCGNONE 
J023049F17GTGGCCCACCCGNONE 
J023052B15GTGGCCCACCCGNONE 
J023061D03GTGGCCCACCCGNONE 
J023062M01GTGGCCCACCCGNONE 
J023089D24GTGGCCCACCCGNONE 
J023109J20GTGGCCCACCCGNONE 
J023109M21GTGGCCCACCCGNONE 
J023120N04GTGGCCCACCCGNONE 
J023122A04GTGGCCCACCCGNONE 
J023134F23GTGGCCCACCCGNONE 
J023149E20GTGGCCCACCCGNONE 
J033022A12GTGGCCCACCCGNONE 
J033022C04GTGGCCCACCCGNONE 
J033024K06GTGGCCCACCCGNONE 
J033026F23GTGGCCCACCCGNONE 
J033029J19GTGGCCCACCCGNONE 
J033040H20GTGGCCCACCCGNONE 
J033042P21GTGGCCCACCCGNONE 
J033043F14GTGGCCCACCCGNONE 
J033044G11GTGGCCCACCCGNONE 
J033052L10GTGGCCCACCCGNONE 
J033052O03GTGGCCCACCCGNONE 
J033052P03GTGGCCCACCCGNONE 
J033079B20GTGGCCCACCCGNONE 
J033089D21GTGGCCCACCCGNONE 
J033094P04GTGGCCCACCCGNONE 
J033103N02GTGGCCCACCCGNONE 
J033110J19GTGGCCCACCCGNONE 
J033114E17GTGGCCCACCCGNONE 
J033115K04GTGGCCCACCCGNONE 
J033119I06GTGGCCCACCCGNONE 
J033121L10GTGGCCCACCCGNONE 
J033123H14GTGGCCCACCCGNONE 
J033136H10GTGGCCCACCCGNONE 
J033139L07GTGGCCCACCCGNONE 
J033143G23GTGGCCCACCCGNONE 
J043021F16GTGGCCCACCCGNONE 
J080304G01GTGGCCCACCCGNONE 
J080305H24GTGGCCCACCCGNONE 
J080309B11GTGGCCCACCCGNONE 
J080315N09GTGGCCCACCCGNONE 
J080319J20GTGGCCCACCCGNONE 
J090014D01GTGGCCCACCCGNONE 
J090067F08GTGGCCCACCCGNONE 
J090079P18GTGGCCCACCCGNONE 
J090082K13GTGGCCCACCCGNONE 
J090093K17GTGGCCCACCCGNONE 
J090099G18GTGGCCCACCCGNONE 
J100022K14GTGGCCCACCCGNONE 
J100052G17GTGGCCCACCCGNONE 
Os01g0134800011-091-C12ATGGCCCACANONE 
AK063402ATGGCCCACASimilar to (1,4)-beta-xylan endohydrolase, isoenzyme X-II (EC 3.2.1.8) (Fragment). 
Os01g0156300AK107993CCGTGGGCCACACGTCTCSimilar to Cappuccino protein. 
Os01g0286600AB057749GGTGGGCCATSimilar to Plastidal protoporphyrinogen oxidase. 
Os01g0352100AK072222GCGTGGGCCAC2OG-Fe(II) oxygenase domain containing protein. 
Os01g0392600J065002C11ATGGCCCACAANONE 
J065101G17ATGGCCCACAANONE 
J065104H18ATGGCCCACAANONE 
J100041A03ATGGCCCACAANONE 
Os01g0598400AK109846CTGGCCCACGAACyclin-like F-box domain containing protein. 
Os01g0622300006-041-C10TTGGCCCACGANONE 
AK072290TTGGCCCACGANONE 
AK099135TTGGCCCACGANONE 
AK106203TTGGCCCACGASimilar to Plastid uroporphyrinogen decarboxylase (Fragment). 
J065102E05TTGGCCCACGANONE 
J080044C04TTGGCCCACGANONE 
J080046E10TTGGCCCACGANONE 
J080050J18TTGGCCCACGANONE 
J080067B13TTGGCCCACGANONE 
J080072C04TTGGCCCACGANONE 
J080072J09TTGGCCCACGANONE 
J080075A16TTGGCCCACGANONE 
J080093E02TTGGCCCACGANONE 
Os01g0633000006-075-A01ACGCGTGGGCCAGANONE 
009-064-A11ACGCGTGGGCCAGANONE 
009-153-F07ACGCGTGGGCCAGANONE 
AK062051ACGCGTGGGCCAGASimilar to 50S ribosomal protein L31. 
J013073B08ACGCGTGGGCCAGANONE 
J065006K19ACGCGTGGGCCAGANONE 
J065053P08ACGCGTGGGCCAGANONE 
J065057D08ACGCGTGGGCCAGANONE 
J065086P07ACGCGTGGGCCAGANONE 
J065095C14ACGCGTGGGCCAGANONE 
J065116B05ACGCGTGGGCCAGANONE 
J065164L20ACGCGTGGGCCAGANONE 
J065185K19ACGCGTGGGCCAGANONE 
J065191E21ACGCGTGGGCCAGANONE 
J065199P21ACGCGTGGGCCAGANONE 
J065216M12ACGCGTGGGCCAGANONE 
J075002M09ACGCGTGGGCCAGANONE 
J075016N10ACGCGTGGGCCAGANONE 
J075041K05ACGCGTGGGCCAGANONE 
J075094E04ACGCGTGGGCCAGANONE 
J075154O04ACGCGTGGGCCAGANONE 
J075176D22ACGCGTGGGCCAGANONE 
J075186M09ACGCGTGGGCCAGANONE 
J075191H20ACGCGTGGGCCAGANONE 
Os01g0689900AK064656CGTGTGGCCCACTNONE 
AK102164CGTGTGGCCCACTProtein kinase-like domain containing protein. 
J033043D15CGTGTGGCCCACTNONE 
J033060J20CGTGTGGCCCACTNONE 
J033086H03CGTGTGGCCCACTNONE 
J033117B10CGTGTGGCCCACTNONE 
J053023O03CGTGTGGCCCACTNONE 
J053055P21CGTGTGGCCCACTNONE 
J053078A20CGTGTGGCCCACTNONE 
J053082K03CGTGTGGCCCACTNONE 
J053086A16CGTGTGGCCCACTNONE 
J080027C22CGTGTGGCCCACTNONE 
J080062G19CGTGTGGCCCACTNONE 
J080065M03CGTGTGGCCCACTNONE 
J100068P17CGTGTGGCCCACTNONE 
Os01g0690800AK066430CGTGTGGCCCACTProtein kinase-like domain containing protein. 
AK073248CGTGTGGCCCACTNONE 
J065001D22CGTGTGGCCCACTNONE 
J065116J04CGTGTGGCCCACTNONE 
J100044K03CGTGTGGCCCACTNONE 
Os01g0704100AK072215ATGGCCCACCACSimilar to Membrane transporter. 
AK109776ATGGCCCACCACNONE 
J080037E03ATGGCCCACCACNONE 
J080041H13ATGGCCCACCACNONE 
J080046B15ATGGCCCACCACNONE 
J080058K14ATGGCCCACCACNONE 
J080065E14ATGGCCCACCACNONE 
J080079C08ATGGCCCACCACNONE 
J080088J12ATGGCCCACCACNONE 
J080088M19ATGGCCCACCACNONE 
J100043G11ATGGCCCACCACNONE 
J100059M22ATGGCCCACCACNONE 
Os01g0720700J033124M22ACGTGGGCCAGGCCCNONE 
J065006G21ACGTGGGCCAGGCCCNONE 
J065025M24ACGTGGGCCAGGCCCNONE 
J065041J02ACGTGGGCCAGGCCCNONE 
J065044B14ACGTGGGCCAGGCCCNONE 
J065061J06ACGTGGGCCAGGCCCNONE 
J065116L21ACGTGGGCCAGGCCCNONE 
J075030F18ACGTGGGCCAGGCCCNONE 
J075034K17ACGTGGGCCAGGCCCNONE 
J075063I02ACGTGGGCCAGGCCCNONE 
J075110D21ACGTGGGCCAGGCCCSimilar to Serine acetyltransferase. 
J075188L15ACGTGGGCCAGGCCCNONE 
J075197B17ACGTGGGCCAGGCCCNONE 
Os01g0764800AK102809CGTGTGGGCCACSimilar to Nt-gh3 deduced protein. 
Os01g0767700AK122168ATGGCCCACACGSimilar to DEIH-box RNA/DNA helicase. 
Os01g0830500006-117-F06GTGGCCCACCACNONE 
AK061475GTGGCCCACCACNONE 
AK105801GTGGCCCACCAC2OG-Fe(II) oxygenase domain containing protein. 
J065168H17GTGGCCCACCACNONE 
J065211O10GTGGCCCACCACNONE 
Os01g0839300AK064685TTGGCCCACAASimilar to 50S ribosomal protein L17. 
J065060I21TTGGCCCACAANONE 
Os01g0855600003-004-C02GTGGCCCACACGNONE 
016-023-G11GTGGCCCACACGNONE 
AK099776GTGGCCCACACGSimilar to Hs1pro-1 protein. 
AY224522GTGGCCCACACGNONE 
J013095E24GTGGCCCACACGNONE 
J023041J04GTGGCCCACACGNONE 
J065130B09GTGGCCCACACGNONE 
J075031B02GTGGCCCACACGNONE 
J075069H11GTGGCCCACACGNONE 
J100026O10GTGGCCCACACGNONE 
J100050J01GTGGCCCACACGNONE 
J100052G04GTGGCCCACACGNONE 
J100053D07GTGGCCCACACGNONE 
J100054K16GTGGCCCACACGNONE 
J100067A06GTGGCCCACACGNONE 
J100067G01GTGGCCCACACGNONE 
J100088C18GTGGCCCACACGNONE 
Os01g0870100AK067564GTGGCCCACGGGProtein of unknown function DUF1012 family protein. 
AK072312GTGGCCCACGGGNONE 
AK103428GTGGCCCACGGGNONE 
Os01g0889000AK103621ATGGCCCACGAGGCCCAAATTetratricopeptide-like helical domain containing protein. 
Os01g0895100AK058611TTGGCCCACASimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698TTGGCCCACANONE 
AK099166TTGGCCCACANONE 
J023065I03TTGGCCCACANONE 
J023081J06TTGGCCCACANONE 
J023126H17TTGGCCCACANONE 
J023126O09TTGGCCCACANONE 
J033035I06TTGGCCCACANONE 
J090065C10TTGGCCCACANONE 
J090095O16TTGGCCCACANONE 
Os01g0896400AK107067CGTGTGGCCCACCCGConserved hypothetical protein. 
Os01g0937300AK062872TGTGGGCCACNONE 
J033136K12TGTGGGCCACNONE 
J053048E20TGTGGGCCACNONE 
J053088K08TGTGGGCCACNONE 
J065011G23TGTGGGCCACNONE 
J065202J09TGTGGGCCACNONE 
Os01g0951800AK069239TTGGCCCACTProtein prenyltransferase domain containing protein. 
Os01g0961200011-099-H06CTGGCCCACCAACNONE 
AK105424CTGGCCCACCAACCBS domain containing protein. 
J065169J18CTGGCCCACCAACNONE 
J075109H12CTGGCCCACCAACNONE 
Os01g0963300AK067544CTGGCCCACGGCCCACTSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os01g0969100AK070623GGAGTGGGCCACNAD-dependent epimerase/dehydratase family protein. 
Os02g0110200009-041-B07ATGGCCCACGTNONE 
AK100012ATGGCCCACGTNONE 
AK105694ATGGCCCACGTSimilar to Hydroperoxide lyase. 
Os02g0119400AK060055TTGGCCCACGTGTCCNONE 
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52). 
J033107H09TTGGCCCACGTGTCCNONE 
J075175F09TTGGCCCACGTGTCCNONE 
J090011H05TTGGCCCACGTGTCCNONE 
J090091O05TTGGCCCACGTGTCCNONE 
Os02g0133900AK107180CTGGCCCACCProtein of unknown function DUF829, eukaryotic family protein. 
Os02g0143200AK070600AGGTGGGCCAGArmadillo-like helical domain containing protein. 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0158400006-048-F06ATGGCCCACTNONE 
006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATGGCCCACTssDNA-binding transcriptional regulator family protein. 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATGGCCCACTNONE 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATGGCCCACTNONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATGGCCCACTNONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATGGCCCACTNONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATGGCCCACTNONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATGGCCCACTNONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATGGCCCACTNONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATGGCCCACTNONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATGGCCCACTNONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATGGCCCACTNONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATGGCCCACTNONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATGGCCCACTNONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATGGCCCACTNONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATGGCCCACTNONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATGGCCCACTNONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATGGCCCACTNONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATGGCCCACTNONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATGGCCCACTNONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATGGCCCACTNONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATGGCCCACTNONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATGGCCCACTNONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0178400009-151-B08TTGGCCCACGAGGCCCATAANONE 
AK063815TTGGCCCACGAGGCCCATAAProtein transport protein SEC61 gamma subunit. 
AK121516TTGGCCCACGAGGCCCATAANONE 
J033026A17TTGGCCCACGAGGCCCATAANONE 
J065011K14TTGGCCCACGAGGCCCATAANONE 
J065056D01TTGGCCCACGAGGCCCATAANONE 
J065061L22TTGGCCCACGAGGCCCATAANONE 
J065076M01TTGGCCCACGAGGCCCATAANONE 
J075092E14TTGGCCCACGAGGCCCATAANONE 
Os02g0186700AK064492ATGGCCCACGCConserved hypothetical protein. 
J065210K09ATGGCCCACGCNONE 
J075006A17ATGGCCCACGCNONE 
J075108C18ATGGCCCACGCNONE 
J075153E08ATGGCCCACGCNONE 
Os02g0190950J075001E02GTGGCCCACCCConserved hypothetical protein. 
J075117E23GTGGCCCACCCNONE 
J075117F23GTGGCCCACCCNONE 
J075144M12GTGGCCCACCCNONE 
J075145H10GTGGCCCACCCNONE 
J075186B15GTGGCCCACCCNONE 
Os02g0435000AK060832TTGGCCCACTNONE 
AK102414TTGGCCCACTTranslocation protein Sec62 family protein. 
Os02g0452800J043024P15TGTGGGCCAGConserved hypothetical protein. 
Os02g0499300AK106994CTGGCCCACCAACCGTGGGCCACConserved hypothetical protein. 
Os02g0517531AK121247TTGGCCCACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os02g0528500J053035P18GACAGGTGGGCCATNONE 
J053046L13GACAGGTGGGCCATNONE 
J053099F11GACAGGTGGGCCATNONE 
Os02g0564100006-072-A11CCGTGGGCCACNONE 
AK073526CCGTGGGCCACSimilar to EL3 protein. 
AK105951CCGTGGGCCACNONE 
J100045C15CCGTGGGCCACNONE 
Os02g0626100003-107-B06CAGGTGGGCCACGCGTCGCGNONE 
AK120127CAGGTGGGCCACGCGTCGCGNONE 
Os02g0658500AK120166CTGGCCCACCANONE 
Os02g0666200006-021-D11CTGGCCCACCAGGGCCCACGCNONE 
006-022-F02CTGGCCCACCAGGGCCCACGCNONE 
006-022-H11CTGGCCCACCAGGGCCCACGCNONE 
006-024-C03CTGGCCCACCAGGGCCCACGCNONE 
006-026-G05CTGGCCCACCAGGGCCCACGCNONE 
006-027-F11CTGGCCCACCAGGGCCCACGCNONE 
006-028-G06CTGGCCCACCAGGGCCCACGCNONE 
006-028-H05CTGGCCCACCAGGGCCCACGCNONE 
006-030-H06CTGGCCCACCAGGGCCCACGCNONE 
006-030-H12CTGGCCCACCAGGGCCCACGCNONE 
006-031-C07CTGGCCCACCAGGGCCCACGCNONE 
006-031-G01CTGGCCCACCAGGGCCCACGCNONE 
006-033-F09CTGGCCCACCAGGGCCCACGCNONE 
006-035-A01CTGGCCCACCAGGGCCCACGCNONE 
006-035-A12CTGGCCCACCAGGGCCCACGCNONE 
006-035-F04CTGGCCCACCAGGGCCCACGCNONE 
006-036-G09CTGGCCCACCAGGGCCCACGCNONE 
006-038-A01CTGGCCCACCAGGGCCCACGCNONE 
006-038-A03CTGGCCCACCAGGGCCCACGCNONE 
006-039-D08CTGGCCCACCAGGGCCCACGCNONE 
006-042-C11CTGGCCCACCAGGGCCCACGCNONE 
006-042-H06CTGGCCCACCAGGGCCCACGCNONE 
006-044-E01CTGGCCCACCAGGGCCCACGCNONE 
006-045-E05CTGGCCCACCAGGGCCCACGCNONE 
006-046-G05CTGGCCCACCAGGGCCCACGCNONE 
006-047-A03CTGGCCCACCAGGGCCCACGCNONE 
006-048-H08CTGGCCCACCAGGGCCCACGCNONE 
006-052-A07CTGGCCCACCAGGGCCCACGCNONE 
006-053-A05CTGGCCCACCAGGGCCCACGCNONE 
006-054-G06CTGGCCCACCAGGGCCCACGCNONE 
006-056-D10CTGGCCCACCAGGGCCCACGCNONE 
006-057-B07CTGGCCCACCAGGGCCCACGCNONE 
006-058-F12CTGGCCCACCAGGGCCCACGCNONE 
006-060-D01CTGGCCCACCAGGGCCCACGCNONE 
006-061-A12CTGGCCCACCAGGGCCCACGCNONE 
006-062-E02CTGGCCCACCAGGGCCCACGCNONE 
006-063-F11CTGGCCCACCAGGGCCCACGCNONE 
006-063-H02CTGGCCCACCAGGGCCCACGCNONE 
006-066-F12CTGGCCCACCAGGGCCCACGCNONE 
006-067-H12CTGGCCCACCAGGGCCCACGCNONE 
006-068-B09CTGGCCCACCAGGGCCCACGCNONE 
006-068-D08CTGGCCCACCAGGGCCCACGCNONE 
006-071-A12CTGGCCCACCAGGGCCCACGCNONE 
006-072-H06CTGGCCCACCAGGGCCCACGCNONE 
006-074-A02CTGGCCCACCAGGGCCCACGCNONE 
006-074-F10CTGGCCCACCAGGGCCCACGCNONE 
006-077-H10CTGGCCCACCAGGGCCCACGCNONE 
006-078-G02CTGGCCCACCAGGGCCCACGCNONE 
006-081-B03CTGGCCCACCAGGGCCCACGCNONE 
006-084-H01CTGGCCCACCAGGGCCCACGCNONE 
006-084-H02CTGGCCCACCAGGGCCCACGCNONE 
006-084-H04CTGGCCCACCAGGGCCCACGCNONE 
006-087-H08CTGGCCCACCAGGGCCCACGCNONE 
006-090-B08CTGGCCCACCAGGGCCCACGCNONE 
006-091-E10CTGGCCCACCAGGGCCCACGCNONE 
006-093-G02CTGGCCCACCAGGGCCCACGCNONE 
006-094-B12CTGGCCCACCAGGGCCCACGCNONE 
006-094-E03CTGGCCCACCAGGGCCCACGCNONE 
006-095-G07CTGGCCCACCAGGGCCCACGCNONE 
006-095-H07CTGGCCCACCAGGGCCCACGCNONE 
006-097-G08CTGGCCCACCAGGGCCCACGCNONE 
006-098-E12CTGGCCCACCAGGGCCCACGCNONE 
006-099-A04CTGGCCCACCAGGGCCCACGCNONE 
006-099-E08CTGGCCCACCAGGGCCCACGCNONE 
006-103-F12CTGGCCCACCAGGGCCCACGCNONE 
006-104-G02CTGGCCCACCAGGGCCCACGCNONE 
006-105-F02CTGGCCCACCAGGGCCCACGCNONE 
006-107-D12CTGGCCCACCAGGGCCCACGCNONE 
006-108-F10CTGGCCCACCAGGGCCCACGCNONE 
006-108-H05CTGGCCCACCAGGGCCCACGCNONE 
006-110-G11CTGGCCCACCAGGGCCCACGCNONE 
006-111-D10CTGGCCCACCAGGGCCCACGCNONE 
006-111-E03CTGGCCCACCAGGGCCCACGCNONE 
006-111-H01CTGGCCCACCAGGGCCCACGCNONE 
006-113-C12CTGGCCCACCAGGGCCCACGCNONE 
006-114-C10CTGGCCCACCAGGGCCCACGCNONE 
006-115-B02CTGGCCCACCAGGGCCCACGCNONE 
006-117-D11CTGGCCCACCAGGGCCCACGCNONE 
006-117-E01CTGGCCCACCAGGGCCCACGCNONE 
009-131-C02CTGGCCCACCAGGGCCCACGCNONE 
009-133-G05CTGGCCCACCAGGGCCCACGCNONE 
009-152-E01CTGGCCCACCAGGGCCCACGCNONE 
009-154-E08CTGGCCCACCAGGGCCCACGCNONE 
009-196-C11CTGGCCCACCAGGGCCCACGCNONE 
012-010-E10CTGGCCCACCAGGGCCCACGCNONE 
013-018-C05CTGGCCCACCAGGGCCCACGCNONE 
013-074-A06CTGGCCCACCAGGGCCCACGCNONE 
013-078-E06CTGGCCCACCAGGGCCCACGCNONE 
AB009665CTGGCCCACCAGGGCCCACGCNONE 
AF022737CTGGCCCACCAGGGCCCACGCNONE 
AJ224327CTGGCCCACCAGGGCCCACGCNONE 
AK061769CTGGCCCACCAGGGCCCACGCNONE 
AK103807CTGGCCCACCAGGGCCCACGCAquaporin. 
AK104658CTGGCCCACCAGGGCCCACGCNONE 
J013065I12CTGGCCCACCAGGGCCCACGCNONE 
J013067L09CTGGCCCACCAGGGCCCACGCNONE 
J013089I10CTGGCCCACCAGGGCCCACGCNONE 
J013095N22CTGGCCCACCAGGGCCCACGCNONE 
J013130E17CTGGCCCACCAGGGCCCACGCNONE 
J013131A06CTGGCCCACCAGGGCCCACGCNONE 
J013154E06CTGGCCCACCAGGGCCCACGCNONE 
J023004D16CTGGCCCACCAGGGCCCACGCNONE 
J023010A15CTGGCCCACCAGGGCCCACGCNONE 
J023010H04CTGGCCCACCAGGGCCCACGCNONE 
J023049K10CTGGCCCACCAGGGCCCACGCNONE 
J023056H24CTGGCCCACCAGGGCCCACGCNONE 
J023064J12CTGGCCCACCAGGGCCCACGCNONE 
J023078I06CTGGCCCACCAGGGCCCACGCNONE 
J023081D05CTGGCCCACCAGGGCCCACGCNONE 
J023099I19CTGGCCCACCAGGGCCCACGCNONE 
J023100F05CTGGCCCACCAGGGCCCACGCNONE 
J023131F16CTGGCCCACCAGGGCCCACGCNONE 
J033025F16CTGGCCCACCAGGGCCCACGCNONE 
J033028F10CTGGCCCACCAGGGCCCACGCNONE 
J033058H13CTGGCCCACCAGGGCCCACGCNONE 
J033064P18CTGGCCCACCAGGGCCCACGCNONE 
J033070H04CTGGCCCACCAGGGCCCACGCNONE 
J033107P20CTGGCCCACCAGGGCCCACGCNONE 
J033114E09CTGGCCCACCAGGGCCCACGCNONE 
J033125G23CTGGCCCACCAGGGCCCACGCNONE 
J033136G05CTGGCCCACCAGGGCCCACGCNONE 
J033147A07CTGGCCCACCAGGGCCCACGCNONE 
J053048M24CTGGCCCACCAGGGCCCACGCNONE 
J053056K02CTGGCCCACCAGGGCCCACGCNONE 
J053057N24CTGGCCCACCAGGGCCCACGCNONE 
J053060C13CTGGCCCACCAGGGCCCACGCNONE 
J065053C22CTGGCCCACCAGGGCCCACGCNONE 
J065067J11CTGGCCCACCAGGGCCCACGCNONE 
J065085A01CTGGCCCACCAGGGCCCACGCNONE 
J065189K01CTGGCCCACCAGGGCCCACGCNONE 
J075024G24CTGGCCCACCAGGGCCCACGCNONE 
J075060O04CTGGCCCACCAGGGCCCACGCNONE 
J075075M07CTGGCCCACCAGGGCCCACGCNONE 
J075090A10CTGGCCCACCAGGGCCCACGCNONE 
J075110P11CTGGCCCACCAGGGCCCACGCNONE 
J075114H02CTGGCCCACCAGGGCCCACGCNONE 
J075127L13CTGGCCCACCAGGGCCCACGCNONE 
J075151B19CTGGCCCACCAGGGCCCACGCNONE 
J075187M17CTGGCCCACCAGGGCCCACGCNONE 
J075198E22CTGGCCCACCAGGGCCCACGCNONE 
J080006J20CTGGCCCACCAGGGCCCACGCNONE 
J080081J10CTGGCCCACCAGGGCCCACGCNONE 
J080087C03CTGGCCCACCAGGGCCCACGCNONE 
J090029E22CTGGCCCACCAGGGCCCACGCNONE 
J090037C19CTGGCCCACCAGGGCCCACGCNONE 
J090037P10CTGGCCCACCAGGGCCCACGCNONE 
J090047M10CTGGCCCACCAGGGCCCACGCNONE 
J090055K05CTGGCCCACCAGGGCCCACGCNONE 
J090057N19CTGGCCCACCAGGGCCCACGCNONE 
J090062M13CTGGCCCACCAGGGCCCACGCNONE 
J090066F22CTGGCCCACCAGGGCCCACGCNONE 
J090066N12CTGGCCCACCAGGGCCCACGCNONE 
J090071K08CTGGCCCACCAGGGCCCACGCNONE 
J090080F16CTGGCCCACCAGGGCCCACGCNONE 
J090081J21CTGGCCCACCAGGGCCCACGCNONE 
J090083F22CTGGCCCACCAGGGCCCACGCNONE 
J090083I12CTGGCCCACCAGGGCCCACGCNONE 
J090088B16CTGGCCCACCAGGGCCCACGCNONE 
J090088E01CTGGCCCACCAGGGCCCACGCNONE 
J090091C11CTGGCCCACCAGGGCCCACGCNONE 
J090091F17CTGGCCCACCAGGGCCCACGCNONE 
J090097A05CTGGCCCACCAGGGCCCACGCNONE 
J090098B15CTGGCCCACCAGGGCCCACGCNONE 
J100018B04CTGGCCCACCAGGGCCCACGCNONE 
J100021J08CTGGCCCACCAGGGCCCACGCNONE 
J100026M12CTGGCCCACCAGGGCCCACGCNONE 
J100032F02CTGGCCCACCAGGGCCCACGCNONE 
J100034B03CTGGCCCACCAGGGCCCACGCNONE 
J100037D13CTGGCCCACCAGGGCCCACGCNONE 
J100041C16CTGGCCCACCAGGGCCCACGCNONE 
J100044D14CTGGCCCACCAGGGCCCACGCNONE 
J100044E21CTGGCCCACCAGGGCCCACGCNONE 
J100047M16CTGGCCCACCAGGGCCCACGCNONE 
J100051D22CTGGCCCACCAGGGCCCACGCNONE 
J100056M13CTGGCCCACCAGGGCCCACGCNONE 
J100061J12CTGGCCCACCAGGGCCCACGCNONE 
J100065A22CTGGCCCACCAGGGCCCACGCNONE 
J100067L12CTGGCCCACCAGGGCCCACGCNONE 
J100068F06CTGGCCCACCAGGGCCCACGCNONE 
J100070C24CTGGCCCACCAGGGCCCACGCNONE 
J100072N09CTGGCCCACCAGGGCCCACGCNONE 
J100073A10CTGGCCCACCAGGGCCCACGCNONE 
J100073B15CTGGCCCACCAGGGCCCACGCNONE 
J100077F05CTGGCCCACCAGGGCCCACGCNONE 
J100078B03CTGGCCCACCAGGGCCCACGCNONE 
J100078F01CTGGCCCACCAGGGCCCACGCNONE 
J100079B08CTGGCCCACCAGGGCCCACGCNONE 
J100083J06CTGGCCCACCAGGGCCCACGCNONE 
Os02g0725100AK071759ACTGACAGGTGTGGCCCACTNONE 
Os02g0741100AK068712TGTGGGCCACSimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK071144TGTGGGCCACNONE 
J065056A02TGTGGGCCACNONE 
J065212F10TGTGGGCCACNONE 
J080005J10TGTGGGCCACNONE 
J080013A11TGTGGGCCACNONE 
J080015E01TGTGGGCCACNONE 
J080022G23TGTGGGCCACNONE 
J080025C13TGTGGGCCACNONE 
J080026P14TGTGGGCCACNONE 
J080027D22TGTGGGCCACNONE 
J080027G13TGTGGGCCACNONE 
J080027L23TGTGGGCCACNONE 
J080027N23TGTGGGCCACNONE 
J080028F21TGTGGGCCACNONE 
J080028J18TGTGGGCCACNONE 
J080028P22TGTGGGCCACNONE 
J080038P04TGTGGGCCACNONE 
J080042M11TGTGGGCCACNONE 
J080043B19TGTGGGCCACNONE 
J080045J23TGTGGGCCACNONE 
J080047B06TGTGGGCCACNONE 
J080052F04TGTGGGCCACNONE 
J080057F01TGTGGGCCACNONE 
J080057G03TGTGGGCCACNONE 
J080060H12TGTGGGCCACNONE 
J080061L12TGTGGGCCACNONE 
J080062J17TGTGGGCCACNONE 
J080062M22TGTGGGCCACNONE 
J080072C01TGTGGGCCACNONE 
J080075F01TGTGGGCCACNONE 
J080076A09TGTGGGCCACNONE 
J080076I01TGTGGGCCACNONE 
J080077D01TGTGGGCCACNONE 
J080077F19TGTGGGCCACNONE 
J080079L19TGTGGGCCACNONE 
J080088B03TGTGGGCCACNONE 
J080090J15TGTGGGCCACNONE 
J080092J21TGTGGGCCACNONE 
J080095J12TGTGGGCCACNONE 
J090012C05TGTGGGCCACNONE 
J090039K19TGTGGGCCACNONE 
J090078L12TGTGGGCCACNONE 
Os02g0744700AF395537ATGGCCCACCCNONE 
AJ308110ATGGCCCACCCNONE 
AK066446ATGGCCCACCCSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0755900011-077-A03AGGTGGGCCATNONE 
015-066-D06AGGTGGGCCATNONE 
AK073587AGGTGGGCCATNONE 
AK104985AGGTGGGCCATSimilar to Glucosyltransferase (Fragment). 
J033052B15AGGTGGGCCATNONE 
Os02g0762300AK106684TTGGCCCACAProtein of unknown function UPF0021 family protein. 
J090060M09TTGGCCCACANONE 
J100083E05TTGGCCCACANONE 
Os02g0771700011-075-D10CTGGCCCACTNONE 
011-086-E10CTGGCCCACTNONE 
AK058571CTGGCCCACTGlycoside hydrolase, family 17 protein. 
AK102185CTGGCCCACTNONE 
J023001D03CTGGCCCACTNONE 
J023041N11CTGGCCCACTNONE 
J033086N13CTGGCCCACTNONE 
J033106K14CTGGCCCACTNONE 
J033125P22CTGGCCCACTNONE 
Os02g0785800005-017-E01TTGGCCCACTNONE 
009-104-F05TTGGCCCACTNONE 
009-149-A09TTGGCCCACTNONE 
009-192-D08TTGGCCCACTNONE 
AK063859TTGGCCCACTNONE 
AK121768TTGGCCCACTSimilar to Ribosomal protein L35A. 
J013037M21TTGGCCCACTNONE 
J023009A11TTGGCCCACTNONE 
J023010P14TTGGCCCACTNONE 
J033092B03TTGGCCCACTNONE 
J065009O06TTGGCCCACTNONE 
J065024K14TTGGCCCACTNONE 
J065053F16TTGGCCCACTNONE 
J065056D18TTGGCCCACTNONE 
J065056N12TTGGCCCACTNONE 
J065071L21TTGGCCCACTNONE 
J065075M21TTGGCCCACTNONE 
J065087D19TTGGCCCACTNONE 
J065111N01TTGGCCCACTNONE 
J065172M05TTGGCCCACTNONE 
J065176E03TTGGCCCACTNONE 
J065184D08TTGGCCCACTNONE 
J065188K21TTGGCCCACTNONE 
J065194I05TTGGCCCACTNONE 
J065196E09TTGGCCCACTNONE 
J065196O21TTGGCCCACTNONE 
J065204O06TTGGCCCACTNONE 
J065212J02TTGGCCCACTNONE 
J075066H03TTGGCCCACTNONE 
J075067C04TTGGCCCACTNONE 
J075070I09TTGGCCCACTNONE 
J075081J03TTGGCCCACTNONE 
J075086I05TTGGCCCACTNONE 
J075092E09TTGGCCCACTNONE 
J075096D13TTGGCCCACTNONE 
J075098A12TTGGCCCACTNONE 
J075110B18TTGGCCCACTNONE 
J075116E14TTGGCCCACTNONE 
J075117J23TTGGCCCACTNONE 
J075117O16TTGGCCCACTNONE 
J075130H10TTGGCCCACTNONE 
J075151B07TTGGCCCACTNONE 
J075156C02TTGGCCCACTNONE 
J075159C07TTGGCCCACTNONE 
J075172O12TTGGCCCACTNONE 
J075181K16TTGGCCCACTNONE 
J075185J05TTGGCCCACTNONE 
J075186D14TTGGCCCACTNONE 
J075187F23TTGGCCCACTNONE 
J075193B15TTGGCCCACTNONE 
J075194P20TTGGCCCACTNONE 
J090002B21TTGGCCCACTNONE 
J090018E03TTGGCCCACTNONE 
J090029I04TTGGCCCACTNONE 
J090065F12TTGGCCCACTNONE 
J090066M05TTGGCCCACTNONE 
J090078A20TTGGCCCACTNONE 
J090084O15TTGGCCCACTNONE 
J090088P20TTGGCCCACTNONE 
J090098L20TTGGCCCACTNONE 
J100025B19TTGGCCCACTNONE 
J100038H15TTGGCCCACTNONE 
J100045H17TTGGCCCACTNONE 
J100058E17TTGGCCCACTNONE 
J100060O16TTGGCCCACTNONE 
J100067I10TTGGCCCACTNONE 
J100082N24TTGGCCCACTNONE 
J100083C17TTGGCCCACTNONE 
J100085I24TTGGCCCACTNONE 
J100087K20TTGGCCCACTNONE 
Os02g0792800AK105616GCGTGGGCCACSimilar to Rieske iron-sulfur protein Tic55 precursor. 
AK120704GCGTGGGCCACNONE 
J075134O14GCGTGGGCCACNONE 
Os02g0800000J100043O08AGTGGGCCAANONE 
J100064O18AGTGGGCCAANONE 
Os02g0812500AK106918GTGGCGTGGGCCACCyclin-like F-box domain containing protein. 
Os02g0817500AK072707ATGGCCCACCTGTCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135ATGGCCCACCTGTCNONE 
U46758ATGGCCCACCTGTCNONE 
Os02g0818000005-003-E01TGGTGGGCCAGNONE 
006-055-D08TGGTGGGCCAGNONE 
006-060-D05TGGTGGGCCAGNONE 
006-086-H02TGGTGGGCCAGNONE 
006-091-B04TGGTGGGCCAGNONE 
009-152-H12TGGTGGGCCAGNONE 
009-184-D08TGGTGGGCCAGNONE 
AK071580TGGTGGGCCAGNONE 
AK104103TGGTGGGCCAGNONE 
AK104525TGGTGGGCCAGNONE 
AK104684TGGTGGGCCAGNONE 
AK104947TGGTGGGCCAGNONE 
J013032M21TGGTGGGCCAGNONE 
J013032M22TGGTGGGCCAGNONE 
J013044P09TGGTGGGCCAGNONE 
J013056P03TGGTGGGCCAGNONE 
J013070P08TGGTGGGCCAGNONE 
J013106H15TGGTGGGCCAGNONE 
J013146O03TGGTGGGCCAGNONE 
J013170F21TGGTGGGCCAGNONE 
J023038I01TGGTGGGCCAGNONE 
J023049P19TGGTGGGCCAGNONE 
J023106O04TGGTGGGCCAGNONE 
J053100K06TGGTGGGCCAGNONE 
J075026E09TGGTGGGCCAGNONE 
J075043L03TGGTGGGCCAGNONE 
J075049B11TGGTGGGCCAGNONE 
J080301G04TGGTGGGCCAGNONE 
J080305H10TGGTGGGCCAGNONE 
J080308H05TGGTGGGCCAGNONE 
J080311I19TGGTGGGCCAGNONE 
J080315G02TGGTGGGCCAGNONE 
J080315J24TGGTGGGCCAGNONE 
J080316D10TGGTGGGCCAGNONE 
J080317H09TGGTGGGCCAGNONE 
J080317J05TGGTGGGCCAGNONE 
J080318H15TGGTGGGCCAGNONE 
J090047M14TGGTGGGCCAGNONE 
J100025F05TGGTGGGCCAGNONE 
J100060C16TGGTGGGCCAGNONE 
J100064H07TGGTGGGCCAGNONE 
J100075N11TGGTGGGCCAGNONE 
J100081E01TGGTGGGCCAGNONE 
J100085G12TGGTGGGCCAGNONE 
Os02g0831800009-150-D09GTTGGTGGGCCATNONE 
AK060519GTTGGTGGGCCATSimilar to 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2. 
J075143E03GTTGGTGGGCCATNONE 
J100077H12GTTGGTGGGCCATNONE 
Os03g0126900AK109217GTGGCGTGGGCCAAConserved hypothetical protein. 
J065085G16GTGGCGTGGGCCAANONE 
J100086C03GTGGCGTGGGCCAANONE 
Os03g0146500006-036-F10TTGGCCCACCTGNONE 
006-082-C03TTGGCCCACCTGNONE 
006-098-E04TTGGCCCACCTGNONE 
006-110-C03TTGGCCCACCTGNONE 
009-057-C11TTGGCCCACCTGNONE 
009-182-D02TTGGCCCACCTGNONE 
AK059776TTGGCCCACCTGGalactose-binding like domain containing protein. 
AK071628TTGGCCCACCTGNONE 
AK104105TTGGCCCACCTGNONE 
AK104220TTGGCCCACCTGNONE 
J065168B02TTGGCCCACCTGNONE 
Os03g0151800AK064955CGCGTGGGCCACNONE 
AK098874CGCGTGGGCCACNONE 
AK098980CGCGTGGGCCACNONE 
AK099712CGCGTGGGCCACNONE 
AK099889CGCGTGGGCCACNONE 
AK121641CGCGTGGGCCACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05CGCGTGGGCCACNONE 
J013001D04CGCGTGGGCCACNONE 
J013121O12CGCGTGGGCCACNONE 
Os03g0249200009-103-B08GTGGCCCACACNONE 
AK069944GTGGCCCACACClass I peptide chain release factor domain containing protein. 
J065166E13GTGGCCCACACNONE 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
Os03g0266300006-027-H06ATGGCCCACANONE 
013-051-G08ATGGCCCACANONE 
014-002-C05ATGGCCCACANONE 
014-002-H02ATGGCCCACANONE 
014-005-A09ATGGCCCACANONE 
014-008-D02ATGGCCCACANONE 
014-008-G06ATGGCCCACANONE 
014-009-C12ATGGCCCACANONE 
014-010-A07ATGGCCCACANONE 
014-012-H03ATGGCCCACANONE 
014-013-E03ATGGCCCACANONE 
014-014-D03ATGGCCCACANONE 
014-028-C09ATGGCCCACANONE 
014-037-G05ATGGCCCACANONE 
014-038-E04ATGGCCCACANONE 
014-041-F08ATGGCCCACANONE 
014-049-E11ATGGCCCACANONE 
014-050-A05ATGGCCCACANONE 
014-053-F10ATGGCCCACANONE 
014-054-C04ATGGCCCACANONE 
014-056-A01ATGGCCCACANONE 
014-060-A08ATGGCCCACANONE 
014-072-C09ATGGCCCACANONE 
014-072-D02ATGGCCCACANONE 
014-077-G08ATGGCCCACANONE 
014-080-C10ATGGCCCACANONE 
014-098-E01ATGGCCCACANONE 
014-100-C02ATGGCCCACANONE 
014-100-E03ATGGCCCACANONE 
014-100-E10ATGGCCCACANONE 
015-061-D06ATGGCCCACANONE 
016-033-H10ATGGCCCACANONE 
AB110191ATGGCCCACANONE 
AF467729ATGGCCCACANONE 
AK073671ATGGCCCACANONE 
AK104129ATGGCCCACAClass I low-molecular-weight heat shock protein 17.9. 
AK119239ATGGCCCACANONE 
AK119616ATGGCCCACANONE 
AK119664ATGGCCCACANONE 
AK119675ATGGCCCACANONE 
D21285ATGGCCCACANONE 
J033051H23ATGGCCCACANONE 
J065036L24ATGGCCCACANONE 
J065045J20ATGGCCCACANONE 
J065104C03ATGGCCCACANONE 
J065109J20ATGGCCCACANONE 
J065116F24ATGGCCCACANONE 
J065146F06ATGGCCCACANONE 
J065146P18ATGGCCCACANONE 
J065167A09ATGGCCCACANONE 
J065183K12ATGGCCCACANONE 
J075019J15ATGGCCCACANONE 
J075112F10ATGGCCCACANONE 
J075150H04ATGGCCCACANONE 
J075159N20ATGGCCCACANONE 
J075164P19ATGGCCCACANONE 
J075185O05ATGGCCCACANONE 
J100030A19ATGGCCCACANONE 
J100044E07ATGGCCCACANONE 
Os03g0270700AK119531TGGTGGGCCAANONE 
Os03g0275700AK111329GTGGCCCACGCConserved hypothetical protein. 
Os03g0275900AK109303GTGGCCCACTNONE 
AK121978GTGGCCCACTSimilar to Spotted leaf protein 11 (Spotted leaf11) (Cell death-related protein SPL11). 
Os03g0277000AK100522GTGGCCCACGGSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0284500012-066-D02GTGGCCCACATGTCAGTGNONE 
AK105295GTGGCCCACATGTCAGTGNONE 
AK121300GTGGCCCACATGTCAGTGHAD-superfamily subfamily IIA hydrolase, CECR5 protein. 
Os03g0284600AK110712CACTGACATGTGGGCCACThioredoxin fold domain containing protein. 
Os03g0295500009-083-F02TGTGGGCCAGANONE 
J053029J05TGTGGGCCAGANONE 
J053054B07TGTGGGCCAGACHCH domain containing protein. 
J065024G23TGTGGGCCAGANONE 
J065036F08TGTGGGCCAGANONE 
J065066M11TGTGGGCCAGANONE 
J065143G19TGTGGGCCAGANONE 
Os03g0298300AK061180AGTGGGCCAGProtein of unknown function DUF588 family protein. 
AK099089AGTGGGCCAGNONE 
Os03g0310800009-126-C10CACGTGGGCCACNONE 
009-156-D02CACGTGGGCCACNONE 
AK058663CACGTGGGCCACNONE 
AK099476CACGTGGGCCACSimilar to Hypersensitive reaction associated Ca2+-binding protein. 
J065084G15CACGTGGGCCACNONE 
J075046C12CACGTGGGCCACNONE 
J075058D24CACGTGGGCCACNONE 
J075151M03CACGTGGGCCACNONE 
J075151M04CACGTGGGCCACNONE 
J075153I20CACGTGGGCCACNONE 
J075167J05CACGTGGGCCACNONE 
J075179G06CACGTGGGCCACNONE 
J100025I19CACGTGGGCCACNONE 
J100025L21CACGTGGGCCACNONE 
J100029C06CACGTGGGCCACNONE 
J100068E24CACGTGGGCCACNONE 
J100070F10CACGTGGGCCACNONE 
J100083H23CACGTGGGCCACNONE 
J100089H10CACGTGGGCCACNONE 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0340500012-007-F10CACGTGGGCCATNONE 
AK099406CACGTGGGCCATNONE 
AK102158CACGTGGGCCATSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13CACGTGGGCCATNONE 
J013063E02CACGTGGGCCATNONE 
J013063I02CACGTGGGCCATNONE 
J013157O07CACGTGGGCCATNONE 
J023131N05CACGTGGGCCATNONE 
J033033P05CACGTGGGCCATNONE 
J033040N16CACGTGGGCCATNONE 
J033044M19CACGTGGGCCATNONE 
J033086F24CACGTGGGCCATNONE 
J033097H01CACGTGGGCCATNONE 
J033106C22CACGTGGGCCATNONE 
J033128M13CACGTGGGCCATNONE 
J033133I15CACGTGGGCCATNONE 
J043027A21CACGTGGGCCATNONE 
J090028A09CACGTGGGCCATNONE 
J090053D06CACGTGGGCCATNONE 
J090083O17CACGTGGGCCATNONE 
J090099H10CACGTGGGCCATNONE 
J100036M05CACGTGGGCCATNONE 
Os03g0342900006-032-D01AGGTGGGCCACCCCACGTGNONE 
006-032-D01CTGGCCCACCTCGCCCCACGNONE 
006-033-E10AGGTGGGCCACCCCACGTGNONE 
006-033-E10CTGGCCCACCTCGCCCCACGNONE 
006-051-G06AGGTGGGCCACCCCACGTGNONE 
006-051-G06CTGGCCCACCTCGCCCCACGNONE 
006-053-E05AGGTGGGCCACCCCACGTGNONE 
006-053-E05CTGGCCCACCTCGCCCCACGNONE 
006-056-B05AGGTGGGCCACCCCACGTGNONE 
006-056-B05CTGGCCCACCTCGCCCCACGNONE 
006-058-F04AGGTGGGCCACCCCACGTGNONE 
006-058-F04CTGGCCCACCTCGCCCCACGNONE 
006-059-E05AGGTGGGCCACCCCACGTGNONE 
006-059-E05CTGGCCCACCTCGCCCCACGNONE 
006-060-F10AGGTGGGCCACCCCACGTGNONE 
006-060-F10CTGGCCCACCTCGCCCCACGNONE 
006-104-D12AGGTGGGCCACCCCACGTGNONE 
006-104-D12CTGGCCCACCTCGCCCCACGNONE 
009-129-C12AGGTGGGCCACCCCACGTGNONE 
009-129-C12CTGGCCCACCTCGCCCCACGNONE 
AK060136AGGTGGGCCACCCCACGTGNONE 
AK060136CTGGCCCACCTCGCCCCACGNONE 
AK060980AGGTGGGCCACCCCACGTGNONE 
AK060980CTGGCCCACCTCGCCCCACGNONE 
AK064815AGGTGGGCCACCCCACGTGDormancyauxin associated family protein. 
AK064815CTGGCCCACCTCGCCCCACGDormancyauxin associated family protein. 
AK104244AGGTGGGCCACCCCACGTGNONE 
AK104244CTGGCCCACCTCGCCCCACGNONE 
AK104391AGGTGGGCCACCCCACGTGNONE 
AK104391CTGGCCCACCTCGCCCCACGNONE 
AK104590AGGTGGGCCACCCCACGTGNONE 
AK104590CTGGCCCACCTCGCCCCACGNONE 
AK104744AGGTGGGCCACCCCACGTGNONE 
AK104744CTGGCCCACCTCGCCCCACGNONE 
AK106100AGGTGGGCCACCCCACGTGNONE 
AK106100CTGGCCCACCTCGCCCCACGNONE 
J013000E10AGGTGGGCCACCCCACGTGNONE 
J013000E10CTGGCCCACCTCGCCCCACGNONE 
J075027O22AGGTGGGCCACCCCACGTGNONE 
J075027O22CTGGCCCACCTCGCCCCACGNONE 
J075052J03AGGTGGGCCACCCCACGTGNONE 
J075052J03CTGGCCCACCTCGCCCCACGNONE 
J075066E15AGGTGGGCCACCCCACGTGNONE 
J075066E15CTGGCCCACCTCGCCCCACGNONE 
J075095C17AGGTGGGCCACCCCACGTGNONE 
J075095C17CTGGCCCACCTCGCCCCACGNONE 
J075118N05AGGTGGGCCACCCCACGTGNONE 
J075118N05CTGGCCCACCTCGCCCCACGNONE 
J075187K22AGGTGGGCCACCCCACGTGNONE 
J075187K22CTGGCCCACCTCGCCCCACGNONE 
J090026L04AGGTGGGCCACCCCACGTGNONE 
J090026L04CTGGCCCACCTCGCCCCACGNONE 
J090059G16AGGTGGGCCACCCCACGTGNONE 
J090059G16CTGGCCCACCTCGCCCCACGNONE 
J100055P20AGGTGGGCCACCCCACGTGNONE 
J100055P20CTGGCCCACCTCGCCCCACGNONE 
J100062A10AGGTGGGCCACCCCACGTGNONE 
J100062A10CTGGCCCACCTCGCCCCACGNONE 
J100068G20AGGTGGGCCACCCCACGTGNONE 
J100068G20CTGGCCCACCTCGCCCCACGNONE 
Os03g0379300006-039-F11CTGGCCCACCACNONE 
AK061515CTGGCCCACCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704CTGGCCCACCACNONE 
J013159M16CTGGCCCACCACNONE 
J090067F01CTGGCCCACCACNONE 
J090083F21CTGGCCCACCACNONE 
J100040M08CTGGCCCACCACNONE 
J100048C03CTGGCCCACCACNONE 
J100056M07CTGGCCCACCACNONE 
J100062N22CTGGCCCACCACNONE 
J100086L07CTGGCCCACCACNONE 
Os03g0565600J090030D24TGTGGGCCATNONE 
Os03g0606200009-030-E09TCTGGCCCACGTGNONE 
009-076-H10TCTGGCCCACGTGNONE 
009-122-H12TCTGGCCCACGTGNONE 
009-153-F09TCTGGCCCACGTGNONE 
AB055076TCTGGCCCACGTGMitochondrial ATP synthase 6 KD subunit. 
AK072384TCTGGCCCACGTGNONE 
AK107928TCTGGCCCACGTGNONE 
J023078E13TCTGGCCCACGTGNONE 
J053031N01TCTGGCCCACGTGNONE 
J053046K19TCTGGCCCACGTGNONE 
J053062P07TCTGGCCCACGTGNONE 
J053091C23TCTGGCCCACGTGNONE 
J053099N19TCTGGCCCACGTGNONE 
J065005E06TCTGGCCCACGTGNONE 
J065030N03TCTGGCCCACGTGNONE 
J065138O21TCTGGCCCACGTGNONE 
J065159K03TCTGGCCCACGTGNONE 
J075030M08TCTGGCCCACGTGNONE 
J080006E23TCTGGCCCACGTGNONE 
J080010D10TCTGGCCCACGTGNONE 
J080016N17TCTGGCCCACGTGNONE 
J080024N09TCTGGCCCACGTGNONE 
J080028E23TCTGGCCCACGTGNONE 
J080035I11TCTGGCCCACGTGNONE 
J080038D15TCTGGCCCACGTGNONE 
J080040H08TCTGGCCCACGTGNONE 
J080043L04TCTGGCCCACGTGNONE 
J080047C06TCTGGCCCACGTGNONE 
J080061G04TCTGGCCCACGTGNONE 
J080066E10TCTGGCCCACGTGNONE 
J080067P03TCTGGCCCACGTGNONE 
J080082D07TCTGGCCCACGTGNONE 
J080089M13TCTGGCCCACGTGNONE 
J080094O09TCTGGCCCACGTGNONE 
J080095C24TCTGGCCCACGTGNONE 
J080309E21TCTGGCCCACGTGNONE 
J090016G15TCTGGCCCACGTGNONE 
J090031C20TCTGGCCCACGTGNONE 
J090033A15TCTGGCCCACGTGNONE 
J090037L07TCTGGCCCACGTGNONE 
J090038I10TCTGGCCCACGTGNONE 
J090072P19TCTGGCCCACGTGNONE 
J100040J02TCTGGCCCACGTGNONE 
J100047N05TCTGGCCCACGTGNONE 
J100048M10TCTGGCCCACGTGNONE 
J100076C02TCTGGCCCACGTGNONE 
J100077G23TCTGGCCCACGTGNONE 
J100080O08TCTGGCCCACGTGNONE 
J100085C06TCTGGCCCACGTGNONE 
J100085F16TCTGGCCCACGTGNONE 
Os03g0607200013-002-F05GCGTGGGCCACNONE 
013-021-H08GCGTGGGCCACNONE 
013-038-E10GCGTGGGCCACNONE 
014-009-E05GCGTGGGCCACNONE 
014-034-H01GCGTGGGCCACNONE 
014-038-A08GCGTGGGCCACNONE 
014-072-G08GCGTGGGCCACNONE 
014-083-B06GCGTGGGCCACNONE 
014-088-G10GCGTGGGCCACNONE 
AK070268GCGTGGGCCACGibberellin regulated protein family protein. 
J023044E14GCGTGGGCCACNONE 
J065199F02GCGTGGGCCACNONE 
J075001C09GCGTGGGCCACNONE 
J075019F02GCGTGGGCCACNONE 
J075061J21GCGTGGGCCACNONE 
J075068G03GCGTGGGCCACNONE 
J075126F10GCGTGGGCCACNONE 
J075153F19GCGTGGGCCACNONE 
J080305I04GCGTGGGCCACNONE 
J080307F24GCGTGGGCCACNONE 
J080312E23GCGTGGGCCACNONE 
J080315M20GCGTGGGCCACNONE 
J080317E18GCGTGGGCCACNONE 
J090043I11GCGTGGGCCACNONE 
Os03g0698900013-074-A08TCGTGGGCCACGTCNONE 
AK073303TCGTGGGCCACGTCAlkaline phytoceramidase family protein. 
AK103953TCGTGGGCCACGTCNONE 
J033024P22TCGTGGGCCACGTCNONE 
J065194N16TCGTGGGCCACGTCNONE 
J065195O11TCGTGGGCCACGTCNONE 
J075020F03TCGTGGGCCACGTCNONE 
J075032P18TCGTGGGCCACGTCNONE 
J075037H13TCGTGGGCCACGTCNONE 
J075147I01TCGTGGGCCACGTCNONE 
J075187B13TCGTGGGCCACGTCNONE 
J100043G08TCGTGGGCCACGTCNONE 
J100060L06TCGTGGGCCACGTCNONE 
J100063O21TCGTGGGCCACGTCNONE 
J100066O13TCGTGGGCCACGTCNONE 
J100072K20TCGTGGGCCACGTCNONE 
J100083G21TCGTGGGCCACGTCNONE 
J100085D07TCGTGGGCCACGTCNONE 
Os03g0701700011-034-E06CCCGTGGGCCACNONE 
AF013979CCCGTGGGCCACNONE 
AK065161CCCGTGGGCCACSimilar to Ethylene receptor. 
AK067813CCCGTGGGCCACNONE 
J013002C04CCCGTGGGCCACNONE 
J013035M07CCCGTGGGCCACNONE 
J013049B10CCCGTGGGCCACNONE 
J013065F11CCCGTGGGCCACNONE 
J013072K18CCCGTGGGCCACNONE 
J013073P08CCCGTGGGCCACNONE 
J013098F08CCCGTGGGCCACNONE 
J013154M13CCCGTGGGCCACNONE 
J023001H02CCCGTGGGCCACNONE 
J023003D16CCCGTGGGCCACNONE 
J023014P17CCCGTGGGCCACNONE 
J023036A22CCCGTGGGCCACNONE 
J023038N01CCCGTGGGCCACNONE 
J023042E11CCCGTGGGCCACNONE 
J023058O05CCCGTGGGCCACNONE 
J023084D05CCCGTGGGCCACNONE 
J023088O17CCCGTGGGCCACNONE 
J023138O11CCCGTGGGCCACNONE 
J023147A10CCCGTGGGCCACNONE 
J033029G18CCCGTGGGCCACNONE 
J033031N13CCCGTGGGCCACNONE 
J033090D09CCCGTGGGCCACNONE 
J033091I06CCCGTGGGCCACNONE 
J033096B20CCCGTGGGCCACNONE 
J033101A19CCCGTGGGCCACNONE 
J033135D03CCCGTGGGCCACNONE 
J043001L13CCCGTGGGCCACNONE 
J043020A13CCCGTGGGCCACNONE 
J053071K24CCCGTGGGCCACNONE 
J053092L14CCCGTGGGCCACNONE 
J053099F19CCCGTGGGCCACNONE 
J065009P22CCCGTGGGCCACNONE 
J065046A22CCCGTGGGCCACNONE 
J065099K22CCCGTGGGCCACNONE 
J065112O22CCCGTGGGCCACNONE 
J065119K11CCCGTGGGCCACNONE 
J065212B11CCCGTGGGCCACNONE 
J090022A11CCCGTGGGCCACNONE 
J090054F15CCCGTGGGCCACNONE 
J090076B20CCCGTGGGCCACNONE 
J090099M22CCCGTGGGCCACNONE 
J100032L01CCCGTGGGCCACNONE 
J100065H13CCCGTGGGCCACNONE 
Os03g0712600015-008-G03CGCGTGGGCCTGGCCCACTNONE 
AK103705CGCGTGGGCCTGGCCCACTHypothetical protein. 
J033136N14CGCGTGGGCCTGGCCCACTNONE 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
Os03g0725400015-060-D03TTGGCCCACTNONE 
AK105499TTGGCCCACTSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860TTGGCCCACTNONE 
AK112085TTGGCCCACTNONE 
J100068K06TTGGCCCACTNONE 
J100073K24TTGGCCCACTNONE 
J100084M24TTGGCCCACTNONE 
Os03g0746600AK069559ACGTGGGCCACWD40-like domain containing protein. 
J023141K22ACGTGGGCCACNONE 
Os03g0752800AB041020ATGGCCCACCCNONE 
AF058697ATGGCCCACCCMADS14 protein. 
AF139664ATGGCCCACCCNONE 
AK121171ATGGCCCACCCNONE 
AY332478ATGGCCCACCCNONE 
AY551916ATGGCCCACCCNONE 
J023081C04ATGGCCCACCCNONE 
Os03g0791800013-037-A12CAGGTGGGCCATNONE 
AB079798CAGGTGGGCCATNONE 
AK067703CAGGTGGGCCATRad6 (Ubiquitin carrier protein). 
AK120251CAGGTGGGCCATNONE 
J013045G10CAGGTGGGCCATNONE 
J023102B18CAGGTGGGCCATNONE 
J065020J23CAGGTGGGCCATNONE 
J065127I21CAGGTGGGCCATNONE 
J065151E11CAGGTGGGCCATNONE 
J075076B05CAGGTGGGCCATNONE 
J075116C15CAGGTGGGCCATNONE 
J075136A07CAGGTGGGCCATNONE 
J100029G21CAGGTGGGCCATNONE 
J100030K01CAGGTGGGCCATNONE 
J100041J02CAGGTGGGCCATNONE 
J100049C22CAGGTGGGCCATNONE 
J100057G17CAGGTGGGCCATNONE 
J100086L12CAGGTGGGCCATNONE 
Os03g0824500AK058990TTGGCCCACCAConserved hypothetical protein. 
J065057L18TTGGCCCACCANONE 
J065083L02TTGGCCCACCANONE 
J065086L24TTGGCCCACCANONE 
J065121L10TTGGCCCACCANONE 
J065168N03TTGGCCCACCANONE 
J100035J22TTGGCCCACCANONE 
J100050G18TTGGCCCACCANONE 
J100055F15TTGGCCCACCANONE 
Os03g0829000AK071107TTGTGGGCCATFumarylacetoacetate (FAA) hydrolase family protein. 
AK109501TTGTGGGCCATNONE 
AK121596TTGTGGGCCATNONE 
J065045C17TTGTGGGCCATNONE 
J065068E23TTGTGGGCCATNONE 
J065083N15TTGTGGGCCATNONE 
J065166P10TTGTGGGCCATNONE 
J065189B13TTGTGGGCCATNONE 
J090082J08TTGTGGGCCATNONE 
J100030P13TTGTGGGCCATNONE 
Os03g0832200AK070712CCCGTGGGCCAGSimilar to Calcium-binding protein precursor (Calreticulin). 
AK070712GGCCGTGGGCCATSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0832600AK120137CGTGTGGGCCAGSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os03g0843400009-195-F11TTGGCCCACTNONE 
AK061198TTGGCCCACTSimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076TTGGCCCACTNONE 
Os03g0852000009-105-G08TGTGGGCCACNONE 
AK063830TGTGGGCCACNONE 
AK100922TGTGGGCCACConserved hypothetical protein. 
J023133O06TGTGGGCCACNONE 
Os04g0387600009-148-E01ATGGCCCACCCGNONE 
009-155-A11ATGGCCCACCCGNONE 
009-175-F04ATGGCCCACCCGNONE 
AK063862ATGGCCCACCCGConserved hypothetical protein. 
J065035F12ATGGCCCACCCGNONE 
J065162C13ATGGCCCACCCGNONE 
J065169L19ATGGCCCACCCGNONE 
Os04g0445100014-052-B04GTGGCCCACGANONE 
AK063700GTGGCCCACGASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0475500Os04g0475500CTGGCCCACCCConserved hypothetical protein. 
Os04g0479800AK121430TGGTGGGCCATCyclin-like F-box domain containing protein. 
J033099N03TGGTGGGCCATNONE 
J090035E10TGGTGGGCCATNONE 
Os04g0486500AK111976GAAGCCCACTGGCCCACCGCCCACACGACCGTTGSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0521800006-043-D11ATGGCCCACTNONE 
AK061536ATGGCCCACTNONE 
AK102934ATGGCCCACTPeptidase M20 family protein. 
AK103369ATGGCCCACTNONE 
Os04g0529600Os04g0529600TCTGGCCCACACGTCACLanthionine synthetase C-like family protein. 
Os04g0530300009-053-E04GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
009-074-E03GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
AK066705GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGConserved hypothetical protein. 
Os04g0530400AK067634CACTGACATGTGGGCCAGCAGCCCAGCACGTGTCt-snare domain containing protein. 
Os04g0531300016-006-E10TGGTGGGCCACNONE 
AK072647TGGTGGGCCACDihydrouridine synthase, DuS family protein. 
AK103911TGGTGGGCCACNONE 
J013038P22TGGTGGGCCACNONE 
J023130D01TGGTGGGCCACNONE 
J033150P13TGGTGGGCCACNONE 
J043026L14TGGTGGGCCACNONE 
J065049A08TGGTGGGCCACNONE 
J065215C17TGGTGGGCCACNONE 
Os04g0550200AK108473CTGGCCCACAAPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0556300009-065-A04CGCGTGGGCCACACGNONE 
009-124-C05CGCGTGGGCCACACGNONE 
AK062772CGCGTGGGCCACACGGlutathione peroxidase. 
AY100689CGCGTGGGCCACACGNONE 
J065008N06CGCGTGGGCCACACGNONE 
J065012C13CGCGTGGGCCACACGNONE 
J065017J06CGCGTGGGCCACACGNONE 
J065033M15CGCGTGGGCCACACGNONE 
J065086O21CGCGTGGGCCACACGNONE 
J065102K04CGCGTGGGCCACACGNONE 
J065141D21CGCGTGGGCCACACGNONE 
J065159K20CGCGTGGGCCACACGNONE 
J065164C12CGCGTGGGCCACACGNONE 
J065170F10CGCGTGGGCCACACGNONE 
J065181F20CGCGTGGGCCACACGNONE 
J065205N07CGCGTGGGCCACACGNONE 
J065209N21CGCGTGGGCCACACGNONE 
J075001M12CGCGTGGGCCACACGNONE 
J075007D22CGCGTGGGCCACACGNONE 
J075026H04CGCGTGGGCCACACGNONE 
J075042O08CGCGTGGGCCACACGNONE 
J075044G20CGCGTGGGCCACACGNONE 
J075057D10CGCGTGGGCCACACGNONE 
J075096L23CGCGTGGGCCACACGNONE 
J075104K12CGCGTGGGCCACACGNONE 
J075119H14CGCGTGGGCCACACGNONE 
J075136C14CGCGTGGGCCACACGNONE 
J075172D01CGCGTGGGCCACACGNONE 
J075184M01CGCGTGGGCCACACGNONE 
J075186E06CGCGTGGGCCACACGNONE 
J075192M08CGCGTGGGCCACACGNONE 
J080006D18CGCGTGGGCCACACGNONE 
J080044G16CGCGTGGGCCACACGNONE 
J080087G15CGCGTGGGCCACACGNONE 
J100021I05CGCGTGGGCCACACGNONE 
J100039D10CGCGTGGGCCACACGNONE 
J100073B05CGCGTGGGCCACACGNONE 
J100074M12CGCGTGGGCCACACGNONE 
Os04g0581300009-171-H01ATGGCCCACGCCACAAGCCCACAANONE 
AK063093ATGGCCCACGCCACAAGCCCACAASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0610500006-115-C07AGTGGGCCAANONE 
AK066289AGTGGGCCAAPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817AGTGGGCCAANONE 
J013096N09AGTGGGCCAANONE 
J023054I11AGTGGGCCAANONE 
J023121P20AGTGGGCCAANONE 
J053039O20AGTGGGCCAANONE 
J053071L20AGTGGGCCAANONE 
J053088H23AGTGGGCCAANONE 
J053096J03AGTGGGCCAANONE 
Os04g0612600AB042115TTGGCCCACTNONE 
AK060707TTGGCCCACTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008TTGGCCCACTNONE 
AK104427TTGGCCCACTNONE 
J023043H02TTGGCCCACTNONE 
J033033I23TTGGCCCACTNONE 
J033067P21TTGGCCCACTNONE 
J033088M21TTGGCCCACTNONE 
J033133M08TTGGCCCACTNONE 
J043030I16TTGGCCCACTNONE 
J075049H08TTGGCCCACTNONE 
Os04g0640800AK065522GTGGCCCACGTGProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0654700006-097-D06CAAGTGGGCCAANONE 
013-016-H01CAAGTGGGCCAANONE 
AB055495CAAGTGGGCCAANONE 
AF072849CAAGTGGGCCAANONE 
AK062107CAAGTGGGCCAANONE 
AK099088CAAGTGGGCCAASimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16CAAGTGGGCCAANONE 
J013038J23CAAGTGGGCCAANONE 
J013038L17CAAGTGGGCCAANONE 
J013038N18CAAGTGGGCCAANONE 
J013038O18CAAGTGGGCCAANONE 
J013124A09CAAGTGGGCCAANONE 
J023007N04CAAGTGGGCCAANONE 
J033023C02CAAGTGGGCCAANONE 
J033030M18CAAGTGGGCCAANONE 
J033068I09CAAGTGGGCCAANONE 
J033100E04CAAGTGGGCCAANONE 
J065153E19CAAGTGGGCCAANONE 
J065207I02CAAGTGGGCCAANONE 
J075007A07CAAGTGGGCCAANONE 
J075036M04CAAGTGGGCCAANONE 
J075147I03CAAGTGGGCCAANONE 
J075197L11CAAGTGGGCCAANONE 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0682100AK070539AGAGTGGGCCATEukaryotic phosphomannomutase family protein. 
J080303K19AGAGTGGGCCATNONE 
J100044E03AGAGTGGGCCATNONE 
J100063H09AGAGTGGGCCATNONE 
J100072L13AGAGTGGGCCATNONE 
J100089H15AGAGTGGGCCATNONE 
Os05g0111200009-033-A06ACGCGTGGGCCACNONE 
AK101693ACGCGTGGGCCACSimilar to Amino acid selective channel protein. 
J065006E13ACGCGTGGGCCACNONE 
J075001D12ACGCGTGGGCCACNONE 
J075005J18ACGCGTGGGCCACNONE 
J075009L08ACGCGTGGGCCACNONE 
J075012M21ACGCGTGGGCCACNONE 
J075019K17ACGCGTGGGCCACNONE 
J075020D07ACGCGTGGGCCACNONE 
J075041D11ACGCGTGGGCCACNONE 
J075051C03ACGCGTGGGCCACNONE 
J075060C05ACGCGTGGGCCACNONE 
J075079N09ACGCGTGGGCCACNONE 
J075094B04ACGCGTGGGCCACNONE 
J075108E08ACGCGTGGGCCACNONE 
J075115G05ACGCGTGGGCCACNONE 
J075147L21ACGCGTGGGCCACNONE 
J075161G12ACGCGTGGGCCACNONE 
J075168J11ACGCGTGGGCCACNONE 
J075168L11ACGCGTGGGCCACNONE 
J075174F22ACGCGTGGGCCACNONE 
Os05g0145100AK107957CCGTGGGCCATCCCCCConserved hypothetical protein. 
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0311000AK099633ATGGCCCACCANONE 
AK100201ATGGCCCACCANONE 
AK100520ATGGCCCACCAClathrin adaptor complex, medium chain family protein. 
J013047M12ATGGCCCACCANONE 
J013052M03ATGGCCCACCANONE 
J013059B15ATGGCCCACCANONE 
J023099C22ATGGCCCACCANONE 
J023100E05ATGGCCCACCANONE 
J023100J17ATGGCCCACCANONE 
J023101D04ATGGCCCACCANONE 
J023119B18ATGGCCCACCANONE 
J033024B03ATGGCCCACCANONE 
J033036M20ATGGCCCACCANONE 
J033071J05ATGGCCCACCANONE 
J033071O20ATGGCCCACCANONE 
J033111K10ATGGCCCACCANONE 
J033144C21ATGGCCCACCANONE 
J033145C21ATGGCCCACCANONE 
J100043L14ATGGCCCACCANONE 
J100079C01ATGGCCCACCANONE 
Os05g0350500013-071-D05GTGGCCCACCCNONE 
AF020787GTGGCCCACCCNONE 
AK061712GTGGCCCACCCNONE 
AK102897GTGGCCCACCCProliferation-associated protein 1 family protein. 
J033060G23GTGGCCCACCCNONE 
J033112P14GTGGCCCACCCNONE 
J033127J04GTGGCCCACCCNONE 
J090015L18GTGGCCCACCCNONE 
J090047K03GTGGCCCACCCNONE 
J090097J17GTGGCCCACCCNONE 
Os05g0366600015-093-D12ACGTGGGCCAGNONE 
AK071469ACGTGGGCCAGSimilar to Hydroxyisourate hydrolase. 
Os05g0391500AK119412TTGGCCCACTCCSimilar to Endo-beta-mannosidase. 
Os05g0395300AK066212GTGGCCCACCCProtein of unknown function DUF21 domain containing protein. 
Os05g0415600AK065818GTGGCCCACAAACTGGGCCCTNONE 
J013042K21GTGGCCCACAAACTGGGCCCTNONE 
J013114E15GTGGCCCACAAACTGGGCCCTNONE 
J013131H02GTGGCCCACAAACTGGGCCCTNONE 
J023041G06GTGGCCCACAAACTGGGCCCTNONE 
J100037M21GTGGCCCACAAACTGGGCCCTNONE 
Os05g0424700AK107848TGTGGGCCATSimilar to Copper transporter 1. 
Os05g0429700AK069203GTGGCCCACANONE 
AK103559GTGGCCCACAC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0437200014-036-D04TCTGGCCCACTNONE 
AK059283TCTGGCCCACTNONE 
AK121867TCTGGCCCACTProtein of unknown function DUF502 family protein. 
Os05g0451300AK108341AGTGGGCCACCTCGCCCGGCCCAACCConserved hypothetical protein. 
Os05g0456000AK058420ATGGCCCACAMitochondrial glycoprotein family protein. 
AK102036ATGGCCCACANONE 
J065066F02ATGGCCCACANONE 
Os05g0458100006-084-A05ATGGCCCACCACNONE 
009-091-H05ATGGCCCACCACNONE 
AJ557547ATGGCCCACCACNONE 
AK059467ATGGCCCACCACNONE 
AK061127ATGGCCCACCACNONE 
AK101652ATGGCCCACCACSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06ATGGCCCACCACNONE 
J033057B20ATGGCCCACCACNONE 
J033087A05ATGGCCCACCACNONE 
J043009C05ATGGCCCACCACNONE 
J090009E10ATGGCCCACCACNONE 
Os05g0461300AK111917CTGGCCCACCAACSimilar to RAB8C. 
AK111946CTGGCCCACCAACNONE 
AK111972CTGGCCCACCAACNONE 
AK112021CTGGCCCACCAACNONE 
J033135H16CTGGCCCACCAACNONE 
J043036O11CTGGCCCACCAACNONE 
Os05g0468700AB051864CCCGTGGGCCATAmmonium transporter. 
AK065288CCCGTGGGCCATNONE 
J013002M22CCCGTGGGCCATNONE 
Os05g0478200J023113C02GCCCAACCTGGCCCACCANONE 
J023150G23GCCCAACCTGGCCCACCANONE 
J033101K13GCCCAACCTGGCCCACCANONE 
Os05g0493800AK110589CTGGCCCACCCSimilar to MtN21 nodulin protein-like. 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0555300009-032-C03CGCGTGCGCTGGCCCACGGNONE 
009-125-E08CGCGTGCGCTGGCCCACGGNONE 
009-149-C12CGCGTGCGCTGGCCCACGGNONE 
009-172-C01CGCGTGCGCTGGCCCACGGNONE 
AK062890CGCGTGCGCTGGCCCACGGFerredoxin domain containing protein. 
AK062997CGCGTGCGCTGGCCCACGGNONE 
Os05g0566500AK073468CGTGTGGGCCACNONE 
AK099052CGTGTGGGCCACSimilar to Initiation factor 3d (Fragment). 
AK104093CGTGTGGGCCACNONE 
J090025I18CGTGTGGGCCACNONE 
Os05g0568600009-024-B09GTGGCCCACCNONE 
009-024-B09GTGGCCCACCTNONE 
AK063781GTGGCCCACCProtein of unknown function DUF1645 family protein. 
AK063781GTGGCCCACCTProtein of unknown function DUF1645 family protein. 
J080049H14GTGGCCCACCNONE 
J080049H14GTGGCCCACCTNONE 
J080062M08GTGGCCCACCNONE 
J080062M08GTGGCCCACCTNONE 
J080064I07GTGGCCCACCNONE 
J080064I07GTGGCCCACCTNONE 
J080068A12GTGGCCCACCNONE 
J080068A12GTGGCCCACCTNONE 
J080086J10GTGGCCCACCNONE 
J080086J10GTGGCCCACCTNONE 
Os05g0589000AK061980GTGGCCCACCANONE 
AK099181GTGGCCCACCAConserved hypothetical protein. 
Os06g0113600016-067-E03ACGTGGGCCAGNONE 
AK062095ACGTGGGCCAGNONE 
AK101235ACGTGGGCCAGCyclin-like F-box domain containing protein. 
AK122025ACGTGGGCCAGNONE 
J013022O19ACGTGGGCCAGNONE 
J023045P05ACGTGGGCCAGNONE 
J033031K01ACGTGGGCCAGNONE 
J033034I09ACGTGGGCCAGNONE 
J033041O04ACGTGGGCCAGNONE 
J033071K03ACGTGGGCCAGNONE 
J033075K16ACGTGGGCCAGNONE 
J033097M01ACGTGGGCCAGNONE 
J033099M22ACGTGGGCCAGNONE 
J033108N15ACGTGGGCCAGNONE 
J033121D18ACGTGGGCCAGNONE 
J033125O06ACGTGGGCCAGNONE 
J033139M16ACGTGGGCCAGNONE 
J033145P18ACGTGGGCCAGNONE 
J033149D05ACGTGGGCCAGNONE 
Os06g0128400AK064390GTGGCCCACCNONE 
AK121983GTGGCCCACCWD40-like domain containing protein. 
Os06g0130000AK064427GTGGCCCACTNONE 
AK070084GTGGCCCACTNONE 
AK119321GTGGCCCACTSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment). 
Os06g0134000AK102796AGGTGGGCCAANONE 
Os06g0157800AK121504GGTGGGCCATSimilar to CG7224 (Fragment). 
J033022L20GGTGGGCCATNONE 
J075033D09GGTGGGCCATNONE 
Os06g0225200005-009-B07ATGGCCCACCAACNONE 
AK067095ATGGCCCACCAACMitochodrial transcription termination factor-related family protein. 
AK104692ATGGCCCACCAACNONE 
J013096A05ATGGCCCACCAACNONE 
J090092C03ATGGCCCACCAACNONE 
Os06g0248200Os06g0248200TCGTGGGCCAANONE 
Os06g0251000J033111L12AGTGGGCCAANONE 
J043001C08AGTGGGCCAAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0291600AK100261GACACGTGGGCCACSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
J023063D14GACACGTGGGCCACNONE 
J090041B12GACACGTGGGCCACNONE 
Os06g0318300004-006-E12TGTGGGCCAGNONE 
014-001-H07TGTGGGCCAGNONE 
AK060873TGTGGGCCAGNONE 
AK065671TGTGGGCCAGSimilar to Rho GDP-dissociation inhibitor 1 (Rho GDI-1) (AtRhoGDI1). 
AY364312TGTGGGCCAGNONE 
J013041C14TGTGGGCCAGNONE 
J065180A18TGTGGGCCAGNONE 
J075013P16TGTGGGCCAGNONE 
Os06g0337100006-100-G05CTGGCCCACGGGTCAGTGGNONE 
AK061222CTGGCCCACGGGTCAGTGGConserved hypothetical protein. 
Os06g0495500AK109873GCGTGGGCCATMulti antimicrobial extrusion protein MatE family protein. 
Os06g0555500016-056-B08TTGGCCCACTCTNONE 
AK102375TTGGCCCACTCTNONE 
AK106546TTGGCCCACTCTInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08TTGGCCCACTCTNONE 
J033091P04TTGGCCCACTCTNONE 
J090082P16TTGGCCCACTCTNONE 
Os06g0568200AK060816ATGGCCCACCTNONE 
J013048K13ATGGCCCACCTNONE 
J013050A11ATGGCCCACCTNONE 
J013051L22ATGGCCCACCTNONE 
J013061N20ATGGCCCACCTNONE 
J013065H06ATGGCCCACCTNONE 
J013068P08ATGGCCCACCTNONE 
J013069C22ATGGCCCACCTNONE 
J013070P14ATGGCCCACCTNONE 
J013074I20ATGGCCCACCTNONE 
J013106C16ATGGCCCACCTNONE 
J013122H02ATGGCCCACCTNONE 
J013129N22ATGGCCCACCTNONE 
J013129P06ATGGCCCACCTNONE 
J013147C12ATGGCCCACCTNONE 
J013152K21ATGGCCCACCTNONE 
J013155C14ATGGCCCACCTNONE 
J023001M10ATGGCCCACCTNONE 
J023012G04ATGGCCCACCTNONE 
J023012H22ATGGCCCACCTNONE 
J023012N11ATGGCCCACCTNONE 
J023013I23ATGGCCCACCTNONE 
J023014L11ATGGCCCACCTNONE 
J023022G16ATGGCCCACCTNONE 
J023031K09ATGGCCCACCTNONE 
J023042N15ATGGCCCACCTNONE 
J023044D09ATGGCCCACCTNONE 
J023063L08ATGGCCCACCTNONE 
J023074C24ATGGCCCACCTNONE 
J023079O11ATGGCCCACCTNONE 
J023107B12ATGGCCCACCTNONE 
J023114B10ATGGCCCACCTNONE 
J023120P15ATGGCCCACCTNONE 
J023123D20ATGGCCCACCTNONE 
J023130G12ATGGCCCACCTNONE 
J023131L13ATGGCCCACCTNONE 
J023135O11ATGGCCCACCTNONE 
J023138M14ATGGCCCACCTNONE 
J023149G07ATGGCCCACCTNONE 
J033024F07ATGGCCCACCTNONE 
J033026C20ATGGCCCACCTNONE 
J033036M14ATGGCCCACCTNONE 
J033038A18ATGGCCCACCTNONE 
J033043B18ATGGCCCACCTNONE 
J033043L05ATGGCCCACCTNONE 
J033064A07ATGGCCCACCTNONE 
J033087H21ATGGCCCACCTNONE 
J033087P22ATGGCCCACCTNONE 
J033116O10ATGGCCCACCTNONE 
J033118G23ATGGCCCACCTNONE 
J033120L01ATGGCCCACCTNONE 
J033133F11ATGGCCCACCTNONE 
J033135H12ATGGCCCACCTNONE 
J033141O15ATGGCCCACCTNONE 
J043003A18ATGGCCCACCTNONE 
J043010C07ATGGCCCACCTNONE 
J043010G12ATGGCCCACCTNONE 
J043012A09ATGGCCCACCTNONE 
J043036K01ATGGCCCACCTNONE 
J065005D13ATGGCCCACCTNONE 
J065017L06ATGGCCCACCTNONE 
J065172I06ATGGCCCACCTNONE 
J090003B02ATGGCCCACCTNONE 
J090015L01ATGGCCCACCTNONE 
J090020I04ATGGCCCACCTNONE 
J090021I06ATGGCCCACCTNONE 
J090047D16ATGGCCCACCTNONE 
J090049J19ATGGCCCACCTNONE 
J090050C16ATGGCCCACCTNONE 
J090055L13ATGGCCCACCTNONE 
J090056J22ATGGCCCACCTNONE 
J090058K23ATGGCCCACCTNONE 
J090059N19ATGGCCCACCTNONE 
J090069A06ATGGCCCACCTNONE 
J090071C19ATGGCCCACCTNONE 
J100024L15ATGGCCCACCTNONE 
J100029O03ATGGCCCACCTNONE 
J100064M17ATGGCCCACCTNONE 
J100082D13ATGGCCCACCTNONE 
J100083P16ATGGCCCACCTNONE 
Os06g0606800AK066355ACGTGGGCCACTargeting for Xklp2 family protein. 
AK106565ACGTGGGCCACNONE 
J013067N05ACGTGGGCCACNONE 
J023127B01ACGTGGGCCACNONE 
J033023J04ACGTGGGCCACNONE 
J033025J18ACGTGGGCCACNONE 
J033032A15ACGTGGGCCACNONE 
J033079F03ACGTGGGCCACNONE 
J033115D22ACGTGGGCCACNONE 
J033119N01ACGTGGGCCACNONE 
J033138G24ACGTGGGCCACNONE 
J033149E08ACGTGGGCCACNONE 
J033150A09ACGTGGGCCACNONE 
J043024B06ACGTGGGCCACNONE 
J065028O13ACGTGGGCCACNONE 
J065070C05ACGTGGGCCACNONE 
J065175H22ACGTGGGCCACNONE 
J090008L08ACGTGGGCCACNONE 
J090009M07ACGTGGGCCACNONE 
J090039L01ACGTGGGCCACNONE 
J090049A02ACGTGGGCCACNONE 
J090050A11ACGTGGGCCACNONE 
J090051G16ACGTGGGCCACNONE 
J090062P20ACGTGGGCCACNONE 
J090073P12ACGTGGGCCACNONE 
J090076B19ACGTGGGCCACNONE 
J090084I23ACGTGGGCCACNONE 
J090088N05ACGTGGGCCACNONE 
J100037J10ACGTGGGCCACNONE 
J100043B06ACGTGGGCCACNONE 
J100058C13ACGTGGGCCACNONE 
J100089N01ACGTGGGCCACNONE 
Os06g0608500AK060097CCAGCCCATCTTGGCCCACCNONE 
AK060097CTGGCCCACAANONE 
AK070667CCAGCCCATCTTGGCCCACCSnf7 family protein. 
AK070667CTGGCCCACAASnf7 family protein. 
Os06g0682300009-098-E01GTGGCCCACGGNONE 
009-134-F09GTGGCCCACGGNONE 
009-137-E02GTGGCCCACGGNONE 
009-198-E05GTGGCCCACGGNONE 
AK062934GTGGCCCACGGHypothetical protein. 
J075053E04GTGGCCCACGGNONE 
Os06g0683200AK060024CAAGTGGGCCAASimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432CAAGTGGGCCAANONE 
J023002B12CAAGTGGGCCAANONE 
J023054E10CAAGTGGGCCAANONE 
J023123F19CAAGTGGGCCAANONE 
J065035K13CAAGTGGGCCAANONE 
J065129P09CAAGTGGGCCAANONE 
J065184B14CAAGTGGGCCAANONE 
Os06g0704300AK107008CTGGCCCACTZinc finger, CCCH-type domain containing protein. 
J065038I12CTGGCCCACTNONE 
J065079E03CTGGCCCACTNONE 
J075035B15CTGGCCCACTNONE 
J090072D21CTGGCCCACTNONE 
Os06g0708200J013149K22CTGACAGGTGGGCCACNONE 
J053032C24CTGACAGGTGGGCCACNONE 
J053037F13CTGACAGGTGGGCCACNONE 
J053037L10CTGACAGGTGGGCCACNONE 
J053043J18CTGACAGGTGGGCCACNONE 
J053098E09CTGACAGGTGGGCCACNONE 
J075036L07CTGACAGGTGGGCCACNONE 
J075057O05CTGACAGGTGGGCCACNONE 
J090092L13CTGACAGGTGGGCCACNONE 
Os06g0709300AK108588ATGGCCCACTFAR1 domain containing protein. 
Os06g0710900AK073326CTGGCCCACCACConserved hypothetical protein. 
Os06g0711600016-047-G09GGGTGGGCCAANONE 
AK064384GGGTGGGCCAAmRNA splicing factor SYF2 family protein. 
AK102831GGGTGGGCCAANONE 
J013072P18GGGTGGGCCAANONE 
J023049G01GGGTGGGCCAANONE 
J023088I01GGGTGGGCCAANONE 
J033023I22GGGTGGGCCAANONE 
J033106I12GGGTGGGCCAANONE 
J033109G07GGGTGGGCCAANONE 
J065030F22GGGTGGGCCAANONE 
J065132H19GGGTGGGCCAANONE 
J080301D07GGGTGGGCCAANONE 
J080305C09GGGTGGGCCAANONE 
J080312C03GGGTGGGCCAANONE 
J080313I15GGGTGGGCCAANONE 
J080315B09GGGTGGGCCAANONE 
J090056N21GGGTGGGCCAANONE 
J100027B07GGGTGGGCCAANONE 
Os07g0141400003-129-D08GATCCGACGTGGGCCAANONE 
006-021-E02GATCCGACGTGGGCCAANONE 
006-025-C06GATCCGACGTGGGCCAANONE 
006-027-H11GATCCGACGTGGGCCAANONE 
006-036-C05GATCCGACGTGGGCCAANONE 
006-046-D07GATCCGACGTGGGCCAANONE 
006-047-A02GATCCGACGTGGGCCAANONE 
006-050-F02GATCCGACGTGGGCCAANONE 
006-053-D07GATCCGACGTGGGCCAANONE 
006-054-E06GATCCGACGTGGGCCAANONE 
006-055-E01GATCCGACGTGGGCCAANONE 
006-055-F01GATCCGACGTGGGCCAANONE 
006-056-H12GATCCGACGTGGGCCAANONE 
006-057-D07GATCCGACGTGGGCCAANONE 
006-074-G10GATCCGACGTGGGCCAANONE 
006-077-C02GATCCGACGTGGGCCAANONE 
006-081-E01GATCCGACGTGGGCCAANONE 
006-089-B08GATCCGACGTGGGCCAANONE 
006-089-C10GATCCGACGTGGGCCAANONE 
006-092-E07GATCCGACGTGGGCCAANONE 
006-096-C11GATCCGACGTGGGCCAANONE 
006-096-H06GATCCGACGTGGGCCAANONE 
006-097-E07GATCCGACGTGGGCCAANONE 
006-098-D03GATCCGACGTGGGCCAANONE 
006-102-C05GATCCGACGTGGGCCAANONE 
006-107-E09GATCCGACGTGGGCCAANONE 
006-110-C09GATCCGACGTGGGCCAANONE 
006-113-C01GATCCGACGTGGGCCAANONE 
006-114-D09GATCCGACGTGGGCCAANONE 
006-115-H06GATCCGACGTGGGCCAANONE 
009-016-G06GATCCGACGTGGGCCAANONE 
009-031-C05GATCCGACGTGGGCCAANONE 
009-060-B05GATCCGACGTGGGCCAANONE 
009-123-H12GATCCGACGTGGGCCAANONE 
009-154-B09GATCCGACGTGGGCCAANONE 
009-172-F07GATCCGACGTGGGCCAANONE 
009-193-A04GATCCGACGTGGGCCAANONE 
AF022732GATCCGACGTGGGCCAANONE 
AF052203GATCCGACGTGGGCCAANONE 
AK065248GATCCGACGTGGGCCAASimilar to 23 kDa polypeptide of photosystem II. 
AK104722GATCCGACGTGGGCCAANONE 
D49713GATCCGACGTGGGCCAANONE 
J013002J02GATCCGACGTGGGCCAANONE 
J065051O13GATCCGACGTGGGCCAANONE 
J065066J18GATCCGACGTGGGCCAANONE 
J065077G23GATCCGACGTGGGCCAANONE 
J065162C22GATCCGACGTGGGCCAANONE 
J065162G22GATCCGACGTGGGCCAANONE 
J075091B13GATCCGACGTGGGCCAANONE 
J075099J22GATCCGACGTGGGCCAANONE 
J100056O22GATCCGACGTGGGCCAANONE 
J100059E01GATCCGACGTGGGCCAANONE 
J100079F20GATCCGACGTGGGCCAANONE 
Os07g0142000AK059877ATGGCCCACCTReticulon family protein. 
AK099414ATGGCCCACCTNONE 
Os07g0150200009-152-C07AGGTGGGCCATNONE 
AK058680AGGTGGGCCATNONE 
AK121635AGGTGGGCCATSimilar to 40S ribosomal protein S12-1. 
J033051C16AGGTGGGCCATNONE 
J033123H15AGGTGGGCCATNONE 
J065093I01AGGTGGGCCATNONE 
J065197C05AGGTGGGCCATNONE 
J075037B11AGGTGGGCCATNONE 
J075114B08AGGTGGGCCATNONE 
J075123N01AGGTGGGCCATNONE 
J075129O04AGGTGGGCCATNONE 
J075160H17AGGTGGGCCATNONE 
J075166H17AGGTGGGCCATNONE 
J080310F11AGGTGGGCCATNONE 
J080315P11AGGTGGGCCATNONE 
J090025A22AGGTGGGCCATNONE 
Os07g0154300009-070-E08AGTGGGCCACNONE 
009-077-E01AGTGGGCCACNONE 
009-196-F05AGTGGGCCACNONE 
AK105386AGTGGGCCACConserved hypothetical protein. 
AK122093AGTGGGCCACNONE 
J033124K14AGTGGGCCACNONE 
J075006I22AGTGGGCCACNONE 
J075185G02AGTGGGCCACNONE 
J090039C02AGTGGGCCACNONE 
Os07g0171200AK071075ATGGCCCACTGalactose-1-phosphate uridyl transferase, class I family protein. 
Os07g0213400003-104-B01CCGTGGGCCAGNONE 
AK062273CCGTGGGCCAGConserved hypothetical protein. 
J065122P17CCGTGGGCCAGNONE 
J065160A01CCGTGGGCCAGNONE 
J090065M11CCGTGGGCCAGNONE 
Os07g0246200012-046-B07CTGGCCCACCCGCGCNONE 
AB021259CTGGCCCACCCGCGCNONE 
AK065341CTGGCCCACCCGCGCSimilar to Calreticulin (Fragment). 
AK099348CTGGCCCACCCGCGCNONE 
AK104328CTGGCCCACCCGCGCNONE 
AK104826CTGGCCCACCCGCGCNONE 
J013000E04CTGGCCCACCCGCGCNONE 
J013093M19CTGGCCCACCCGCGCNONE 
J013108J08CTGGCCCACCCGCGCNONE 
J013118G03CTGGCCCACCCGCGCNONE 
J013121I07CTGGCCCACCCGCGCNONE 
J013153K07CTGGCCCACCCGCGCNONE 
J023028N07CTGGCCCACCCGCGCNONE 
J023034F12CTGGCCCACCCGCGCNONE 
J023043J11CTGGCCCACCCGCGCNONE 
J023087A03CTGGCCCACCCGCGCNONE 
J023099N05CTGGCCCACCCGCGCNONE 
J023105B02CTGGCCCACCCGCGCNONE 
J023110H02CTGGCCCACCCGCGCNONE 
J023112E15CTGGCCCACCCGCGCNONE 
J023132C20CTGGCCCACCCGCGCNONE 
J023134G12CTGGCCCACCCGCGCNONE 
J023138O12CTGGCCCACCCGCGCNONE 
J033031E05CTGGCCCACCCGCGCNONE 
J033032C03CTGGCCCACCCGCGCNONE 
J033039K10CTGGCCCACCCGCGCNONE 
J033050P09CTGGCCCACCCGCGCNONE 
J033074D03CTGGCCCACCCGCGCNONE 
J033075G14CTGGCCCACCCGCGCNONE 
J033075I23CTGGCCCACCCGCGCNONE 
J033081H23CTGGCCCACCCGCGCNONE 
J033087N08CTGGCCCACCCGCGCNONE 
J033110B03CTGGCCCACCCGCGCNONE 
J033148H22CTGGCCCACCCGCGCNONE 
J043027F13CTGGCCCACCCGCGCNONE 
J043031H01CTGGCCCACCCGCGCNONE 
J080003O10CTGGCCCACCCGCGCNONE 
J080022D10CTGGCCCACCCGCGCNONE 
J080029I12CTGGCCCACCCGCGCNONE 
J080034A09CTGGCCCACCCGCGCNONE 
J080035H20CTGGCCCACCCGCGCNONE 
J080049C10CTGGCCCACCCGCGCNONE 
J080053G14CTGGCCCACCCGCGCNONE 
J080055J22CTGGCCCACCCGCGCNONE 
J080058J04CTGGCCCACCCGCGCNONE 
J080069E14CTGGCCCACCCGCGCNONE 
J080069M23CTGGCCCACCCGCGCNONE 
J080072E19CTGGCCCACCCGCGCNONE 
J080072I03CTGGCCCACCCGCGCNONE 
J080075B13CTGGCCCACCCGCGCNONE 
J080078I11CTGGCCCACCCGCGCNONE 
J080081F16CTGGCCCACCCGCGCNONE 
J080088O10CTGGCCCACCCGCGCNONE 
J080089G18CTGGCCCACCCGCGCNONE 
J090009C10CTGGCCCACCCGCGCNONE 
J090022D23CTGGCCCACCCGCGCNONE 
J090023A15CTGGCCCACCCGCGCNONE 
J090024M10CTGGCCCACCCGCGCNONE 
J090038F24CTGGCCCACCCGCGCNONE 
J090039O13CTGGCCCACCCGCGCNONE 
J090040N12CTGGCCCACCCGCGCNONE 
J090054I18CTGGCCCACCCGCGCNONE 
J090061C16CTGGCCCACCCGCGCNONE 
J090063H23CTGGCCCACCCGCGCNONE 
J090067F21CTGGCCCACCCGCGCNONE 
J090075A01CTGGCCCACCCGCGCNONE 
J090076K11CTGGCCCACCCGCGCNONE 
J090078L11CTGGCCCACCCGCGCNONE 
J090079P03CTGGCCCACCCGCGCNONE 
J090087D23CTGGCCCACCCGCGCNONE 
J090087G22CTGGCCCACCCGCGCNONE 
J090089F03CTGGCCCACCCGCGCNONE 
J090092A04CTGGCCCACCCGCGCNONE 
J100024L17CTGGCCCACCCGCGCNONE 
J100031P13CTGGCCCACCCGCGCNONE 
J100032H05CTGGCCCACCCGCGCNONE 
J100036P03CTGGCCCACCCGCGCNONE 
J100038L07CTGGCCCACCCGCGCNONE 
J100043I20CTGGCCCACCCGCGCNONE 
J100069A21CTGGCCCACCCGCGCNONE 
J100078G06CTGGCCCACCCGCGCNONE 
J100081J24CTGGCCCACCCGCGCNONE 
J100081N04CTGGCCCACCCGCGCNONE 
J100084K16CTGGCCCACCCGCGCNONE 
J100085O06CTGGCCCACCCGCGCNONE 
J100088L13CTGGCCCACCCGCGCNONE 
J100090O21CTGGCCCACCCGCGCNONE 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0419800J080309B06GAGGCGTGGGCCACNONE 
Os07g0469100009-036-F03TTGTGGGCTCGTGGGCCACNONE 
009-126-D06TTGTGGGCTCGTGGGCCACNONE 
009-190-A01TTGTGGGCTCGTGGGCCACNONE 
AK061626TTGTGGGCTCGTGGGCCACNONE 
AK120365TTGTGGGCTCGTGGGCCACSimilar to Thylakoid membrane phosphoprotein 14 kDa, chloroplast precursor. 
J013068P10TTGTGGGCTCGTGGGCCACNONE 
J053066C23TTGTGGGCTCGTGGGCCACNONE 
J065011K15TTGTGGGCTCGTGGGCCACNONE 
J065053E15TTGTGGGCTCGTGGGCCACNONE 
J065167F21TTGTGGGCTCGTGGGCCACNONE 
J075065G04TTGTGGGCTCGTGGGCCACNONE 
J075146A09TTGTGGGCTCGTGGGCCACNONE 
Os07g0598900015-040-C12TGTGGGCCAANONE 
AK102627TGTGGGCCAACobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521TGTGGGCCAANONE 
J033087C18TGTGGGCCAANONE 
J033099K03TGTGGGCCAANONE 
J065054E02TGTGGGCCAANONE 
J090055O05TGTGGGCCAANONE 
Os07g0616800AK100306ATGGCCCACGCCTCSucrose synthase 3 (EC 2.4.1.13) (Sucrose-UDP glucosyltransferase 3). 
J023081P20ATGGCCCACGCCTCNONE 
J023083F19ATGGCCCACGCCTCNONE 
J023131O18ATGGCCCACGCCTCNONE 
J075005A08ATGGCCCACGCCTCNONE 
J075014A17ATGGCCCACGCCTCNONE 
J075034L22ATGGCCCACGCCTCNONE 
J075042E03ATGGCCCACGCCTCNONE 
J075058F21ATGGCCCACGCCTCNONE 
J075068P20ATGGCCCACGCCTCNONE 
J075069D01ATGGCCCACGCCTCNONE 
J075081D21ATGGCCCACGCCTCNONE 
J075094N20ATGGCCCACGCCTCNONE 
J075141C12ATGGCCCACGCCTCNONE 
J075175I11ATGGCCCACGCCTCNONE 
J075177O15ATGGCCCACGCCTCNONE 
J075181B08ATGGCCCACGCCTCNONE 
J075181E16ATGGCCCACGCCTCNONE 
J075182M01ATGGCCCACGCCTCNONE 
J090002E09ATGGCCCACGCCTCNONE 
J090012C07ATGGCCCACGCCTCNONE 
J090016H23ATGGCCCACGCCTCNONE 
J090018C17ATGGCCCACGCCTCNONE 
J090023D12ATGGCCCACGCCTCNONE 
J090025B11ATGGCCCACGCCTCNONE 
J090026B16ATGGCCCACGCCTCNONE 
J090026D01ATGGCCCACGCCTCNONE 
J090026N17ATGGCCCACGCCTCNONE 
J090027G04ATGGCCCACGCCTCNONE 
J090027J17ATGGCCCACGCCTCNONE 
J090030L01ATGGCCCACGCCTCNONE 
J090032F19ATGGCCCACGCCTCNONE 
J090033C02ATGGCCCACGCCTCNONE 
J090041D05ATGGCCCACGCCTCNONE 
J090042O17ATGGCCCACGCCTCNONE 
J090048I02ATGGCCCACGCCTCNONE 
J090048K18ATGGCCCACGCCTCNONE 
J090054J02ATGGCCCACGCCTCNONE 
J090056K21ATGGCCCACGCCTCNONE 
J090057D16ATGGCCCACGCCTCNONE 
J090058F22ATGGCCCACGCCTCNONE 
J090062L16ATGGCCCACGCCTCNONE 
J090062L17ATGGCCCACGCCTCNONE 
J090063H10ATGGCCCACGCCTCNONE 
J090063L17ATGGCCCACGCCTCNONE 
J090069A12ATGGCCCACGCCTCNONE 
J090069I20ATGGCCCACGCCTCNONE 
J090069L03ATGGCCCACGCCTCNONE 
J090072F07ATGGCCCACGCCTCNONE 
J090074K19ATGGCCCACGCCTCNONE 
J090077E02ATGGCCCACGCCTCNONE 
J090078L13ATGGCCCACGCCTCNONE 
J090081C14ATGGCCCACGCCTCNONE 
J090081J18ATGGCCCACGCCTCNONE 
J090083E11ATGGCCCACGCCTCNONE 
J090083I21ATGGCCCACGCCTCNONE 
J090083P21ATGGCCCACGCCTCNONE 
J090088H09ATGGCCCACGCCTCNONE 
J090090I19ATGGCCCACGCCTCNONE 
J090090K03ATGGCCCACGCCTCNONE 
J090092L21ATGGCCCACGCCTCNONE 
J090094M21ATGGCCCACGCCTCNONE 
J090095E24ATGGCCCACGCCTCNONE 
J090095H06ATGGCCCACGCCTCNONE 
J090095P19ATGGCCCACGCCTCNONE 
J090096E13ATGGCCCACGCCTCNONE 
J090096G02ATGGCCCACGCCTCNONE 
J090096N12ATGGCCCACGCCTCNONE 
J090097C07ATGGCCCACGCCTCNONE 
Os07g0624600AK109902GTGGTGGGCCATSimilar to Trehalose-6-phosphate phosphatase. 
Os07g0626100009-127-G03GACAGGTGGGCCACNONE 
AK062899GACAGGTGGGCCACSimilar to 50S ribosomal protein L7/L12. 
Os07g0631900AK061072CACTGACAGTGGGCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os07g0681100AK103917TGTGGGCCACNONE 
Os07g0688100AK101635GTGGCCCACTProtein prenyltransferase domain containing protein. 
J033055B02GTGGCCCACTNONE 
J090013O08GTGGCCCACTNONE 
J090074A17GTGGCCCACTNONE 
Os08g0116500009-007-E05ATGGCCCACANONE 
009-074-C07ATGGCCCACANONE 
009-098-A07ATGGCCCACANONE 
009-100-C03ATGGCCCACANONE 
009-136-E04ATGGCCCACANONE 
009-138-B08ATGGCCCACANONE 
009-144-B06ATGGCCCACANONE 
009-184-E04ATGGCCCACANONE 
009-189-F01ATGGCCCACANONE 
013-006-E05ATGGCCCACANONE 
013-015-C10ATGGCCCACANONE 
013-019-F09ATGGCCCACANONE 
013-020-C01ATGGCCCACANONE 
013-021-F05ATGGCCCACANONE 
013-035-D08ATGGCCCACANONE 
013-038-C09ATGGCCCACANONE 
013-054-B07ATGGCCCACANONE 
013-061-G10ATGGCCCACANONE 
013-074-B01ATGGCCCACANONE 
013-079-B06ATGGCCCACANONE 
013-099-B09ATGGCCCACANONE 
013-099-G11ATGGCCCACANONE 
014-023-F04ATGGCCCACANONE 
014-032-C07ATGGCCCACANONE 
014-045-E02ATGGCCCACANONE 
014-085-C02ATGGCCCACANONE 
014-087-F04ATGGCCCACANONE 
014-089-C04ATGGCCCACANONE 
014-090-E01ATGGCCCACANONE 
014-094-G11ATGGCCCACANONE 
014-097-B07ATGGCCCACANONE 
015-024-A12ATGGCCCACANONE 
015-032-C06ATGGCCCACANONE 
016-053-E09ATGGCCCACANONE 
016-081-F10ATGGCCCACANONE 
AK058240ATGGCCCACASimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09ATGGCCCACANONE 
J023107O19ATGGCCCACANONE 
J053029K21ATGGCCCACANONE 
J053073P11ATGGCCCACANONE 
J053074B04ATGGCCCACANONE 
J053078M14ATGGCCCACANONE 
J065001E12ATGGCCCACANONE 
J065006J12ATGGCCCACANONE 
J065015C06ATGGCCCACANONE 
J065025D13ATGGCCCACANONE 
J065029A04ATGGCCCACANONE 
J065031D23ATGGCCCACANONE 
J065032E24ATGGCCCACANONE 
J065034P16ATGGCCCACANONE 
J065043B04ATGGCCCACANONE 
J065044A15ATGGCCCACANONE 
J065062D18ATGGCCCACANONE 
J065079G13ATGGCCCACANONE 
J065080A19ATGGCCCACANONE 
J065080A20ATGGCCCACANONE 
J065089N19ATGGCCCACANONE 
J065111O07ATGGCCCACANONE 
J065115N15ATGGCCCACANONE 
J065131A04ATGGCCCACANONE 
J065138H02ATGGCCCACANONE 
J065139K10ATGGCCCACANONE 
J065144A02ATGGCCCACANONE 
J065155J17ATGGCCCACANONE 
J065159D18ATGGCCCACANONE 
J065159I18ATGGCCCACANONE 
J065167H12ATGGCCCACANONE 
J065174C22ATGGCCCACANONE 
J065184A05ATGGCCCACANONE 
J065188M15ATGGCCCACANONE 
J065191D23ATGGCCCACANONE 
J065203C07ATGGCCCACANONE 
J065207C23ATGGCCCACANONE 
J065207L16ATGGCCCACANONE 
J065212F01ATGGCCCACANONE 
J065212F05ATGGCCCACANONE 
J075037B07ATGGCCCACANONE 
J075042F15ATGGCCCACANONE 
J075059J03ATGGCCCACANONE 
J075068M18ATGGCCCACANONE 
J075079E13ATGGCCCACANONE 
J075081F12ATGGCCCACANONE 
J075083I05ATGGCCCACANONE 
J075123K23ATGGCCCACANONE 
J075142F16ATGGCCCACANONE 
J075156N03ATGGCCCACANONE 
J075162K05ATGGCCCACANONE 
J075171E08ATGGCCCACANONE 
J075177N03ATGGCCCACANONE 
J075182K17ATGGCCCACANONE 
J075186K02ATGGCCCACANONE 
J075191K05ATGGCCCACANONE 
J080011E10ATGGCCCACANONE 
J080016M21ATGGCCCACANONE 
J080017A17ATGGCCCACANONE 
J080031O09ATGGCCCACANONE 
J080039G21ATGGCCCACANONE 
J080041B01ATGGCCCACANONE 
J080050G20ATGGCCCACANONE 
J080054A12ATGGCCCACANONE 
J080058O08ATGGCCCACANONE 
J080061N04ATGGCCCACANONE 
J080064L23ATGGCCCACANONE 
J080064P05ATGGCCCACANONE 
J080069I17ATGGCCCACANONE 
J080070E07ATGGCCCACANONE 
J080071B20ATGGCCCACANONE 
J080074L08ATGGCCCACANONE 
J080076N08ATGGCCCACANONE 
J080081A14ATGGCCCACANONE 
J080081J17ATGGCCCACANONE 
J080085N14ATGGCCCACANONE 
J080090B09ATGGCCCACANONE 
J080097L11ATGGCCCACANONE 
J080306H13ATGGCCCACANONE 
J080307H13ATGGCCCACANONE 
J080311F12ATGGCCCACANONE 
J080316L23ATGGCCCACANONE 
J080318H02ATGGCCCACANONE 
J090016L15ATGGCCCACANONE 
J090019I02ATGGCCCACANONE 
J090031G21ATGGCCCACANONE 
J090066C15ATGGCCCACANONE 
J100032I02ATGGCCCACANONE 
J100032N07ATGGCCCACANONE 
J100032N16ATGGCCCACANONE 
J100041P21ATGGCCCACANONE 
J100048M04ATGGCCCACANONE 
J100048M14ATGGCCCACANONE 
J100063B08ATGGCCCACANONE 
J100088E20ATGGCCCACANONE 
J100090I08ATGGCCCACANONE 
Os08g0126500AK110941GCCCCACGTATGGCCCACTTGProtein of unknown function DUF295 family protein. 
Os08g0150800AK101530TGTGGGCCACGTCSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0192800AK059490ATGGCCCACATGTCAGTGNONE 
AK101678ATGGCCCACATGTCAGTGNONE 
AK120613ATGGCCCACATGTCAGTGBromodomain containing protein. 
J080039B22ATGGCCCACATGTCAGTGNONE 
J080039I23ATGGCCCACATGTCAGTGNONE 
J080074D19ATGGCCCACATGTCAGTGNONE 
J080086N13ATGGCCCACATGTCAGTGNONE 
Os08g0192900AK103422AGTGGGCCAGCCCATGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AGTGGGCCAGCCCATGANONE 
Os08g0196900J065042C13TGTGGGCCATNONE 
J065097A06TGTGGGCCATNONE 
J065164E04TGTGGGCCATNONE 
J075006N16TGTGGGCCATCyclin-like F-box domain containing protein. 
J075007K15TGTGGGCCATNONE 
J075025D24TGTGGGCCATNONE 
J075165A07TGTGGGCCATNONE 
J075176D05TGTGGGCCATNONE 
J075181K09TGTGGGCCATNONE 
J075199B15TGTGGGCCATNONE 
Os08g0316900013-024-A06CTGGCCCACANONE 
J033112J20CTGGCCCACANONE 
J065025M22CTGGCCCACANONE 
J065026E15CTGGCCCACANONE 
Os08g0374100006-043-B11TGTGGGCCACNONE 
006-065-D12TGTGGGCCACNONE 
006-071-B11TGTGGGCCACNONE 
006-101-C05TGTGGGCCACNONE 
009-159-A03TGTGGGCCACNONE 
AK070541TGTGGGCCACSimilar to Ubiquitin-conjugating enzyme E2 M (EC 6.3.2.19) (Ubiquitin-protein ligase M) (Ubiquitin carrier protein M) (Nedd8-conjugating enzyme Ubc12). 
AK104158TGTGGGCCACNONE 
AK104511TGTGGGCCACNONE 
J023056A05TGTGGGCCACNONE 
J100059M16TGTGGGCCACNONE 
Os08g0386300AK059323GTGGCCCACGTGGCNONE 
AK070379GTGGCCCACGTGGCCytochrome b5 domain containing protein. 
J023054P20GTGGCCCACGTGGCNONE 
J033089H01GTGGCCCACGTGGCNONE 
J065013I01GTGGCCCACGTGGCNONE 
J065212E17GTGGCCCACGTGGCNONE 
J080317O15GTGGCCCACGTGGCNONE 
J090018O07GTGGCCCACGTGGCNONE 
Os08g0430700AK101681TGGTGGGCCACSimilar to UVB-resistance protein-like. 
AK102785TGGTGGGCCACNONE 
Os08g0447200AK067377GTGGTGGGCCAGSGT1 family protein. 
J013106M17GTGGTGGGCCAGNONE 
J033133D18GTGGTGGGCCAGNONE 
J033140B09GTGGTGGGCCAGNONE 
J100028I17GTGGTGGGCCAGNONE 
J100086C22GTGGTGGGCCAGNONE 
Os08g0463900AK120178AGTGGGCCAGConserved hypothetical protein. 
J013033H06AGTGGGCCAGNONE 
J075006G17AGTGGGCCAGNONE 
Os08g0474750J075009C13CGTGTGGGCCATNONE 
J075122O14CGTGTGGGCCATHypothetical protein. 
Os08g0474800Os08g0474800CGTGTGGGCCATEsterase/lipase/thioesterase domain containing protein. 
Os08g0490100009-038-D02CGTGGGCCACNONE 
J065152E11CGTGGGCCACSimilar to PBF protein. 
J090050K03CGTGGGCCACNONE 
J090053L01CGTGGGCCACNONE 
Os08g0503800AK101954ATGGCCCACACGSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
Os08g0511000AK107578AGTGGGCCAGAProtein prenyltransferase domain containing protein. 
Os08g0536300AF358777CTGGCCCACTGACANONE 
AK099722CTGGCCCACTGACASimilar to Hd1. 
J100054G13CTGGCCCACTGACANONE 
Os08g0544500AK071354TTGGCCCACCSimilar to ARP2/3 regulatory protein subunit NAPP. 
Os08g0564100AK063258GTGTGGGCCATSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0280600AK070961GTGGGCCACMnd1 family protein. 
J023066B13GTGGGCCACNONE 
Os09g0319800AK066759AGTGGGCCATTerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
Os09g0330200AK111018AGTGGGCCACConserved hypothetical protein. 
Os09g0397900AK101306GGCTGGGCTTTTTGGTGGGCCAASimilar to FEG protein. 
Os09g0401200AK106846GTGTGGGCCATNONE 
Os09g0437900AK107833GGTGGGCCAGASimilar to Adrenodoxin. 
Os09g0441900009-109-C08GTGGCCCACTNONE 
013-033-G05GTGGCCCACTNONE 
AK062809GTGGCCCACTNONE 
AK064043GTGGCCCACTNONE 
J023131I10GTGGCCCACTNONE 
J033032C18GTGGCCCACTNONE 
J033113E20GTGGCCCACTNONE 
Os09g0443800AK107689TGGTGGGCCAAConserved hypothetical protein. 
Os09g0446200011-092-H04AGTGGGCCACSpc97/Spc98 family protein. 
Os09g0453800AK119212ATGGCCCACTNONE 
J023081A04ATGGCCCACTNONE 
J065180G14ATGGCCCACTNONE 
J100024A17ATGGCCCACTNONE 
J100030A05ATGGCCCACTNONE 
J100042I11ATGGCCCACTNONE 
J100054N05ATGGCCCACTNONE 
J100075G23ATGGCCCACTNONE 
Os09g0462200AK064734CACGTGGGCCACEsterase/lipase/thioesterase domain containing protein. 
Os09g0462300J065097M23GTGGCCCACGTGEsterase/lipase/thioesterase domain containing protein. 
J065161K12GTGGCCCACGTGNONE 
Os09g0463700016-008-D06TTGGCCCACACGNONE 
AK060708TTGGCCCACACGSimilar to AHM1. 
J090013G05TTGGCCCACACGNONE 
Os09g0505700006-050-D06CCACTGACAAGTGGGCCATNONE 
AF189365CCACTGACAAGTGGGCCATNONE 
AK061034CCACTGACAAGTGGGCCATNONE 
AK069451CCACTGACAAGTGGGCCATRibulose-phosphate 3-epimerase, cytoplasmic isoform (EC 5.1.3.1) (Ribulose-5-phosphate-epimerase) (Cyt-RPEase) (RPEcyt) (Pentose-5- phosphate 3-epimerase) (PPE). 
J065081J09CCACTGACAAGTGGGCCATNONE 
J065115A18CCACTGACAAGTGGGCCATNONE 
J065143E16CCACTGACAAGTGGGCCATNONE 
J065146F17CCACTGACAAGTGGGCCATNONE 
J065201H17CCACTGACAAGTGGGCCATNONE 
J075029C13CCACTGACAAGTGGGCCATNONE 
J075049I05CCACTGACAAGTGGGCCATNONE 
J075122G19CCACTGACAAGTGGGCCATNONE 
J075132N08CCACTGACAAGTGGGCCATNONE 
Os09g0533900003-104-E05GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
012-076-C03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK067774GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK100449GTGGCCCACCACGCCTCGGCCCCACCCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023026E11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023028B20GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023050P11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023052K08GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023075J03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023078E15GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023090P12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023120E01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023142K01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033027K23GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058A09GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058C12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033125A04GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J043040L01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053061D06GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053096N13GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J065193H10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J090075L17GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J100050D10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
Os11g0118000AK100743CTGGCCCACAAEsterase/lipase/thioesterase domain containing protein. 
J023031M08CTGGCCCACAANONE 
J023118F07CTGGCCCACAANONE 
Os11g0131200J065024D18AGGTGGGCCAAMpv17/PMP22 family protein. 
J065206C17AGGTGGGCCAANONE 
Os11g0168200005-010-H01TTGTGGGCCAGAGCCCATCCNONE 
009-156-F07TTGTGGGCCAGAGCCCATCCNONE 
012-025-F01TTGTGGGCCAGAGCCCATCCNONE 
012-089-A02TTGTGGGCCAGAGCCCATCCNONE 
016-016-E08TTGTGGGCCAGAGCCCATCCNONE 
AK073392TTGTGGGCCAGAGCCCATCC60S ribosomal protein L3. 
AK099225TTGTGGGCCAGAGCCCATCCNONE 
AK101469TTGTGGGCCAGAGCCCATCCNONE 
AY236158TTGTGGGCCAGAGCCCATCCNONE 
J013152M22TTGTGGGCCAGAGCCCATCCNONE 
J023013N11TTGTGGGCCAGAGCCCATCCNONE 
J023038J11TTGTGGGCCAGAGCCCATCCNONE 
J023054N21TTGTGGGCCAGAGCCCATCCNONE 
J033041E13TTGTGGGCCAGAGCCCATCCNONE 
J033050O09TTGTGGGCCAGAGCCCATCCNONE 
J033093G05TTGTGGGCCAGAGCCCATCCNONE 
J033094J17TTGTGGGCCAGAGCCCATCCNONE 
J033112J24TTGTGGGCCAGAGCCCATCCNONE 
J033113D05TTGTGGGCCAGAGCCCATCCNONE 
J033120K10TTGTGGGCCAGAGCCCATCCNONE 
J033121H19TTGTGGGCCAGAGCCCATCCNONE 
J033129C08TTGTGGGCCAGAGCCCATCCNONE 
J033140H24TTGTGGGCCAGAGCCCATCCNONE 
J065020I18TTGTGGGCCAGAGCCCATCCNONE 
J065058L01TTGTGGGCCAGAGCCCATCCNONE 
J065059G22TTGTGGGCCAGAGCCCATCCNONE 
J065212L09TTGTGGGCCAGAGCCCATCCNONE 
J075047P09TTGTGGGCCAGAGCCCATCCNONE 
J075063C18TTGTGGGCCAGAGCCCATCCNONE 
J075076E07TTGTGGGCCAGAGCCCATCCNONE 
J075077F14TTGTGGGCCAGAGCCCATCCNONE 
J075086C22TTGTGGGCCAGAGCCCATCCNONE 
J075161L09TTGTGGGCCAGAGCCCATCCNONE 
J075177K20TTGTGGGCCAGAGCCCATCCNONE 
J090007L06TTGTGGGCCAGAGCCCATCCNONE 
J090010M02TTGTGGGCCAGAGCCCATCCNONE 
J090013M20TTGTGGGCCAGAGCCCATCCNONE 
J090044I15TTGTGGGCCAGAGCCCATCCNONE 
J090045O06TTGTGGGCCAGAGCCCATCCNONE 
J090060L04TTGTGGGCCAGAGCCCATCCNONE 
J090061C17TTGTGGGCCAGAGCCCATCCNONE 
J090062F10TTGTGGGCCAGAGCCCATCCNONE 
J090066L03TTGTGGGCCAGAGCCCATCCNONE 
J090089E13TTGTGGGCCAGAGCCCATCCNONE 
J090096D21TTGTGGGCCAGAGCCCATCCNONE 
J100039F12TTGTGGGCCAGAGCCCATCCNONE 
J100053N06TTGTGGGCCAGAGCCCATCCNONE 
Os11g0187500012-002-D06TCATGGGCTATGGCCCACGTNONE 
012-035-H04TCATGGGCTATGGCCCACGTNONE 
012-065-F08TCATGGGCTATGGCCCACGTNONE 
AK063977TCATGGGCTATGGCCCACGTSimilar to Heat shock protein 70. 
AK103083TCATGGGCTATGGCCCACGTNONE 
J033118G15TCATGGGCTATGGCCCACGTNONE 
J065115E02TCATGGGCTATGGCCCACGTNONE 
J065178K04TCATGGGCTATGGCCCACGTNONE 
J065178L03TCATGGGCTATGGCCCACGTNONE 
J090064A22TCATGGGCTATGGCCCACGTNONE 
Os11g0209100016-063-F03ATGGCCCACGCTTGTGGGCCTGNONE 
AK064391ATGGCCCACGCTTGTGGGCCTGCyclin-like F-box domain containing protein. 
J075027K02ATGGCCCACGCTTGTGGGCCTGNONE 
J075154K15ATGGCCCACGCTTGTGGGCCTGNONE 
Os11g0298400AK068577CAAGTGGGCCAARibulose bisphosphate carboxylase, small chain family protein. 
Os11g0448400AB095094ATGGCCCACASimilar to Sigma factor SIG2A. 
J075053H03ATGGCCCACANONE 
J075062F23ATGGCCCACANONE 
J090029D08ATGGCCCACANONE 
Os11g0629200AK065196ATGGCCCACCTSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os11g0648000AK066444GCCACGTGGCCCACAGGTGGGTCCCACSimilar to Na+/H+ antiporter. 
AK072026GCCACGTGGCCCACAGGTGGGTCCCACNONE 
Os11g0659500AK068543ACGTGGGCCACSimilar to Acyl-ACP thioesterase (Fragment). 
AK068543ACGTGGGCCACSimilar to Acyl-ACP thioesterase (Fragment). 
J013072O18ACGTGGGCCACNONE 
J013072O18ACGTGGGCCACNONE 
J013097B18ACGTGGGCCACNONE 
J013097B18ACGTGGGCCACNONE 
J013157H03ACGTGGGCCACNONE 
J013157H03ACGTGGGCCACNONE 
J023001D14ACGTGGGCCACNONE 
J023001D14ACGTGGGCCACNONE 
J080311F23ACGTGGGCCACNONE 
J080311F23ACGTGGGCCACNONE 
J090030F08ACGTGGGCCACNONE 
J090030F08ACGTGGGCCACNONE 
J090036B09ACGTGGGCCACNONE 
J090036B09ACGTGGGCCACNONE 
J090045G05ACGTGGGCCACNONE 
J090045G05ACGTGGGCCACNONE 
J100054J10ACGTGGGCCACNONE 
J100054J10ACGTGGGCCACNONE 
Os12g0155200AK067300TTGGCCCACTCCSimilar to Rac GTPase activating protein. 
J090050C04TTGGCCCACTCCNONE 
Os12g0230600AK072568CTGGCCCACCACCCCCCAProtein of unknown function DUF1685 family protein. 
Os12g0242500J065129F10GTGTGGGCCATNONE 
J090032G12GTGTGGGCCATConserved hypothetical protein. 
Os12g0285600AK069104CGACACGTGGGCCATOxysterol-binding protein family protein. 
AK069104CTGGCCCACGCGOxysterol-binding protein family protein. 
Os12g0292400006-063-H05GTGGCCCACTNONE 
006-083-H03GTGGCCCACTNONE 
006-098-B04GTGGCCCACTNONE 
009-006-G02GTGGCCCACTNONE 
009-018-H03GTGGCCCACTNONE 
009-019-F09GTGGCCCACTNONE 
009-023-G12GTGGCCCACTNONE 
009-028-B05GTGGCCCACTNONE 
009-036-E09GTGGCCCACTNONE 
009-041-D03GTGGCCCACTNONE 
009-068-E01GTGGCCCACTNONE 
009-084-A08GTGGCCCACTNONE 
009-110-B10GTGGCCCACTNONE 
009-113-E12GTGGCCCACTNONE 
009-123-F08GTGGCCCACTNONE 
009-136-D11GTGGCCCACTNONE 
009-144-H09GTGGCCCACTNONE 
009-162-D06GTGGCCCACTNONE 
009-172-G02GTGGCCCACTNONE 
009-174-D05GTGGCCCACTNONE 
009-181-A04GTGGCCCACTNONE 
009-181-F10GTGGCCCACTNONE 
009-184-C01GTGGCCCACTNONE 
009-185-A12GTGGCCCACTNONE 
009-186-F01GTGGCCCACTNONE 
009-188-A04GTGGCCCACTNONE 
009-188-H09GTGGCCCACTNONE 
009-194-A02GTGGCCCACTNONE 
009-194-C12GTGGCCCACTNONE 
014-008-D06GTGGCCCACTNONE 
AK068266GTGGCCCACTSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
AK070257GTGGCCCACTNONE 
J013149A10GTGGCCCACTNONE 
J023042N11GTGGCCCACTNONE 
J065008A06GTGGCCCACTNONE 
J065013C20GTGGCCCACTNONE 
J065013C24GTGGCCCACTNONE 
J065015F19GTGGCCCACTNONE 
J065017A05GTGGCCCACTNONE 
J065017L20GTGGCCCACTNONE 
J065021H14GTGGCCCACTNONE 
J065026K06GTGGCCCACTNONE 
J065028A05GTGGCCCACTNONE 
J065028L01GTGGCCCACTNONE 
J065028P08GTGGCCCACTNONE 
J065029I11GTGGCCCACTNONE 
J065032H19GTGGCCCACTNONE 
J065032K20GTGGCCCACTNONE 
J065035N23GTGGCCCACTNONE 
J065036A21GTGGCCCACTNONE 
J065040B13GTGGCCCACTNONE 
J065043D04GTGGCCCACTNONE 
J065045A20GTGGCCCACTNONE 
J065048G23GTGGCCCACTNONE 
J065049P06GTGGCCCACTNONE 
J065054H13GTGGCCCACTNONE 
J065057M06GTGGCCCACTNONE 
J065058P12GTGGCCCACTNONE 
J065059A12GTGGCCCACTNONE 
J065064J15GTGGCCCACTNONE 
J065066I19GTGGCCCACTNONE 
J065069B20GTGGCCCACTNONE 
J065071O19GTGGCCCACTNONE 
J065073E16GTGGCCCACTNONE 
J065073N04GTGGCCCACTNONE 
J065074L22GTGGCCCACTNONE 
J065075J08GTGGCCCACTNONE 
J065075K04GTGGCCCACTNONE 
J065075L14GTGGCCCACTNONE 
J065078F13GTGGCCCACTNONE 
J065081A10GTGGCCCACTNONE 
J065083H02GTGGCCCACTNONE 
J065083H05GTGGCCCACTNONE 
J065088C07GTGGCCCACTNONE 
J065088D02GTGGCCCACTNONE 
J065096C10GTGGCCCACTNONE 
J065103I09GTGGCCCACTNONE 
J065107N04GTGGCCCACTNONE 
J065108L19GTGGCCCACTNONE 
J065108O06GTGGCCCACTNONE 
J065111D07GTGGCCCACTNONE 
J065112H15GTGGCCCACTNONE 
J065112L15GTGGCCCACTNONE 
J065112M18GTGGCCCACTNONE 
J065113F02GTGGCCCACTNONE 
J065114C11GTGGCCCACTNONE 
J065116E12GTGGCCCACTNONE 
J065119E03GTGGCCCACTNONE 
J065120C19GTGGCCCACTNONE 
J065120H22GTGGCCCACTNONE 
J065121M16GTGGCCCACTNONE 
J065121N17GTGGCCCACTNONE 
J065123E20GTGGCCCACTNONE 
J065127F18GTGGCCCACTNONE 
J065130M04GTGGCCCACTNONE 
J065131N01GTGGCCCACTNONE 
J065134A05GTGGCCCACTNONE 
J065136L05GTGGCCCACTNONE 
J065138D04GTGGCCCACTNONE 
J065138E04GTGGCCCACTNONE 
J065138P10GTGGCCCACTNONE 
J065141E12GTGGCCCACTNONE 
J065142F20GTGGCCCACTNONE 
J065143D19GTGGCCCACTNONE 
J065143N05GTGGCCCACTNONE 
J065146K06GTGGCCCACTNONE 
J065150A10GTGGCCCACTNONE 
J065150J16GTGGCCCACTNONE 
J065151H15GTGGCCCACTNONE 
J065151K19GTGGCCCACTNONE 
J065151P22GTGGCCCACTNONE 
J065154L17GTGGCCCACTNONE 
J065158A20GTGGCCCACTNONE 
J065158C05GTGGCCCACTNONE 
J065161E16GTGGCCCACTNONE 
J065162A22GTGGCCCACTNONE 
J065162K19GTGGCCCACTNONE 
J065165L15GTGGCCCACTNONE 
J065170J09GTGGCCCACTNONE 
J065171J22GTGGCCCACTNONE 
J065172L15GTGGCCCACTNONE 
J065174B07GTGGCCCACTNONE 
J065174D24GTGGCCCACTNONE 
J065175L22GTGGCCCACTNONE 
J065176C04GTGGCCCACTNONE 
J065176K18GTGGCCCACTNONE 
J065180P21GTGGCCCACTNONE 
J065183A09GTGGCCCACTNONE 
J065187E22GTGGCCCACTNONE 
J065192F01GTGGCCCACTNONE 
J065194E23GTGGCCCACTNONE 
J065196A13GTGGCCCACTNONE 
J065196F18GTGGCCCACTNONE 
J065196P03GTGGCCCACTNONE 
J065204P15GTGGCCCACTNONE 
J065207L24GTGGCCCACTNONE 
J065207O18GTGGCCCACTNONE 
J065210B18GTGGCCCACTNONE 
J065210H05GTGGCCCACTNONE 
J065210M24GTGGCCCACTNONE 
J065212F02GTGGCCCACTNONE 
J065219H13GTGGCCCACTNONE 
J075003J22GTGGCCCACTNONE 
J075006N24GTGGCCCACTNONE 
J075007M07GTGGCCCACTNONE 
J075011D05GTGGCCCACTNONE 
J075026I09GTGGCCCACTNONE 
J075030K22GTGGCCCACTNONE 
J075040P09GTGGCCCACTNONE 
J075042L19GTGGCCCACTNONE 
J075043B01GTGGCCCACTNONE 
J075044M04GTGGCCCACTNONE 
J075048H12GTGGCCCACTNONE 
J075049E04GTGGCCCACTNONE 
J075054L07GTGGCCCACTNONE 
J075060D03GTGGCCCACTNONE 
J075064E01GTGGCCCACTNONE 
J075064I24GTGGCCCACTNONE 
J075071L20GTGGCCCACTNONE 
J075075G19GTGGCCCACTNONE 
J075076H14GTGGCCCACTNONE 
J075081E01GTGGCCCACTNONE 
J075089O22GTGGCCCACTNONE 
J075095K19GTGGCCCACTNONE 
J075096L09GTGGCCCACTNONE 
J075105J11GTGGCCCACTNONE 
J075106E16GTGGCCCACTNONE 
J075110A07GTGGCCCACTNONE 
J075116F14GTGGCCCACTNONE 
J075130L19GTGGCCCACTNONE 
J075133I07GTGGCCCACTNONE 
J075137P15GTGGCCCACTNONE 
J075139J03GTGGCCCACTNONE 
J075142L14GTGGCCCACTNONE 
J075144B16GTGGCCCACTNONE 
J075155J18GTGGCCCACTNONE 
J075160O14GTGGCCCACTNONE 
J075161H15GTGGCCCACTNONE 
J075169I05GTGGCCCACTNONE 
J075171J22GTGGCCCACTNONE 
J075179K20GTGGCCCACTNONE 
J075183J01GTGGCCCACTNONE 
J075183O05GTGGCCCACTNONE 
J075184C15GTGGCCCACTNONE 
J075184J21GTGGCCCACTNONE 
J075190G24GTGGCCCACTNONE 
J075196M20GTGGCCCACTNONE 
J080002B08GTGGCCCACTNONE 
J080004M09GTGGCCCACTNONE 
J080008J04GTGGCCCACTNONE 
J080012E01GTGGCCCACTNONE 
J080015L07GTGGCCCACTNONE 
J080017P10GTGGCCCACTNONE 
J080018G20GTGGCCCACTNONE 
J080020F04GTGGCCCACTNONE 
J080021E04GTGGCCCACTNONE 
J080027O08GTGGCCCACTNONE 
J080034C06GTGGCCCACTNONE 
J080034H14GTGGCCCACTNONE 
J080036G10GTGGCCCACTNONE 
J080037C10GTGGCCCACTNONE 
J080038H18GTGGCCCACTNONE 
J080044A19GTGGCCCACTNONE 
J080045I24GTGGCCCACTNONE 
J080050G19GTGGCCCACTNONE 
J080050K24GTGGCCCACTNONE 
J080054F12GTGGCCCACTNONE 
J080059J09GTGGCCCACTNONE 
J080061P18GTGGCCCACTNONE 
J080065O20GTGGCCCACTNONE 
J080068D16GTGGCCCACTNONE 
J080069P21GTGGCCCACTNONE 
J080072D12GTGGCCCACTNONE 
J080079D01GTGGCCCACTNONE 
J080079J23GTGGCCCACTNONE 
J080087B09GTGGCCCACTNONE 
J080091J12GTGGCCCACTNONE 
J080092K11GTGGCCCACTNONE 
J080304A18GTGGCCCACTNONE 
J080309O09GTGGCCCACTNONE 
J080312G11GTGGCCCACTNONE 
J080315B02GTGGCCCACTNONE 
J080315B22GTGGCCCACTNONE 
J080318K05GTGGCCCACTNONE 
J080318M07GTGGCCCACTNONE 
J090003I22GTGGCCCACTNONE 
J090010J03GTGGCCCACTNONE 
J090020J06GTGGCCCACTNONE 
J090032D18GTGGCCCACTNONE 
J090055N15GTGGCCCACTNONE 
J090056P03GTGGCCCACTNONE 
J090057N17GTGGCCCACTNONE 
J090082K17GTGGCCCACTNONE 
J090084M06GTGGCCCACTNONE 
J100039O13GTGGCCCACTNONE 
J100067C07GTGGCCCACTNONE 
J100090J23GTGGCCCACTNONE 
Os12g0408000AK109709ATGGCCCACAAProtein of unknown function DUF594 family protein. 
J075021B20ATGGCCCACAANONE 
J075034G20ATGGCCCACAANONE 
J075087F21ATGGCCCACAANONE 
J075177E12ATGGCCCACAANONE 
J075194D14ATGGCCCACAANONE 
Os12g0408800AK059660ATGGCCCACCTNONE 
AK068032ATGGCCCACCTNONE 
J013131D11ATGGCCCACCTNONE 
Os12g0460800J023003J21CACTGACACGTGGGCCACNONE 
Os12g0533500AK068646GGGCTGGGCCGCGTGGGCCAAConserved hypothetical protein. 
J013158L10GGGCTGGGCCGCGTGGGCCAANONE 
J065083J02GGGCTGGGCCGCGTGGGCCAANONE 
J075079D02GGGCTGGGCCGCGTGGGCCAANONE 
J100037H16GGGCTGGGCCGCGTGGGCCAANONE 
J100075P13GGGCTGGGCCGCGTGGGCCAANONE 
Os12g0572400016-084-F04ATGGCCCACAANONE 
AK065531ATGGCCCACAASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03ATGGCCCACAANONE 
J013034H02ATGGCCCACAANONE 
J033117N05ATGGCCCACAANONE 
J065027L09ATGGCCCACAANONE 
J065037D09ATGGCCCACAANONE 
J065197I09ATGGCCCACAANONE 
J090045C01ATGGCCCACAANONE 
J100031E11ATGGCCCACAANONE 
Os12g0599900AK101252ATGGCCCACCTGTCAGTetratricopeptide region domain containing protein. 
J033032F05ATGGCCCACCTGTCAGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.