version

Summary of OsREG655 (All List)

OrganismOryza sativa  
IDOsREG655  
SequenceTAAGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count853  

Entry Sequences (853 entries)

LocusGene modelSequenceDescription
Os01g0172400AK065102TAAGCCCAGNONE 
AK100365TAAGCCCAGNONE 
AK119523TAAGCCCAGNONE 
D73411TAAGCCCAGPhospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1). 
J013001N03TAAGCCCAGNONE 
J013052B12TAAGCCCAGNONE 
J013071F15TAAGCCCAGNONE 
J013108F19TAAGCCCAGNONE 
J023025E17TAAGCCCAGNONE 
J023083O10TAAGCCCAGNONE 
J023084M17TAAGCCCAGNONE 
J023100D16TAAGCCCAGNONE 
J023107O10TAAGCCCAGNONE 
J023119F08TAAGCCCAGNONE 
J033035B07TAAGCCCAGNONE 
J033052C18TAAGCCCAGNONE 
J033092H11TAAGCCCAGNONE 
J033096D02TAAGCCCAGNONE 
J033117A16TAAGCCCAGNONE 
J043010E08TAAGCCCAGNONE 
J043013C12TAAGCCCAGNONE 
J065001M15TAAGCCCAGNONE 
J065021O11TAAGCCCAGNONE 
J065089O20TAAGCCCAGNONE 
J065117N05TAAGCCCAGNONE 
J065129L11TAAGCCCAGNONE 
J065170F18TAAGCCCAGNONE 
J090066E11TAAGCCCAGNONE 
J090076N24TAAGCCCAGNONE 
J090093G21TAAGCCCAGNONE 
J100041H17TAAGCCCAGNONE 
J100050D07TAAGCCCAGNONE 
J100063A06TAAGCCCAGNONE 
Os01g0186900AK106168TAAGCCCACCTNONE 
J075116O22TAAGCCCACCTNONE 
J100060H12TAAGCCCACCTNONE 
Os01g0349000AK108540TAAGCCCAAAAConserved hypothetical protein. 
J065059M15TAAGCCCAAAANONE 
Os01g0508300AK101435TGATGGGCTTANONE 
AK111287TGATGGGCTTAConserved hypothetical protein. 
J065096N08TGATGGGCTTANONE 
J075003F13TGATGGGCTTANONE 
J075014I16TGATGGGCTTANONE 
J075022D23TGATGGGCTTANONE 
J075040N19TGATGGGCTTANONE 
J075121O06TGATGGGCTTANONE 
J075131E17TGATGGGCTTANONE 
J075136N22TGATGGGCTTANONE 
J075147D01TGATGGGCTTANONE 
J075173C07TGATGGGCTTANONE 
J075196L22TGATGGGCTTANONE 
Os01g0620100AK070122TAAGCCCACAWD40-like domain containing protein. 
J023044A10TAAGCCCACANONE 
J033023C13TAAGCCCACANONE 
J033045E16TAAGCCCACANONE 
J033111H03TAAGCCCACANONE 
Os01g0643900AK108288TAAGCCCAGTAOleosin family protein. 
Os01g0681900AB008845AATGGGCTTANADH dependent Glutamate Synthase precursor (EC 1.4.1.14). 
AK105755AATGGGCTTANONE 
Os01g0686800006-098-B12GGATGGGCTTANONE 
006-113-H04GGATGGGCTTANONE 
AK060428GGATGGGCTTANONE 
AK098877GGATGGGCTTANONE 
AK098893GGATGGGCTTANONE 
AK121587GGATGGGCTTAGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231GGATGGGCTTANONE 
J013001E12GGATGGGCTTANONE 
J013001N15GGATGGGCTTANONE 
J013098G22GGATGGGCTTANONE 
J023004P15GGATGGGCTTANONE 
J023014D09GGATGGGCTTANONE 
J023020G09GGATGGGCTTANONE 
J023034A19GGATGGGCTTANONE 
J023050I11GGATGGGCTTANONE 
J023079D13GGATGGGCTTANONE 
J023091B11GGATGGGCTTANONE 
J023099M03GGATGGGCTTANONE 
J023101H20GGATGGGCTTANONE 
J023106P14GGATGGGCTTANONE 
J023111F19GGATGGGCTTANONE 
J023132C22GGATGGGCTTANONE 
J023139O03GGATGGGCTTANONE 
J023146O10GGATGGGCTTANONE 
J033022G16GGATGGGCTTANONE 
J033030C10GGATGGGCTTANONE 
J033032G18GGATGGGCTTANONE 
J033034N09GGATGGGCTTANONE 
J033037K24GGATGGGCTTANONE 
J033038B22GGATGGGCTTANONE 
J033061E06GGATGGGCTTANONE 
J033065F08GGATGGGCTTANONE 
J033065I24GGATGGGCTTANONE 
J033069L01GGATGGGCTTANONE 
J033086N21GGATGGGCTTANONE 
J033102I06GGATGGGCTTANONE 
J033111N07GGATGGGCTTANONE 
J033118K11GGATGGGCTTANONE 
J033125D08GGATGGGCTTANONE 
J033129P22GGATGGGCTTANONE 
J033131L12GGATGGGCTTANONE 
J033139D08GGATGGGCTTANONE 
J033141J08GGATGGGCTTANONE 
J043024B14GGATGGGCTTANONE 
J053048G19GGATGGGCTTANONE 
J065023B15GGATGGGCTTANONE 
J065082C15GGATGGGCTTANONE 
J065087D24GGATGGGCTTANONE 
J065122D11GGATGGGCTTANONE 
J065128P13GGATGGGCTTANONE 
J065149I19GGATGGGCTTANONE 
J065154E16GGATGGGCTTANONE 
J065156K21GGATGGGCTTANONE 
J065166H09GGATGGGCTTANONE 
J065169F24GGATGGGCTTANONE 
J065194I16GGATGGGCTTANONE 
J065213M20GGATGGGCTTANONE 
J075020F19GGATGGGCTTANONE 
J075051J16GGATGGGCTTANONE 
J075093C18GGATGGGCTTANONE 
J075119H02GGATGGGCTTANONE 
J075120J11GGATGGGCTTANONE 
J075173A15GGATGGGCTTANONE 
J080302B05GGATGGGCTTANONE 
J080304G10GGATGGGCTTANONE 
J080305E13GGATGGGCTTANONE 
J080315L11GGATGGGCTTANONE 
J090005H15GGATGGGCTTANONE 
J090021C24GGATGGGCTTANONE 
J090025H24GGATGGGCTTANONE 
J090025M11GGATGGGCTTANONE 
J090026C22GGATGGGCTTANONE 
J090027H15GGATGGGCTTANONE 
J090034B17GGATGGGCTTANONE 
J090045G11GGATGGGCTTANONE 
J090048H02GGATGGGCTTANONE 
J090051N04GGATGGGCTTANONE 
J090052I06GGATGGGCTTANONE 
J090054L17GGATGGGCTTANONE 
J090060M22GGATGGGCTTANONE 
J090075N17GGATGGGCTTANONE 
J090079K13GGATGGGCTTANONE 
J090086H08GGATGGGCTTANONE 
J090094N20GGATGGGCTTANONE 
J100021F03GGATGGGCTTANONE 
J100031M01GGATGGGCTTANONE 
J100033I18GGATGGGCTTANONE 
J100034P07GGATGGGCTTANONE 
J100043M16GGATGGGCTTANONE 
J100046J12GGATGGGCTTANONE 
J100055F09GGATGGGCTTANONE 
J100057D19GGATGGGCTTANONE 
J100060O10GGATGGGCTTANONE 
J100064G09GGATGGGCTTANONE 
J100077F24GGATGGGCTTANONE 
J100080E12GGATGGGCTTANONE 
J100089J04GGATGGGCTTANONE 
Os01g0688200AK120982TAAGCCCATCTGGGCCCAACAAlpha/beta hydrolase family protein. 
Os01g0707300AK059962TAAGCCCAACANONE 
AK104463TAAGCCCAACASimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0781000006-077-C12GTTGGGCTTANONE 
009-156-E02GTTGGGCTTANONE 
AK059870GTTGGGCTTAVacuolar protein sorting-associated, VPS28 family protein. 
AK099116GTTGGGCTTANONE 
AK104274GTTGGGCTTANONE 
J023034E12GTTGGGCTTANONE 
J075074G06GTTGGGCTTANONE 
J090041H03GTTGGGCTTANONE 
J100045K08GTTGGGCTTANONE 
Os01g0926400AK063916TCATGGGCTTANONE 
AK073976TCATGGGCTTASimilar to Pectin-glucuronyltransferase. 
Os01g0949500006-054-G03TACTGGGCTTANONE 
006-095-H01TACTGGGCTTANONE 
006-101-D08TACTGGGCTTANONE 
006-110-A10TACTGGGCTTANONE 
AK068769TACTGGGCTTANONE 
AK070662TACTGGGCTTASimilar to Calmodulin (CaM). 
AK104094TACTGGGCTTANONE 
AK104159TACTGGGCTTANONE 
J065045M16TACTGGGCTTANONE 
J075112E20TACTGGGCTTANONE 
J100074O04TACTGGGCTTANONE 
J100078F05TACTGGGCTTANONE 
Os01g0951800AK069239TCGTGGGCTTAProtein prenyltransferase domain containing protein. 
Os01g0952600AK067525GTTGGTGGGCTTANONE 
AK070047GTTGGTGGGCTTASimilar to LacZ (Fragment). 
Os01g0966200009-079-H11GTGGGCTTANONE 
009-124-G10GTGGGCTTANONE 
AK058564GTGGGCTTAProtein of unknown function YGGT family protein. 
AK098935GTGGGCTTANONE 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os02g0163600AK068043TCATGGGCTTAConserved hypothetical protein. 
J013131O20TCATGGGCTTANONE 
J065006E03TCATGGGCTTANONE 
Os02g0168500011-010-B05TAAGCCCAAGNONE 
AJ831493TAAGCCCAAGNONE 
AK073338TAAGCCCAAGNONE 
AK073486TAAGCCCAAGConserved hypothetical protein. 
J100059F05TAAGCCCAAGNONE 
J100082K14TAAGCCCAAGNONE 
J100090P09TAAGCCCAAGNONE 
Os02g0178400009-151-B08AGATGGGCTTANONE 
AK063815AGATGGGCTTAProtein transport protein SEC61 gamma subunit. 
AK121516AGATGGGCTTANONE 
J033026A17AGATGGGCTTANONE 
J065011K14AGATGGGCTTANONE 
J065056D01AGATGGGCTTANONE 
J065061L22AGATGGGCTTANONE 
J065076M01AGATGGGCTTANONE 
J075092E14AGATGGGCTTANONE 
Os02g0287000006-107-B10CTTGGGCTTANONE 
006-120-E07CTTGGGCTTANONE 
AF052503CTTGGGCTTANONE 
AK059647CTTGGGCTTASimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131CTTGGGCTTANONE 
J023048M05CTTGGGCTTANONE 
J033107L10CTTGGGCTTANONE 
J065019A12CTTGGGCTTANONE 
J065064J21CTTGGGCTTANONE 
J065071D15CTTGGGCTTANONE 
J065094L12CTTGGGCTTANONE 
J065095L06CTTGGGCTTANONE 
J065097J11CTTGGGCTTANONE 
J065099M08CTTGGGCTTANONE 
J065104D01CTTGGGCTTANONE 
J065107L02CTTGGGCTTANONE 
J065110D14CTTGGGCTTANONE 
J065135J07CTTGGGCTTANONE 
J065137C16CTTGGGCTTANONE 
J065150C07CTTGGGCTTANONE 
J065165I10CTTGGGCTTANONE 
J065189F07CTTGGGCTTANONE 
J065205L22CTTGGGCTTANONE 
J065214C09CTTGGGCTTANONE 
J065217G17CTTGGGCTTANONE 
J075029E17CTTGGGCTTANONE 
J075054O16CTTGGGCTTANONE 
J075068N23CTTGGGCTTANONE 
J075135N18CTTGGGCTTANONE 
J075152G09CTTGGGCTTANONE 
J075162D10CTTGGGCTTANONE 
J075164F11CTTGGGCTTANONE 
J080036L12CTTGGGCTTANONE 
J080049K18CTTGGGCTTANONE 
J080060P03CTTGGGCTTANONE 
J080062G16CTTGGGCTTANONE 
J080062G21CTTGGGCTTANONE 
J080064N07CTTGGGCTTANONE 
J080075I22CTTGGGCTTANONE 
J080086F20CTTGGGCTTANONE 
J080087G07CTTGGGCTTANONE 
J080088I06CTTGGGCTTANONE 
J080302B20CTTGGGCTTANONE 
J080303L14CTTGGGCTTANONE 
J080309O12CTTGGGCTTANONE 
J080317F12CTTGGGCTTANONE 
J080317P18CTTGGGCTTANONE 
J090013L15CTTGGGCTTANONE 
J090043N04CTTGGGCTTANONE 
J090085G01CTTGGGCTTANONE 
J090085G19CTTGGGCTTANONE 
Os02g0549600009-119-C10TAAGCCCACNONE 
AK066564TAAGCCCACSimilar to 40S ribosomal protein S10-1. 
J013073I17TAAGCCCACNONE 
J013104F19TAAGCCCACNONE 
J013104K21TAAGCCCACNONE 
J013110E05TAAGCCCACNONE 
J023020L11TAAGCCCACNONE 
J023130D08TAAGCCCACNONE 
J033041D03TAAGCCCACNONE 
J033105K14TAAGCCCACNONE 
J065040N14TAAGCCCACNONE 
J065157A09TAAGCCCACNONE 
J075123A20TAAGCCCACNONE 
J075129F06TAAGCCCACNONE 
J075135E04TAAGCCCACNONE 
J075173A10TAAGCCCACNONE 
J080301E09TAAGCCCACNONE 
J080306D10TAAGCCCACNONE 
J080310M21TAAGCCCACNONE 
J080312M09TAAGCCCACNONE 
J080319J08TAAGCCCACNONE 
J090036L14TAAGCCCACNONE 
J090051D01TAAGCCCACNONE 
J090066K07TAAGCCCACNONE 
Os02g0577400003-116-C07CTGGGCTTANONE 
AK062584CTGGGCTTAConserved hypothetical protein. 
Os02g0610700014-008-A03TAAGCCCACGTAGGCCCAAACNONE 
AK059205TAAGCCCACGTAGGCCCAAACConserved hypothetical protein. 
AK100281TAAGCCCACGTAGGCCCAAACNONE 
J023074H03TAAGCCCACGTAGGCCCAAACNONE 
J065002J16TAAGCCCACGTAGGCCCAAACNONE 
J065032I20TAAGCCCACGTAGGCCCAAACNONE 
J065076A07TAAGCCCACGTAGGCCCAAACNONE 
J065142O21TAAGCCCACGTAGGCCCAAACNONE 
J065203A03TAAGCCCACGTAGGCCCAAACNONE 
J075017F24TAAGCCCACGTAGGCCCAAACNONE 
J075017G24TAAGCCCACGTAGGCCCAAACNONE 
Os02g0629900AK108563TAAGCCCATAAConserved hypothetical protein. 
J065138O07TAAGCCCATAANONE 
Os02g0673000AK108650TAAGCCCAAGProtein of unknown function UPF0005 family protein. 
Os02g0721100AK108167TAAGCCCAACASimilar to E2 ubiquitin-conjugating enzyme UbcH5B (Fragment). 
Os02g0740300AK067833TAAGCCCATTTTGGGCCTGAAA ATPase domain containing protein. 
Os02g0761100AK070404TAAGCCCAGTASimilar to Cyclophilin-40 (Expressed protein). 
Os02g0791400009-106-F11CTTGGGCTTANONE 
AK062787CTTGGGCTTACytochrome oxidase c, subunit VIb family protein. 
Os02g0830100J013032G02TAAGCCCAAAANONE 
J013052O21TAAGCCCAAAANONE 
J023078A05TAAGCCCAAAANONE 
J033114C07TAAGCCCAAAANONE 
J033125M07TAAGCCCAAAANONE 
J053045C11TAAGCCCAAAANONE 
J100055G05TAAGCCCAAAANONE 
J100080J22TAAGCCCAAAANONE 
Os03g0151900009-084-F09TAAGCCCACNONE 
AB032761TAAGCCCACNONE 
AK105389TAAGCCCACNONE 
AK121527TAAGCCCACSimilar to Small GTP-binding protein. 
J075028M03TAAGCCCACNONE 
J075031H15TAAGCCCACNONE 
J075045L24TAAGCCCACNONE 
J075055K14TAAGCCCACNONE 
J075100O08TAAGCCCACNONE 
J075112B20TAAGCCCACNONE 
J075188D21TAAGCCCACNONE 
Os03g0167600AK121254TAAGCCCAAAASimilar to Male sterility protein 2. 
Os03g0181600AK067807TAAGCCCACCAACGGCTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TAAGCCCACCAACGGCTNONE 
Os03g0192400009-081-A03TAAGCCCATTANONE 
009-159-B02TAAGCCCATTANONE 
AK070573TAAGCCCATTAGRIM-19 family protein. 
J023056B01TAAGCCCATTANONE 
J023075G06TAAGCCCATTANONE 
J033048K16TAAGCCCATTANONE 
J033048L16TAAGCCCATTANONE 
J053031H23TAAGCCCATTANONE 
J065002H14TAAGCCCATTANONE 
J065006G22TAAGCCCATTANONE 
J065032G13TAAGCCCATTANONE 
J065056A09TAAGCCCATTANONE 
J065078I01TAAGCCCATTANONE 
J065095G01TAAGCCCATTANONE 
J065095I18TAAGCCCATTANONE 
J065134M18TAAGCCCATTANONE 
J065158P07TAAGCCCATTANONE 
J065165K17TAAGCCCATTANONE 
J065181J12TAAGCCCATTANONE 
J065189N09TAAGCCCATTANONE 
J065200D13TAAGCCCATTANONE 
J065202H20TAAGCCCATTANONE 
J065215K20TAAGCCCATTANONE 
J075049N19TAAGCCCATTANONE 
J075147J16TAAGCCCATTANONE 
J090081E19TAAGCCCATTANONE 
J100017C16TAAGCCCATTANONE 
J100039M16TAAGCCCATTANONE 
J100043E23TAAGCCCATTANONE 
J100063L12TAAGCCCATTANONE 
J100079F22TAAGCCCATTANONE 
Os03g0279600006-070-A07TAAGCCCACCANONE 
AK061080TAAGCCCACCAConserved hypothetical protein. 
AK071043TAAGCCCACCANONE 
AK103191TAAGCCCACCANONE 
J065077E22TAAGCCCACCANONE 
J065208F22TAAGCCCACCANONE 
J075156K12TAAGCCCACCANONE 
Os03g0308100AB116073TAAGCCCATGAPeptidase S14, ClpP family protein. 
AK060518TAAGCCCATGANONE 
AK099107TAAGCCCATGANONE 
AK105977TAAGCCCATGANONE 
J065005O19TAAGCCCATGANONE 
J065007L02TAAGCCCATGANONE 
J065128G15TAAGCCCATGANONE 
J065128N14TAAGCCCATGANONE 
J075010E21TAAGCCCATGANONE 
J075101J24TAAGCCCATGANONE 
J075124O14TAAGCCCATGANONE 
J075126O07TAAGCCCATGANONE 
Os03g0332700AK072820TAAGCCCATTAGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0335100AK107094TAAGCCCACAConserved hypothetical protein. 
Os03g0335300AK098846TAAGCCCAACCNONE 
AK098891TAAGCCCAACCNONE 
AK111509TAAGCCCAACCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847TAAGCCCAACCNONE 
AK121413TAAGCCCAACCNONE 
Os03g0372700AK064323AGTTGGGCTTANONE 
AK073312AGTTGGGCTTALow temperature viability protein family protein. 
Os03g0442400Os03g0442400TAAGCCCAGTTNONE 
Os03g0581800009-177-G11TAAGCCCATCCGGCCCAAATNONE 
AK059201TAAGCCCATCCGGCCCAAATNONE 
AK121839TAAGCCCATCCGGCCCAAATHypothetical protein. 
J023022K06TAAGCCCATCCGGCCCAAATNONE 
J023110K21TAAGCCCATCCGGCCCAAATNONE 
J033100N18TAAGCCCATCCGGCCCAAATNONE 
J033120D11TAAGCCCATCCGGCCCAAATNONE 
J065044P15TAAGCCCATCCGGCCCAAATNONE 
J065102G22TAAGCCCATCCGGCCCAAATNONE 
J065149N14TAAGCCCATCCGGCCCAAATNONE 
J065201L18TAAGCCCATCCGGCCCAAATNONE 
J065205K10TAAGCCCATCCGGCCCAAATNONE 
J075035D19TAAGCCCATCCGGCCCAAATNONE 
J075073E06TAAGCCCATCCGGCCCAAATNONE 
J075134M11TAAGCCCATCCGGCCCAAATNONE 
J090004P12TAAGCCCATCCGGCCCAAATNONE 
J090070H20TAAGCCCATCCGGCCCAAATNONE 
J090087B04TAAGCCCATCCGGCCCAAATNONE 
J100028F10TAAGCCCATCCGGCCCAAATNONE 
J100036M18TAAGCCCATCCGGCCCAAATNONE 
J100065C24TAAGCCCATCCGGCCCAAATNONE 
J100080O13TAAGCCCATCCGGCCCAAATNONE 
Os03g0668000AK111705TAAGCCCATGGNONE 
AK111783TAAGCCCATGGCyclin-like F-box domain containing protein. 
J023087J12TAAGCCCATGGNONE 
Os03g0807800AK064984AATGGGCTTASimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14AATGGGCTTANONE 
J065015J20AATGGGCTTANONE 
J065122L11AATGGGCTTANONE 
J065217E10AATGGGCTTANONE 
J075023C02AATGGGCTTANONE 
J075102O04AATGGGCTTANONE 
J080024G24AATGGGCTTANONE 
J080033F02AATGGGCTTANONE 
J080047M13AATGGGCTTANONE 
J080048A22AATGGGCTTANONE 
J080056E06AATGGGCTTANONE 
J080064O11AATGGGCTTANONE 
Os03g0809300011-024-C02TATTGGGCTTANONE 
016-071-E09TATTGGGCTTANONE 
AK103140TATTGGGCTTAProtein phosphatase 2C-like domain containing protein. 
J013030O08TATTGGGCTTANONE 
J013108D19TATTGGGCTTANONE 
J013124D15TATTGGGCTTANONE 
J013128F17TATTGGGCTTANONE 
J013146J06TATTGGGCTTANONE 
J013149D12TATTGGGCTTANONE 
J013154P12TATTGGGCTTANONE 
J013162N01TATTGGGCTTANONE 
J013170G15TATTGGGCTTANONE 
J013170H16TATTGGGCTTANONE 
J023022I09TATTGGGCTTANONE 
J023072B19TATTGGGCTTANONE 
J023106H09TATTGGGCTTANONE 
J023135C03TATTGGGCTTANONE 
J023141C09TATTGGGCTTANONE 
J033091K23TATTGGGCTTANONE 
J033107I05TATTGGGCTTANONE 
J033112M18TATTGGGCTTANONE 
J033120G10TATTGGGCTTANONE 
J033144G06TATTGGGCTTANONE 
J043017L21TATTGGGCTTANONE 
J043024O10TATTGGGCTTANONE 
J053023K04TATTGGGCTTANONE 
J053035D01TATTGGGCTTANONE 
J053037P10TATTGGGCTTANONE 
J053042K15TATTGGGCTTANONE 
J053047C14TATTGGGCTTANONE 
J053054A06TATTGGGCTTANONE 
J053071H03TATTGGGCTTANONE 
J053073G08TATTGGGCTTANONE 
J053090D04TATTGGGCTTANONE 
J053095E17TATTGGGCTTANONE 
J090007O03TATTGGGCTTANONE 
J090024G24TATTGGGCTTANONE 
J090042M08TATTGGGCTTANONE 
J090045I16TATTGGGCTTANONE 
J090051E13TATTGGGCTTANONE 
J090073B15TATTGGGCTTANONE 
J090096F19TATTGGGCTTANONE 
J100030M23TATTGGGCTTANONE 
Os03g0861700AK066129CGATGGGCTTARhodanese-like domain containing protein. 
J013051M12CGATGGGCTTANONE 
J013104N13CGATGGGCTTANONE 
J065052E12CGATGGGCTTANONE 
Os03g0861800AF358762TAAGCCCATCGNONE 
AK068434TAAGCCCATCGCyclin-like F-box domain containing protein. 
AK109388TAAGCCCATCGNONE 
J013154L15TAAGCCCATCGNONE 
J013170I23TAAGCCCATCGNONE 
J023031D05TAAGCCCATCGNONE 
J023082E07TAAGCCCATCGNONE 
J023095M10TAAGCCCATCGNONE 
J023127D14TAAGCCCATCGNONE 
J023138M15TAAGCCCATCGNONE 
J023138M16TAAGCCCATCGNONE 
J033060B18TAAGCCCATCGNONE 
J033060F13TAAGCCCATCGNONE 
J033096J11TAAGCCCATCGNONE 
J033122C07TAAGCCCATCGNONE 
J053029A10TAAGCCCATCGNONE 
J053062O16TAAGCCCATCGNONE 
J053064J08TAAGCCCATCGNONE 
J053086F22TAAGCCCATCGNONE 
J065036C04TAAGCCCATCGNONE 
J065072J23TAAGCCCATCGNONE 
J065120D04TAAGCCCATCGNONE 
J065161D04TAAGCCCATCGNONE 
J065172H02TAAGCCCATCGNONE 
J065207B01TAAGCCCATCGNONE 
J075019H18TAAGCCCATCGNONE 
J075082E16TAAGCCCATCGNONE 
J075089A10TAAGCCCATCGNONE 
J075099G02TAAGCCCATCGNONE 
J075134M04TAAGCCCATCGNONE 
J075144K19TAAGCCCATCGNONE 
J075147F17TAAGCCCATCGNONE 
J090004O14TAAGCCCATCGNONE 
J090013A07TAAGCCCATCGNONE 
J090047K14TAAGCCCATCGNONE 
Os04g0337500AK061807GGTTGGGCTTANONE 
Os04g0343900AK107841TAAGCCCACCCConserved hypothetical protein. 
Os04g0381100AK121764TAAGCCCAATTBile acid:sodium symporter family protein. 
Os04g0440100AK101324TTGTGGGCTTANONE 
AK105415TTGTGGGCTTANonsense-mediated decay UPF3 domain containing protein. 
Os04g0451100AK106764CTGGGCTTAConserved hypothetical protein. 
Os04g0542900AK068610TCATGGGCTTAConserved hypothetical protein. 
Os04g0577500006-039-C03TACTGGGCCGATAAGCCCAGNONE 
006-043-H01TACTGGGCCGATAAGCCCAGNONE 
AK061538TACTGGGCCGATAAGCCCAGNONE 
AK065648TACTGGGCCGATAAGCCCAGTatD-related deoxyribonuclease family protein. 
AK104763TACTGGGCCGATAAGCCCAGNONE 
J013035E21TACTGGGCCGATAAGCCCAGNONE 
J013066M11TACTGGGCCGATAAGCCCAGNONE 
J100026B02TACTGGGCCGATAAGCCCAGNONE 
Os04g0602900AK065982TATGGGCTTANONE 
AK100414TATGGGCTTAIsoprenylcysteine carboxyl methyltransferase family protein. 
J013045J05TATGGGCTTANONE 
J065196I21TATGGGCTTANONE 
J065205B13TATGGGCTTANONE 
J090017J24TATGGGCTTANONE 
Os04g0609200AK103652TAAGCCCAAGMajor facilitator superfamily protein. 
Os04g0636400006-064-G07TAAGCCCAGCCNONE 
006-097-D05TAAGCCCAGCCNONE 
AK061848TAAGCCCAGCCSimilar to Senescence-associated protein 6. 
AK099573TAAGCCCAGCCNONE 
J013035J20TAAGCCCAGCCNONE 
Os04g0641300AK071780TAAGCCCAACTGlutaredoxin domain containing protein. 
J023114E02TAAGCCCAACTNONE 
Os05g0110700AK102486ATCTGGGCCTAAGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12ATCTGGGCCTAAGCCCAATANONE 
Os05g0111000AK073598CTTGGGCTTASimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0150300AK100732TAAGCCCATTSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0170800AK068085TAAGCCCAAACUvrB/UvrC protein domain containing protein. 
J100063G14TAAGCCCAAACNONE 
Os05g0194600AK102487TTTTGGGCTTAAGGGCCCAATTPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01TTTTGGGCTTAAGGGCCCAATTNONE 
J100041A08TTTTGGGCTTAAGGGCCCAATTNONE 
Os05g0227100009-045-C06TAAGCCCAATANONE 
009-109-A08TAAGCCCAATANONE 
J075072D22TAAGCCCAATAHypothetical protein. 
Os05g0227300Os05g0227300TAAGCCCAATANONE 
Os05g0255600AK073067ATATGGGCTTAThioredoxin domain 2 containing protein. 
J033022A04ATATGGGCTTANONE 
J033022B03ATATGGGCTTANONE 
J033116F22ATATGGGCTTANONE 
J065017H13ATATGGGCTTANONE 
J065038G20ATATGGGCTTANONE 
J065076J16ATATGGGCTTANONE 
J065135D06ATATGGGCTTANONE 
J065168P22ATATGGGCTTANONE 
J065188G21ATATGGGCTTANONE 
J065207C14ATATGGGCTTANONE 
J080014C23ATATGGGCTTANONE 
J080018G12ATATGGGCTTANONE 
J080021F03ATATGGGCTTANONE 
J100068C14ATATGGGCTTANONE 
Os05g0297900AK071238TAAGCCCAGTGACGTGSimilar to Signal peptidase 18 subunit (Fragment). 
J013159C03TAAGCCCAGTGACGTGNONE 
J023041J06TAAGCCCAGTGACGTGNONE 
J023085B09TAAGCCCAGTGACGTGNONE 
J033031J11TAAGCCCAGTGACGTGNONE 
J065010C22TAAGCCCAGTGACGTGNONE 
J065032E10TAAGCCCAGTGACGTGNONE 
J065141O18TAAGCCCAGTGACGTGNONE 
J065155K04TAAGCCCAGTGACGTGNONE 
Os05g0358500AK060575CTTGGGCTTANONE 
AK100777CTTGGGCTTAProtein phosphatase 2C-like domain containing protein. 
Os05g0447000AK108280TAAGCCCATACSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0506900AK106697TAAGCCCAAAABrix domain containing protein. 
Os05g0509200AK061566TAAGCCCATGANADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007TAAGCCCATGANONE 
AK100226TAAGCCCATGANONE 
J013114B12TAAGCCCATGANONE 
J023048D09TAAGCCCATGANONE 
Os05g0524200AK071990CTTGGGCTTADual specificity protein phosphatase domain containing protein. 
Os05g0539300Os05g0539300AGTTGGGCTTAProtein of unknown function DUF295 family protein. 
Os05g0558900AK101679TAAGCCCATCGSimilar to Frsb-prov protein. 
J013028M08TAAGCCCATCGNONE 
J013074E16TAAGCCCATCGNONE 
J013096L01TAAGCCCATCGNONE 
J023085M19TAAGCCCATCGNONE 
J033058I10TAAGCCCATCGNONE 
J033091D18TAAGCCCATCGNONE 
J033111H13TAAGCCCATCGNONE 
J033114C18TAAGCCCATCGNONE 
Os05g0571100006-092-E08TATTGGGCTTANONE 
006-120-A03TATTGGGCTTANONE 
015-030-F01TATTGGGCTTANONE 
AK068658TATTGGGCTTAProtein of unknown function DUF860, plant family protein. 
AK104438TATTGGGCTTANONE 
Os05g0593100AK061855AGGTGGGCTTANONE 
AK100119AGGTGGGCTTASimilar to Vacuolar ATP synthase subunit C (EC 3.6.3.14) (V-ATPase C subunit) (Vacuolar proton pump C subunit). 
AY224442AGGTGGGCTTANONE 
Os06g0106000006-086-D02TCATGGGCTTANONE 
AK059897TCATGGGCTTASeptum site-determining protein MinD family protein. 
AK105653TCATGGGCTTANONE 
J065059N03TCATGGGCTTANONE 
J065138F18TCATGGGCTTANONE 
J065158D02TCATGGGCTTANONE 
Os06g0119300AK067271CTGGGCTTAProtein of unknown function DUF594 family protein. 
Os06g0128400AK064390AATGGGCTGATAAGCCCATGGNONE 
AK121983AATGGGCTGATAAGCCCATGGWD40-like domain containing protein. 
Os06g0135340J065061D17TAAGCCCATGANONE 
J065159A10TAAGCCCATGAConserved hypothetical protein. 
Os06g0139700006-052-C07TAAGCCCATCCACCNONE 
009-009-A08TAAGCCCATCCACCNONE 
015-020-D09TAAGCCCATCCACCNONE 
015-087-H06TAAGCCCATCCACCNONE 
016-078-A03TAAGCCCATCCACCNONE 
AK067884TAAGCCCATCCACCNONE 
AK103245TAAGCCCATCCACCConserved hypothetical protein. 
AK106116TAAGCCCATCCACCNONE 
AK106220TAAGCCCATCCACCNONE 
Os06g0159600AK068486TAAGCCCAGCU box domain containing protein. 
AK108446TAAGCCCAGCNONE 
J065084J15TAAGCCCAGCNONE 
Os06g0187900009-171-C09TAAGCCCACNONE 
AK063879TAAGCCCACNONE 
AK071765TAAGCCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11TAAGCCCACNONE 
J033098E13TAAGCCCACNONE 
J100036J11TAAGCCCACNONE 
J100047B19TAAGCCCACNONE 
Os06g0202900AK109607TAAGCCCATCGProtein kinase-like domain containing protein. 
Os06g0603400AK060002TAAGCCCACANONE 
AK060002TAAGCCCACANONE 
AK102325TAAGCCCACANONE 
AK102325TAAGCCCACANONE 
AK106905TAAGCCCACASimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
AK106905TAAGCCCACASimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
J090039I22TAAGCCCACANONE 
J090039I22TAAGCCCACANONE 
J100022N15TAAGCCCACANONE 
J100022N15TAAGCCCACANONE 
J100023E09TAAGCCCACANONE 
J100023E09TAAGCCCACANONE 
J100052D21TAAGCCCACANONE 
J100052D21TAAGCCCACANONE 
Os06g0608500AK060097TAAGCCCATTNONE 
AK070667TAAGCCCATTSnf7 family protein. 
Os06g0710300AK121344TAAGCCCAACAUncharacterized protein UPF0114 family protein. 
J043016B12TAAGCCCAACANONE 
J065104H21TAAGCCCAACANONE 
Os07g0242600AK065752AGCCCATTTAAGCCCACACyclin-like F-box domain containing protein. 
J013037K22AGCCCATTTAAGCCCACANONE 
Os07g0558000AK069272ACATGGGCTTANONE 
AK101867ACATGGGCTTAABC-1 domain containing protein. 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
009-083-H02TAATGGGCCTTATTGGGCTTANONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
AK062660TAATGGGCCTTATTGGGCTTAConserved hypothetical protein. 
Os07g0569000AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
AK073915TAAGCCCAATAAGGCCCATTAConserved hypothetical protein. 
Os07g0618500AK068210GGTGTGTGGGCTTAGGGCCGTGNONE 
AK068975GGTGTGTGGGCTTAGGGCCGTGSimilar to Dihydropterin pyrophosphokinase /dihydropteroate synthase precursor (EC 2.5.1.15). 
J013147H17GGTGTGTGGGCTTAGGGCCGTGNONE 
J013170L10GGTGTGTGGGCTTAGGGCCGTGNONE 
J023061I07GGTGTGTGGGCTTAGGGCCGTGNONE 
J043024N01GGTGTGTGGGCTTAGGGCCGTGNONE 
Os07g0638500AK108983TACTGGGCTTASimilar to Dirigent-like protein (Fragment). 
J100035F20TACTGGGCTTANONE 
Os07g0644300AK066726TAAGCCCAATTSimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483TAAGCCCAATTNONE 
Os07g0645400009-125-B12CTGGGCTTANONE 
015-038-A09CTGGGCTTANONE 
AK119179CTGGGCTTANONE 
Os07g0687300AK073043AAATGGGCTTAGGCCCATTSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0113800J033069I12TAAGCCCAATTNONE 
J053050I07TAAGCCCAATTNONE 
J065006J11TAAGCCCAATTNONE 
J065013D02TAAGCCCAATTNONE 
J065055L24TAAGCCCAATTNONE 
J065071I11TAAGCCCAATTConserved hypothetical protein. 
J065093G12TAAGCCCAATTNONE 
J065101N03TAAGCCCAATTNONE 
Os08g0139100006-027-E12TAAGCCCATCTNONE 
006-089-E06TAAGCCCATCTNONE 
006-113-G02TAAGCCCATCTNONE 
AK061429TAAGCCCATCTNONE 
AK099590TAAGCCCATCTSimilar to DAG protein, chloroplast precursor. 
AK104727TAAGCCCATCTNONE 
J013043H11TAAGCCCATCTNONE 
J013049N13TAAGCCCATCTNONE 
J065079F01TAAGCCCATCTNONE 
J065122N24TAAGCCCATCTNONE 
J065142J24TAAGCCCATCTNONE 
J065193N03TAAGCCCATCTNONE 
J075041I21TAAGCCCATCTNONE 
J075145E04TAAGCCCATCTNONE 
Os08g0176800AK111670GTTTGGGCTTASimilar to mRNA-associated protein mrnp 41 (Rae1 protein homolog). 
J013030D15GTTTGGGCTTANONE 
J013157K01GTTTGGGCTTANONE 
J023108A20GTTTGGGCTTANONE 
J033125F09GTTTGGGCTTANONE 
Os08g0243900011-052-H03TAAGCCCAATNONE 
AK102707TAAGCCCAATNONE 
AK121452TAAGCCCAATMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20TAAGCCCAATNONE 
J065168E04TAAGCCCAATNONE 
Os08g0261000AK100590TAAGCCCAGDisease resistance protein family protein. 
Os08g0278100014-004-D02TAAGCCCAAGNONE 
014-004-D02TAAGCCCATCANONE 
AK063626TAAGCCCAAGConserved hypothetical protein. 
AK063626TAAGCCCATCAConserved hypothetical protein. 
Os08g0386300AK059323TAAGCCCATTGGGCTGANONE 
AK070379TAAGCCCATTGGGCTGACytochrome b5 domain containing protein. 
J023054P20TAAGCCCATTGGGCTGANONE 
J033089H01TAAGCCCATTGGGCTGANONE 
J065013I01TAAGCCCATTGGGCTGANONE 
J065212E17TAAGCCCATTGGGCTGANONE 
J080317O15TAAGCCCATTGGGCTGANONE 
J090018O07TAAGCCCATTGGGCTGANONE 
Os08g0416000AF145729TAAGCCCACGCHomeodomain leucine zipper protein. 
AK100634TAAGCCCACGCNONE 
AK101569TAAGCCCACGCNONE 
AK110561TAAGCCCACGCNONE 
J013074A01TAAGCCCACGCNONE 
J013159K22TAAGCCCACGCNONE 
J023028M01TAAGCCCACGCNONE 
J023033C15TAAGCCCACGCNONE 
J023107N23TAAGCCCACGCNONE 
J023110A12TAAGCCCACGCNONE 
J023122D02TAAGCCCACGCNONE 
J033050G15TAAGCCCACGCNONE 
J033107D17TAAGCCCACGCNONE 
J065082J21TAAGCCCACGCNONE 
J065165L21TAAGCCCACGCNONE 
J065171J17TAAGCCCACGCNONE 
J100026K13TAAGCCCACGCNONE 
J100039E16TAAGCCCACGCNONE 
J100056J11TAAGCCCACGCNONE 
J100070I19TAAGCCCACGCNONE 
J100073B16TAAGCCCACGCNONE 
J100081M19TAAGCCCACGCNONE 
J100088E09TAAGCCCACGCNONE 
Os08g0423400AK072922TTTGGGCTTAConserved hypothetical protein. 
J023146P06TTTGGGCTTANONE 
Os08g0447200AK067377TAAGCCCAAATSGT1 family protein. 
J013106M17TAAGCCCAAATNONE 
J033133D18TAAGCCCAAATNONE 
J033140B09TAAGCCCAAATNONE 
J100028I17TAAGCCCAAATNONE 
J100086C22TAAGCCCAAATNONE 
Os08g0471900015-099-E10TAAGCCCAGCCCATTTNONE 
AK069434TAAGCCCAGCCCATTTZinc finger, ZPR1-type domain containing protein. 
Os08g0480400J065154C22TAAGCCCACGGNONE 
J065214F15TAAGCCCACGGProtein of unknown function DUF1637 family protein. 
Os08g0485600AK064883TAAGCCCAGNONE 
AK068243TAAGCCCAGMethyl-CpG binding domain containing protein. 
Os08g0521400006-047-C11TAAGCCCATGGNONE 
016-014-E07TAAGCCCATGGNONE 
AK070148TAAGCCCATGGNONE 
AK101704TAAGCCCATGGZinc finger, RanBP2-type domain containing protein. 
AK105045TAAGCCCATGGNONE 
J013108K14TAAGCCCATGGNONE 
J013129E16TAAGCCCATGGNONE 
J013159M23TAAGCCCATGGNONE 
J023041G22TAAGCCCATGGNONE 
J033060G13TAAGCCCATGGNONE 
J033060J15TAAGCCCATGGNONE 
J065120J24TAAGCCCATGGNONE 
J065160I01TAAGCCCATGGNONE 
J065179A16TAAGCCCATGGNONE 
J065189K04TAAGCCCATGGNONE 
J090032O15TAAGCCCATGGNONE 
J090045A18TAAGCCCATGGNONE 
J090060B21TAAGCCCATGGNONE 
J090086F23TAAGCCCATGGNONE 
J090098O22TAAGCCCATGGNONE 
J100018K20TAAGCCCATGGNONE 
J100048P22TAAGCCCATGGNONE 
J100052I06TAAGCCCATGGNONE 
Os08g0527400AK119389TAAGCCCAGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0558200AK069761TAAGCCCAAGGlutathione S-transferase, N-terminal domain containing protein. 
J013041N12TAAGCCCAAGNONE 
J013093H08TAAGCCCAAGNONE 
J023020B17TAAGCCCAAGNONE 
J023028D17TAAGCCCAAGNONE 
J023039B10TAAGCCCAAGNONE 
J065045O11TAAGCCCAAGNONE 
J065206N10TAAGCCCAAGNONE 
J075032G11TAAGCCCAAGNONE 
J075037C22TAAGCCCAAGNONE 
J075074J23TAAGCCCAAGNONE 
J090023A08TAAGCCCAAGNONE 
J090028N16TAAGCCCAAGNONE 
J100081G01TAAGCCCAAGNONE 
Os08g0563300009-007-B01TAAGCCCAAGNONE 
AK062315TAAGCCCAAGSimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
J065095F04TAAGCCCAAGNONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0115900009-055-E06TAAGCCCAAATNONE 
AK068597TAAGCCCAAATConserved hypothetical protein. 
J065136F11TAAGCCCAAATNONE 
J080023D14TAAGCCCAAATNONE 
Os09g0392400AK106799TAAGCCCATTTNONE 
Os09g0397900AK101306ATATGGGCTTASimilar to FEG protein. 
AK101306ATATGGGCTTASimilar to FEG protein. 
Os09g0516800009-017-A01TAAGCCCAGCCCAACCConserved hypothetical protein. 
Os09g0554000J065123C23TTATGGGCTTATGGCCCATCASimilar to Mitochondrial phosphate transporter. 
Os09g0571400AK103109AGCCCATTAAGCCCATTCyclophilin 1. 
J023011A12AGCCCATTAAGCCCATTNONE 
J033119A20AGCCCATTAAGCCCATTNONE 
J053034N16AGCCCATTAAGCCCATTNONE 
J053045N23AGCCCATTAAGCCCATTNONE 
J053052J12AGCCCATTAAGCCCATTNONE 
J053052K04AGCCCATTAAGCCCATTNONE 
J053099M15AGCCCATTAAGCCCATTNONE 
J065071H23AGCCCATTAAGCCCATTNONE 
J065131B16AGCCCATTAAGCCCATTNONE 
J075003F19AGCCCATTAAGCCCATTNONE 
J075116F02AGCCCATTAAGCCCATTNONE 
J075126G05AGCCCATTAAGCCCATTNONE 
J075145E09AGCCCATTAAGCCCATTNONE 
J075149O22AGCCCATTAAGCCCATTNONE 
J075163A09AGCCCATTAAGCCCATTNONE 
J075194A09AGCCCATTAAGCCCATTNONE 
L29471AGCCCATTAAGCCCATTNONE 
Os11g0227600AK101375TAATGGGCTTAGCGTGGGCCGGAConserved hypothetical protein. 
AK102193TAATGGGCTTAGCGTGGGCCGGANONE 
J033087C03TAATGGGCTTAGCGTGGGCCGGANONE 
Os11g0297900AK067692CAGGTGGGCTTASimilar to Txnl4b protein. 
J013118F01CAGGTGGGCTTANONE 
J023066E22CAGGTGGGCTTANONE 
J023066E24CAGGTGGGCTTANONE 
Os11g0575600AK073570TAAGCCCACAASimilar to Lipoxygenase (Fragment). 
Os11g0593100AK070035TAAGCCCAGTAProtein of unknown function DUF295 family protein. 
J023038E14TAAGCCCAGTANONE 
J100062C21TAAGCCCAGTANONE 
Os11g0617800009-105-D10ATTGGGCTTANONE 
AK062778ATTGGGCTTAConserved hypothetical protein. 
Os12g0146300J065162K17TAAGCCCATCAHypothetical protein. 
Os12g0182200AK099737ATTGGGCTTASimilar to Dihydrolipoamide S-acetyltransferase. 
Os12g0564800AK103886ATATGGGCTTADisease resistance protein family protein. 
Os12g0592200Os12g0592200TAAGCCCATCGConserved hypothetical protein. 
Os12g0599900AK101252TAAGCCCATTTTetratricopeptide region domain containing protein. 
J033032F05TAAGCCCATTTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.