version

Summary of OsREG656 (All List)

OrganismOryza sativa  
IDOsREG656  
SequenceTAGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2656  

Entry Sequences (2656 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087TAGGCCCACAGAAGCCCATAANONE 
AK103808TAGGCCCACAGAAGCCCATAAC-type lectin domain containing protein. 
Os01g0104100AK072797TTATGGGCTTCTGTGGGCCTAZinc finger, RING-type domain containing protein. 
AK104280TTATGGGCTTCTGTGGGCCTANONE 
Os01g0132800AK068422AGTGGGCCTAPeptidyl-tRNA hydrolase family protein. 
Os01g0134500AK111908TAGGCCCATASimilar to Delta-7-sterol-C5(6)-desaturase (EC 1.3.3.-) (Delta-7-C-5 sterol desaturase) (Delta7-sterol-C5-desaturase). 
AK112014TAGGCCCATANONE 
Os01g0166800AK073783GGACGGCCCATTAGGCCCAATAConserved hypothetical protein. 
AK099378GGACGGCCCATTAGGCCCAATANONE 
J033026H10GGACGGCCCATTAGGCCCAATANONE 
J033067O18GGACGGCCCATTAGGCCCAATANONE 
J033108A17GGACGGCCCATTAGGCCCAATANONE 
J065015J11GGACGGCCCATTAGGCCCAATANONE 
J065204P09GGACGGCCCATTAGGCCCAATANONE 
Os01g0191100009-011-A02TAGGCCCACACGNONE 
009-028-D05TAGGCCCACACGNONE 
009-058-B11TAGGCCCACACGNONE 
009-151-D09TAGGCCCACACGNONE 
013-026-G03TAGGCCCACACGNONE 
013-063-F04TAGGCCCACACGNONE 
013-069-B05TAGGCCCACACGNONE 
014-029-E04TAGGCCCACACGNONE 
014-072-H04TAGGCCCACACGNONE 
014-089-E09TAGGCCCACACGNONE 
015-047-G05TAGGCCCACACGNONE 
016-033-G06TAGGCCCACACGNONE 
AK058815TAGGCCCACACGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08TAGGCCCACACGNONE 
J023077K21TAGGCCCACACGNONE 
J023081F19TAGGCCCACACGNONE 
J033052N11TAGGCCCACACGNONE 
J033058N11TAGGCCCACACGNONE 
J033114G05TAGGCCCACACGNONE 
J033114O17TAGGCCCACACGNONE 
J033129L14TAGGCCCACACGNONE 
J053029I12TAGGCCCACACGNONE 
J065067N19TAGGCCCACACGNONE 
J065084I19TAGGCCCACACGNONE 
J065099O03TAGGCCCACACGNONE 
J065201I08TAGGCCCACACGNONE 
J075035B08TAGGCCCACACGNONE 
J075037B22TAGGCCCACACGNONE 
J075054L16TAGGCCCACACGNONE 
J075059D15TAGGCCCACACGNONE 
J075164I08TAGGCCCACACGNONE 
J075185J01TAGGCCCACACGNONE 
J090042O06TAGGCCCACACGNONE 
J090044F12TAGGCCCACACGNONE 
J090063L02TAGGCCCACACGNONE 
J090073I10TAGGCCCACACGNONE 
J090078E18TAGGCCCACACGNONE 
J100072K16TAGGCCCACACGNONE 
Os01g0203300015-045-F03TAGGCCCATCCANONE 
AK106329TAGGCCCATCCAConserved hypothetical protein. 
Os01g0209000AK103701CAAGTGGGCCTAAlg9-like mannosyltransferase family protein. 
J065104C04CAAGTGGGCCTANONE 
J090083C01CAAGTGGGCCTANONE 
Os01g0231700012-002-F11GCCGGCCCAAGTAGGCCCAGCNONE 
013-082-F05GCCGGCCCAAGTAGGCCCAGCNONE 
AK107453GCCGGCCCAAGTAGGCCCAGCSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22GCCGGCCCAAGTAGGCCCAGCNONE 
J065023E21GCCGGCCCAAGTAGGCCCAGCNONE 
J065036H21GCCGGCCCAAGTAGGCCCAGCNONE 
J065037M24GCCGGCCCAAGTAGGCCCAGCNONE 
J065049L04GCCGGCCCAAGTAGGCCCAGCNONE 
J065072F17GCCGGCCCAAGTAGGCCCAGCNONE 
J065085H10GCCGGCCCAAGTAGGCCCAGCNONE 
J065109N19GCCGGCCCAAGTAGGCCCAGCNONE 
J065117M19GCCGGCCCAAGTAGGCCCAGCNONE 
J065144C15GCCGGCCCAAGTAGGCCCAGCNONE 
J065159G24GCCGGCCCAAGTAGGCCCAGCNONE 
J065164N14GCCGGCCCAAGTAGGCCCAGCNONE 
J075025K16GCCGGCCCAAGTAGGCCCAGCNONE 
J075057L05GCCGGCCCAAGTAGGCCCAGCNONE 
J075070I16GCCGGCCCAAGTAGGCCCAGCNONE 
J075089D10GCCGGCCCAAGTAGGCCCAGCNONE 
J075138F10GCCGGCCCAAGTAGGCCCAGCNONE 
J090018C11GCCGGCCCAAGTAGGCCCAGCNONE 
J100018L19GCCGGCCCAAGTAGGCCCAGCNONE 
J100024B14GCCGGCCCAAGTAGGCCCAGCNONE 
J100048L02GCCGGCCCAAGTAGGCCCAGCNONE 
J100055A22GCCGGCCCAAGTAGGCCCAGCNONE 
J100069K01GCCGGCCCAAGTAGGCCCAGCNONE 
Os01g0233500AB024986TAGGCCCAAAANONE 
AK063476TAGGCCCAAAACyclin. 
Os01g0283000AK073165TAGGCCCATCTConserved hypothetical protein. 
J033023G08TAGGCCCATCTNONE 
Os01g0283100004-018-B01AGATGGGCCTANONE 
AK060908AGATGGGCCTANONE 
AK071713AGATGGGCCTASimilar to Ferripyochelin-binding protein-like. 
AK104205AGATGGGCCTANONE 
AK122051AGATGGGCCTANONE 
J023109L19AGATGGGCCTANONE 
Os01g0303100009-049-H10TTTTGGGCCTANONE 
AK062603TTTTGGGCCTASimilar to Chitinase precursor (EC 3.2.1.17). 
Os01g0314300AK073419TAGGCCCATCTUncharacterized domain 2 containing protein. 
AK104939TAGGCCCATCTNONE 
J033044B03TAGGCCCATCTNONE 
J033060E12TAGGCCCATCTNONE 
J043037E21TAGGCCCATCTNONE 
J065019O18TAGGCCCATCTNONE 
J065025P22TAGGCCCATCTNONE 
J065042P06TAGGCCCATCTNONE 
J065074C19TAGGCCCATCTNONE 
J065074E13TAGGCCCATCTNONE 
J065094E05TAGGCCCATCTNONE 
J065108N08TAGGCCCATCTNONE 
J065134L13TAGGCCCATCTNONE 
J065152N24TAGGCCCATCTNONE 
J065162N24TAGGCCCATCTNONE 
J065170P16TAGGCCCATCTNONE 
J065177M20TAGGCCCATCTNONE 
J065187N01TAGGCCCATCTNONE 
J075012N12TAGGCCCATCTNONE 
J075046C17TAGGCCCATCTNONE 
J075055N06TAGGCCCATCTNONE 
J075141H03TAGGCCCATCTNONE 
J075150M11TAGGCCCATCTNONE 
J090005B16TAGGCCCATCTNONE 
J090079L11TAGGCCCATCTNONE 
J100039F16TAGGCCCATCTNONE 
Os01g0331900013-026-D04ATATGGGCCTANONE 
AK064784ATATGGGCCTANONE 
AK121761ATATGGGCCTAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15ATATGGGCCTANONE 
J033090D07ATATGGGCCTANONE 
J090006L21ATATGGGCCTANONE 
Os01g0533900AK101194TAGGCCCAAAASimilar to Multidrug resistance protein 1 homolog. 
Os01g0571200014-074-A10ATTTGGGCCTANONE 
014-074-A10TAGGCCCATTTNONE 
AK121299ATTTGGGCCTASimilar to Ribosomal protein L34. 
AK121299TAGGCCCATTTSimilar to Ribosomal protein L34. 
J023110L12ATTTGGGCCTANONE 
J023110L12TAGGCCCATTTNONE 
Os01g0585400AK103584AGGGCCCATAGGCCCAGAConserved hypothetical protein. 
J033133B01AGGGCCCATAGGCCCAGANONE 
Os01g0661400AK073113TAGGCCCATCTNucleic acid-binding, OB-fold domain containing protein. 
J023014C20TAGGCCCATCTNONE 
J033022G03TAGGCCCATCTNONE 
J065050H15TAGGCCCATCTNONE 
J065059J19TAGGCCCATCTNONE 
J065085I24TAGGCCCATCTNONE 
J065166G12TAGGCCCATCTNONE 
J065182C18TAGGCCCATCTNONE 
Os01g0679600009-061-F03AAAGCCCAATAGGCCCAATANONE 
014-055-H04AAAGCCCAATAGGCCCAATANONE 
AK062530AAAGCCCAATAGGCCCAATAConserved hypothetical protein. 
J065015E10AAAGCCCAATAGGCCCAATANONE 
J065061F21AAAGCCCAATAGGCCCAATANONE 
J065128F13AAAGCCCAATAGGCCCAATANONE 
J065189E14AAAGCCCAATAGGCCCAATANONE 
J075006F04AAAGCCCAATAGGCCCAATANONE 
J075017A20AAAGCCCAATAGGCCCAATANONE 
J075075H02AAAGCCCAATAGGCCCAATANONE 
J075104C06AAAGCCCAATAGGCCCAATANONE 
J075154F23AAAGCCCAATAGGCCCAATANONE 
J075168N01AAAGCCCAATAGGCCCAATANONE 
J075189L15AAAGCCCAATAGGCCCAATANONE 
J075192J18AAAGCCCAATAGGCCCAATANONE 
J100062M10AAAGCCCAATAGGCCCAATANONE 
J100064C23AAAGCCCAATAGGCCCAATANONE 
J100080M16AAAGCCCAATAGGCCCAATANONE 
Os01g0686800006-098-B12TAGGCCCATACNONE 
006-113-H04TAGGCCCATACNONE 
AK060428TAGGCCCATACNONE 
AK098877TAGGCCCATACNONE 
AK098893TAGGCCCATACNONE 
AK121587TAGGCCCATACGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231TAGGCCCATACNONE 
J013001E12TAGGCCCATACNONE 
J013001N15TAGGCCCATACNONE 
J013098G22TAGGCCCATACNONE 
J023004P15TAGGCCCATACNONE 
J023014D09TAGGCCCATACNONE 
J023020G09TAGGCCCATACNONE 
J023034A19TAGGCCCATACNONE 
J023050I11TAGGCCCATACNONE 
J023079D13TAGGCCCATACNONE 
J023091B11TAGGCCCATACNONE 
J023099M03TAGGCCCATACNONE 
J023101H20TAGGCCCATACNONE 
J023106P14TAGGCCCATACNONE 
J023111F19TAGGCCCATACNONE 
J023132C22TAGGCCCATACNONE 
J023139O03TAGGCCCATACNONE 
J023146O10TAGGCCCATACNONE 
J033022G16TAGGCCCATACNONE 
J033030C10TAGGCCCATACNONE 
J033032G18TAGGCCCATACNONE 
J033034N09TAGGCCCATACNONE 
J033037K24TAGGCCCATACNONE 
J033038B22TAGGCCCATACNONE 
J033061E06TAGGCCCATACNONE 
J033065F08TAGGCCCATACNONE 
J033065I24TAGGCCCATACNONE 
J033069L01TAGGCCCATACNONE 
J033086N21TAGGCCCATACNONE 
J033102I06TAGGCCCATACNONE 
J033111N07TAGGCCCATACNONE 
J033118K11TAGGCCCATACNONE 
J033125D08TAGGCCCATACNONE 
J033129P22TAGGCCCATACNONE 
J033131L12TAGGCCCATACNONE 
J033139D08TAGGCCCATACNONE 
J033141J08TAGGCCCATACNONE 
J043024B14TAGGCCCATACNONE 
J053048G19TAGGCCCATACNONE 
J065023B15TAGGCCCATACNONE 
J065082C15TAGGCCCATACNONE 
J065087D24TAGGCCCATACNONE 
J065122D11TAGGCCCATACNONE 
J065128P13TAGGCCCATACNONE 
J065149I19TAGGCCCATACNONE 
J065154E16TAGGCCCATACNONE 
J065156K21TAGGCCCATACNONE 
J065166H09TAGGCCCATACNONE 
J065169F24TAGGCCCATACNONE 
J065194I16TAGGCCCATACNONE 
J065213M20TAGGCCCATACNONE 
J075020F19TAGGCCCATACNONE 
J075051J16TAGGCCCATACNONE 
J075093C18TAGGCCCATACNONE 
J075119H02TAGGCCCATACNONE 
J075120J11TAGGCCCATACNONE 
J075173A15TAGGCCCATACNONE 
J080302B05TAGGCCCATACNONE 
J080304G10TAGGCCCATACNONE 
J080305E13TAGGCCCATACNONE 
J080315L11TAGGCCCATACNONE 
J090005H15TAGGCCCATACNONE 
J090021C24TAGGCCCATACNONE 
J090025H24TAGGCCCATACNONE 
J090025M11TAGGCCCATACNONE 
J090026C22TAGGCCCATACNONE 
J090027H15TAGGCCCATACNONE 
J090034B17TAGGCCCATACNONE 
J090045G11TAGGCCCATACNONE 
J090048H02TAGGCCCATACNONE 
J090051N04TAGGCCCATACNONE 
J090052I06TAGGCCCATACNONE 
J090054L17TAGGCCCATACNONE 
J090060M22TAGGCCCATACNONE 
J090075N17TAGGCCCATACNONE 
J090079K13TAGGCCCATACNONE 
J090086H08TAGGCCCATACNONE 
J090094N20TAGGCCCATACNONE 
J100021F03TAGGCCCATACNONE 
J100031M01TAGGCCCATACNONE 
J100033I18TAGGCCCATACNONE 
J100034P07TAGGCCCATACNONE 
J100043M16TAGGCCCATACNONE 
J100046J12TAGGCCCATACNONE 
J100055F09TAGGCCCATACNONE 
J100057D19TAGGCCCATACNONE 
J100060O10TAGGCCCATACNONE 
J100064G09TAGGCCCATACNONE 
J100077F24TAGGCCCATACNONE 
J100080E12TAGGCCCATACNONE 
J100089J04TAGGCCCATACNONE 
Os01g0700200AK100961TAGGCCCAAGCCCATCCASimilar to Chromosome condensation regulator protein (Fragment). 
J023141C11TAGGCCCAAGCCCATCCANONE 
Os01g0710000AK111794AAATGGGCCTASimilar to WD-repeat protein RBAP1. 
J023006D22AAATGGGCCTANONE 
J065106P04AAATGGGCCTANONE 
J100036G13AAATGGGCCTANONE 
Os01g0710800013-097-E05TTTTGGGCCTTAGGCCCATATNONE 
AK069973TTTTGGGCCTTAGGCCCATATNONE 
AK071099TTTTGGGCCTTAGGCCCATATConserved hypothetical protein. 
J023081K01TTTTGGGCCTTAGGCCCATATNONE 
J023123E16TTTTGGGCCTTAGGCCCATATNONE 
J033066B11TTTTGGGCCTTAGGCCCATATNONE 
J065144G11TTTTGGGCCTTAGGCCCATATNONE 
Os01g0719250AK105184TAGGCCCATTGGGCTConserved hypothetical protein. 
Os01g0720500003-129-C07TAGGCCCATCCNONE 
004-015-C03TAGGCCCATCCNONE 
004-016-C06TAGGCCCATCCNONE 
006-022-A02TAGGCCCATCCNONE 
006-022-C04TAGGCCCATCCNONE 
006-022-C05TAGGCCCATCCNONE 
006-026-H07TAGGCCCATCCNONE 
006-028-A10TAGGCCCATCCNONE 
006-028-B01TAGGCCCATCCNONE 
006-030-F02TAGGCCCATCCNONE 
006-031-H01TAGGCCCATCCNONE 
006-046-G10TAGGCCCATCCNONE 
006-049-C03TAGGCCCATCCNONE 
006-050-C08TAGGCCCATCCNONE 
006-051-B12TAGGCCCATCCNONE 
006-051-F11TAGGCCCATCCNONE 
006-053-E07TAGGCCCATCCNONE 
006-055-H07TAGGCCCATCCNONE 
006-056-A12TAGGCCCATCCNONE 
006-060-C01TAGGCCCATCCNONE 
006-060-D10TAGGCCCATCCNONE 
006-063-B05TAGGCCCATCCNONE 
006-063-B09TAGGCCCATCCNONE 
006-071-H09TAGGCCCATCCNONE 
006-081-A08TAGGCCCATCCNONE 
006-082-G12TAGGCCCATCCNONE 
006-084-C09TAGGCCCATCCNONE 
006-085-A04TAGGCCCATCCNONE 
006-086-A02TAGGCCCATCCNONE 
006-086-G11TAGGCCCATCCNONE 
006-087-E07TAGGCCCATCCNONE 
006-090-H01TAGGCCCATCCNONE 
006-092-G11TAGGCCCATCCNONE 
006-093-E01TAGGCCCATCCNONE 
006-095-F02TAGGCCCATCCNONE 
006-097-C08TAGGCCCATCCNONE 
006-098-A01TAGGCCCATCCNONE 
006-100-A10TAGGCCCATCCNONE 
006-109-C10TAGGCCCATCCNONE 
006-112-A11TAGGCCCATCCNONE 
006-112-F09TAGGCCCATCCNONE 
006-113-B08TAGGCCCATCCNONE 
006-113-F01TAGGCCCATCCNONE 
006-115-B01TAGGCCCATCCNONE 
006-116-B11TAGGCCCATCCNONE 
006-118-B05TAGGCCCATCCNONE 
006-118-E04TAGGCCCATCCNONE 
006-119-G08TAGGCCCATCCNONE 
006-120-F04TAGGCCCATCCNONE 
009-078-E06TAGGCCCATCCNONE 
009-097-A11TAGGCCCATCCNONE 
009-115-F02TAGGCCCATCCNONE 
009-135-H12TAGGCCCATCCNONE 
009-145-C06TAGGCCCATCCNONE 
009-187-B03TAGGCCCATCCNONE 
009-197-C08TAGGCCCATCCNONE 
AK058289TAGGCCCATCCNONE 
AK062725TAGGCCCATCCSimilar to Type I chlorophyll a/b-binding protein b (Fragment). 
AK103946TAGGCCCATCCNONE 
AK104176TAGGCCCATCCNONE 
J023055C17TAGGCCCATCCNONE 
J033101K18TAGGCCCATCCNONE 
J075041N01TAGGCCCATCCNONE 
U74295TAGGCCCATCCNONE 
Os01g0737900012-087-D12ATTTGGGCCTANONE 
AK072600ATTTGGGCCTAProtein prenyltransferase domain containing protein. 
J023006E12ATTTGGGCCTANONE 
J023130A18ATTTGGGCCTANONE 
J023134O05ATTTGGGCCTANONE 
Os01g0748100AK071261GTGGCCCAAGCTGGGCCTAHypothetical protein. 
J023084C08GTGGCCCAAGCTGGGCCTANONE 
J065058A07GTGGCCCAAGCTGGGCCTANONE 
Os01g0750900AK111087ACGTGGGCCTAConserved hypothetical protein. 
J100042H18ACGTGGGCCTANONE 
J100044L13ACGTGGGCCTANONE 
Os01g0773200015-072-C12CCAGGCCCAAATAGGCCCAGTNONE 
Os01g0773600AK067004TCATGGGCCTAGlycoside hydrolase, family 47 protein. 
J013091F09TCATGGGCCTANONE 
J013134K14TCATGGGCCTANONE 
J013158J15TCATGGGCCTANONE 
J033060O20TCATGGGCCTANONE 
J033074C16TCATGGGCCTANONE 
J075086F05TCATGGGCCTANONE 
J075150H08TCATGGGCCTANONE 
J090006E02TCATGGGCCTANONE 
J090074E02TCATGGGCCTANONE 
J100030M05TCATGGGCCTANONE 
J100036M16TCATGGGCCTANONE 
J100063H18TCATGGGCCTANONE 
Os01g0784600AK067527ACATGGGCTAATGGGCCTAConserved hypothetical protein. 
Os01g0805000009-045-H11AGTGGGCCTANONE 
009-045-H11TAATGGGCCTANONE 
009-196-H08AGTGGGCCTANONE 
009-196-H08TAATGGGCCTANONE 
J013094D22AGTGGGCCTARibosomal protein L34 family protein. 
J013094D22TAATGGGCCTARibosomal protein L34 family protein. 
J013119F23AGTGGGCCTANONE 
J013119F23TAATGGGCCTANONE 
J065128B11AGTGGGCCTANONE 
J065128B11TAATGGGCCTANONE 
Os01g0829266J065010C18AATGGGCCTANONE 
J065037A22AATGGGCCTANONE 
J065044B02AATGGGCCTAConserved hypothetical protein. 
J065044B10AATGGGCCTANONE 
J065051A06AATGGGCCTANONE 
J065073E06AATGGGCCTANONE 
J065074I11AATGGGCCTANONE 
J065086D22AATGGGCCTANONE 
J065104H10AATGGGCCTANONE 
J065107C05AATGGGCCTANONE 
J065124H16AATGGGCCTANONE 
J065165F22AATGGGCCTANONE 
J065169B11AATGGGCCTANONE 
J065172G21AATGGGCCTANONE 
J065191E05AATGGGCCTANONE 
J065191F18AATGGGCCTANONE 
Os01g0851000AK065338TGTTGGGCCTAPfkB domain containing protein. 
Os01g0861000AK058707TAGGCCCACTConserved hypothetical protein. 
Os01g0872700AK066633TTGGGCCTANONE 
AK100381TTGGGCCTAPutative 5-3 exonuclease domain containing protein. 
J013028K13TTGGGCCTANONE 
J013038C19TTGGGCCTANONE 
J023024P16TTGGGCCTANONE 
J023074N21TTGGGCCTANONE 
J023085E21TTGGGCCTANONE 
J033034K14TTGGGCCTANONE 
J033044N04TTGGGCCTANONE 
J033052O10TTGGGCCTANONE 
J033087J09TTGGGCCTANONE 
J033129L17TTGGGCCTANONE 
J033143O07TTGGGCCTANONE 
J065014M22TTGGGCCTANONE 
J065025H10TTGGGCCTANONE 
J065051H21TTGGGCCTANONE 
J065123E05TTGGGCCTANONE 
J065181P03TTGGGCCTANONE 
J100064B21TTGGGCCTANONE 
Os01g0895100AK058611ATATGGGCCTASimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698ATATGGGCCTANONE 
AK099166ATATGGGCCTANONE 
J023065I03ATATGGGCCTANONE 
J023081J06ATATGGGCCTANONE 
J023126H17ATATGGGCCTANONE 
J023126O09ATATGGGCCTANONE 
J033035I06ATATGGGCCTANONE 
J090065C10ATATGGGCCTANONE 
J090095O16ATATGGGCCTANONE 
Os01g0907300015-031-F03TGTTGGGCCTANONE 
AK103626TGTTGGGCCTAConserved hypothetical protein. 
AK108617TGTTGGGCCTANONE 
J013094D23TGTTGGGCCTANONE 
J013106G24TGTTGGGCCTANONE 
J013120M13TGTTGGGCCTANONE 
J023056M16TGTTGGGCCTANONE 
J023092M24TGTTGGGCCTANONE 
J033133N22TGTTGGGCCTANONE 
J043010O12TGTTGGGCCTANONE 
Os01g0915800AK103859TAGGCCCACGCGSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TAGGCCCACGCGNONE 
J090056H03TAGGCCCACGCGNONE 
J090058L14TAGGCCCACGCGNONE 
J090058P16TAGGCCCACGCGNONE 
J090076C19TAGGCCCACGCGNONE 
J100086P14TAGGCCCACGCGNONE 
Os01g0917400AK111958GTTTGGGCCTANONE 
Os01g0920400016-005-B10AATTGGGCCTANONE 
AK073965AATTGGGCCTASimilar to Dynamin-related protein 3A (Dynamin-like protein 2) (Dynamin-like protein 2a). Splice isoform 2. 
J013023K02AATTGGGCCTANONE 
J023008G04AATTGGGCCTANONE 
J033072A13AATTGGGCCTANONE 
J033106F08AATTGGGCCTANONE 
J043009F23AATTGGGCCTANONE 
J043027F03AATTGGGCCTANONE 
J065009O17AATTGGGCCTANONE 
J065046M03AATTGGGCCTANONE 
J065051H14AATTGGGCCTANONE 
J065077G12AATTGGGCCTANONE 
J065082M20AATTGGGCCTANONE 
J065087O20AATTGGGCCTANONE 
J065123N10AATTGGGCCTANONE 
J065124O16AATTGGGCCTANONE 
J065163P15AATTGGGCCTANONE 
J065166D19AATTGGGCCTANONE 
J065212C15AATTGGGCCTANONE 
J065219F23AATTGGGCCTANONE 
J075068F08AATTGGGCCTANONE 
J075139J12AATTGGGCCTANONE 
J075196K05AATTGGGCCTANONE 
J090050D18AATTGGGCCTANONE 
J090099H08AATTGGGCCTANONE 
J100029L12AATTGGGCCTANONE 
J100044C19AATTGGGCCTANONE 
J100056L03AATTGGGCCTANONE 
J100078E23AATTGGGCCTANONE 
J100087E19AATTGGGCCTANONE 
Os01g0929500AK111399TAGGCCCATCCSimilar to Carbonyl reductase-like protein. 
AK120263TAGGCCCATCCNONE 
Os01g0937300AK062872TTTTGGGCCTANONE 
J033136K12TTTTGGGCCTANONE 
J053048E20TTTTGGGCCTANONE 
J053088K08TTTTGGGCCTANONE 
J065011G23TTTTGGGCCTANONE 
J065202J09TTTTGGGCCTANONE 
Os01g0945300003-104-D07TATTGGGCCTANONE 
AK065371TATTGGGCCTAAmino acid/polyamine transporter I family protein. 
AK072189TATTGGGCCTANONE 
J013023D09TATTGGGCCTANONE 
J013055J18TATTGGGCCTANONE 
J013146P21TATTGGGCCTANONE 
J075109G14TATTGGGCCTANONE 
J075158O19TATTGGGCCTANONE 
Os01g0960800AK073977TAATGGGCCTAProtein Transporter, Pam16 family protein. 
AK073977TAGGCCCAGTAProtein Transporter, Pam16 family protein. 
AY313247TAATGGGCCTANONE 
AY313247TAGGCCCAGTANONE 
J033075P16TAATGGGCCTANONE 
J033075P16TAGGCCCAGTANONE 
J065051H06TAATGGGCCTANONE 
J065051H06TAGGCCCAGTANONE 
J065167L02TAATGGGCCTANONE 
J065167L02TAGGCCCAGTANONE 
J090083C22TAATGGGCCTANONE 
J090083C22TAGGCCCAGTANONE 
Os01g0970900011-018-A07ATTGGGCCTANONE 
011-022-E12ATTGGGCCTANONE 
AK063285ATTGGGCCTANONE 
AK101688ATTGGGCCTAProtein prenyltransferase domain containing protein. 
J100042L01ATTGGGCCTANONE 
J100053B11ATTGGGCCTANONE 
Os01g0976300AK111354TGGTGGGCCTAHeavy metal transport/detoxification protein domain containing protein. 
Os02g0102700006-096-A07TAGGCCCAAATNONE 
AK061193TAGGCCCAAATSimilar to AGL157Cp. 
AK061558TAGGCCCAAATNONE 
AK103689TAGGCCCAAATNONE 
J023128B06TAGGCCCAAATNONE 
J033136G21TAGGCCCAAATNONE 
J053084F10TAGGCCCAAATNONE 
J053089D12TAGGCCCAAATNONE 
J075149B12TAGGCCCAAATNONE 
J075165L17TAGGCCCAAATNONE 
Os02g0103700009-031-C12TAGGCCCAATANONE 
AK062502TAGGCCCAATANONE 
AK102186TAGGCCCAATASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17TAGGCCCAATANONE 
J065161I07TAGGCCCAATANONE 
J065184G15TAGGCCCAATANONE 
J075123E02TAGGCCCAATANONE 
Os02g0116900009-017-C02TAATGGGCCTANONE 
AK121401TAATGGGCCTASimilar to 15.9 kDa subunit of RNA polymerase II. 
J013105H09TAATGGGCCTANONE 
J023131N03TAATGGGCCTANONE 
J033145N08TAATGGGCCTANONE 
J065105G09TAATGGGCCTANONE 
J075086L06TAATGGGCCTANONE 
Os02g0120000AK067383GTGGTGGGCCTATTTGGGCTGAProtein prenyltransferase domain containing protein. 
AK101590GTGGTGGGCCTATTTGGGCTGANONE 
J013100B15GTGGTGGGCCTATTTGGGCTGANONE 
Os02g0135600AK069843GCCGGCCCAGTTAGGCCCACAConserved hypothetical protein. 
J023034H09GCCGGCCCAGTTAGGCCCACANONE 
J033090D08GCCGGCCCAGTTAGGCCCACANONE 
J100025N07GCCGGCCCAGTTAGGCCCACANONE 
J100075G18GCCGGCCCAGTTAGGCCCACANONE 
Os02g0135700AK100570TGTGGGCCTAACTGGGCCGGCDNA polymerase V family protein. 
Os02g0136800011-089-E11TTATGGGCCTANONE 
AK070727TTATGGGCCTANONE 
AK103485TTATGGGCCTAProtein of unknown function DUF1677, Oryza sativa family protein. 
J023058D10TTATGGGCCTANONE 
J033140H14TTATGGGCCTANONE 
J033142H14TTATGGGCCTANONE 
J065151O09TTATGGGCCTANONE 
J090076K09TTATGGGCCTANONE 
J090085K04TTATGGGCCTANONE 
Os02g0176400009-099-H11TAGGCCCAGCNONE 
AK062746TAGGCCCAGCProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0178400009-151-B08TAGGCCCACANONE 
009-151-B08TAGGCCCATGGGCCGGANONE 
AK063815TAGGCCCACAProtein transport protein SEC61 gamma subunit. 
AK063815TAGGCCCATGGGCCGGAProtein transport protein SEC61 gamma subunit. 
AK121516TAGGCCCACANONE 
AK121516TAGGCCCATGGGCCGGANONE 
J033026A17TAGGCCCACANONE 
J033026A17TAGGCCCATGGGCCGGANONE 
J065011K14TAGGCCCACANONE 
J065011K14TAGGCCCATGGGCCGGANONE 
J065056D01TAGGCCCACANONE 
J065056D01TAGGCCCATGGGCCGGANONE 
J065061L22TAGGCCCACANONE 
J065061L22TAGGCCCATGGGCCGGANONE 
J065076M01TAGGCCCACANONE 
J065076M01TAGGCCCATGGGCCGGANONE 
J075092E14TAGGCCCACANONE 
J075092E14TAGGCCCATGGGCCGGANONE 
Os02g0192700004-020-H12TAGGCCCAACCNONE 
006-024-H06TAGGCCCAACCNONE 
006-042-F06TAGGCCCAACCNONE 
006-050-D04TAGGCCCAACCNONE 
006-059-E10TAGGCCCAACCNONE 
006-070-B02TAGGCCCAACCNONE 
006-084-A09TAGGCCCAACCNONE 
006-114-E11TAGGCCCAACCNONE 
006-117-E05TAGGCCCAACCNONE 
009-126-D11TAGGCCCAACCNONE 
AK061629TAGGCCCAACCSimilar to Thioredoxin peroxidase. 
AK065909TAGGCCCAACCNONE 
J013043E11TAGGCCCAACCNONE 
J065038I09TAGGCCCAACCNONE 
J065078C12TAGGCCCAACCNONE 
J065122O14TAGGCCCAACCNONE 
J065198H04TAGGCCCAACCNONE 
Os02g0193600AK060499TAGGCCCACAMad3/BUB1 homology region 1 domain containing protein. 
Os02g0202600AK068376GCTGGGCCTANONE 
AK099277GCTGGGCCTANONE 
AK101844GCTGGGCCTATetratricopeptide-like helical domain containing protein. 
J080001G13GCTGGGCCTANONE 
J080011J23GCTGGGCCTANONE 
J080015F12GCTGGGCCTANONE 
J080017J03GCTGGGCCTANONE 
J080030J24GCTGGGCCTANONE 
J080038H02GCTGGGCCTANONE 
J080041G13GCTGGGCCTANONE 
J080044B13GCTGGGCCTANONE 
J080044L10GCTGGGCCTANONE 
J080046H11GCTGGGCCTANONE 
J080057J01GCTGGGCCTANONE 
J080062E13GCTGGGCCTANONE 
J080062N11GCTGGGCCTANONE 
J080063C17GCTGGGCCTANONE 
J080064K11GCTGGGCCTANONE 
J080064N09GCTGGGCCTANONE 
J080067C17GCTGGGCCTANONE 
J080067C23GCTGGGCCTANONE 
J080069J21GCTGGGCCTANONE 
J080070L23GCTGGGCCTANONE 
J080085N15GCTGGGCCTANONE 
J080094F03GCTGGGCCTANONE 
Os02g0266200AK099647TAGGCCCACGCGNONE 
AK103371TAGGCCCACGCGProtein prenyltransferase domain containing protein. 
Os02g0266500AK100307TAATGGGCCTASimilar to RASPBERRY3. 
Os02g0321900AK058256TAGGCCCATAGCCCATCANONE 
AK062103TAGGCCCATAGCCCATCASimilar to 60S ribosomal protein L10a-1. 
AK102574TAGGCCCATAGCCCATCANONE 
J065176M06TAGGCCCATAGCCCATCANONE 
J075112D24TAGGCCCATAGCCCATCANONE 
Os02g0499300AK106994CCTGGGCCTAConserved hypothetical protein. 
Os02g0510300AK067961TGTGGGCCTAConserved hypothetical protein. 
AK104001TGTGGGCCTANONE 
J013123J20TGTGGGCCTANONE 
J065169H15TGTGGGCCTANONE 
Os02g0525400011-008-B01TAGGCCCACAGCCCAAACNONE 
AK065368TAGGCCCACAGCCCAAACSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13TAGGCCCACAGCCCAAACNONE 
J033046H10TAGGCCCACAGCCCAAACNONE 
Os02g0526500006-107-D09AATGGGCCTANONE 
Os02g0533800009-149-F12TAGGCCCAGANONE 
013-058-H02TAGGCCCAGANONE 
014-017-G07TAGGCCCAGANONE 
014-028-F04TAGGCCCAGANONE 
014-050-G04TAGGCCCAGANONE 
014-095-F04TAGGCCCAGANONE 
014-099-C08TAGGCCCAGANONE 
016-046-F05TAGGCCCAGANONE 
AK121139TAGGCCCAGAConserved hypothetical protein. 
J013104A14TAGGCCCAGANONE 
J023077F13TAGGCCCAGANONE 
J023145I11TAGGCCCAGANONE 
J065033D14TAGGCCCAGANONE 
J065079I15TAGGCCCAGANONE 
J065104E21TAGGCCCAGANONE 
J065128E06TAGGCCCAGANONE 
J065174F07TAGGCCCAGANONE 
J065195B12TAGGCCCAGANONE 
J065207B12TAGGCCCAGANONE 
J080304M24TAGGCCCAGANONE 
J090040A13TAGGCCCAGANONE 
J090054B18TAGGCCCAGANONE 
J100037A06TAGGCCCAGANONE 
J100042F24TAGGCCCAGANONE 
J100043N23TAGGCCCAGANONE 
J100044H14TAGGCCCAGANONE 
J100056K24TAGGCCCAGANONE 
J100063O22TAGGCCCAGANONE 
J100071G05TAGGCCCAGANONE 
J100078G15TAGGCCCAGANONE 
Os02g0533900AB062681TCTGGGCCTANONE 
AK061722TCTGGGCCTANONE 
AK106147TCTGGGCCTANONE 
AK121892TCTGGGCCTASimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0567000AK068282TAGGCCCAAATConserved hypothetical protein. 
AK068282TGTGGGCCTAConserved hypothetical protein. 
J075034A17TAGGCCCAAATNONE 
J075034A17TGTGGGCCTANONE 
J075129I09TAGGCCCAAATNONE 
J075129I09TGTGGGCCTANONE 
Os02g0591800AK060611ACATGGGCTAGGCCCACTBrix domain containing protein. 
AK102534ACATGGGCTAGGCCCACTNONE 
J075057H08ACATGGGCTAGGCCCACTNONE 
J075179P18ACATGGGCTAGGCCCACTNONE 
J080011H01ACATGGGCTAGGCCCACTNONE 
J080018E14ACATGGGCTAGGCCCACTNONE 
J080026N17ACATGGGCTAGGCCCACTNONE 
J080047A13ACATGGGCTAGGCCCACTNONE 
J080049C17ACATGGGCTAGGCCCACTNONE 
J080050G07ACATGGGCTAGGCCCACTNONE 
J080064D10ACATGGGCTAGGCCCACTNONE 
J080080A03ACATGGGCTAGGCCCACTNONE 
J080080G20ACATGGGCTAGGCCCACTNONE 
J080080I03ACATGGGCTAGGCCCACTNONE 
J080081H12ACATGGGCTAGGCCCACTNONE 
J080090K07ACATGGGCTAGGCCCACTNONE 
J080092O06ACATGGGCTAGGCCCACTNONE 
J080096B07ACATGGGCTAGGCCCACTNONE 
J080097M08ACATGGGCTAGGCCCACTNONE 
Os02g0606900J023065M01TAGGCCCAATANONE 
J023065M01TAGGCCCACANONE 
J023065M01TGGTGGGCCTANONE 
J075046E14TAGGCCCAATANONE 
J075046E14TAGGCCCACANONE 
J075046E14TGGTGGGCCTANONE 
Os02g0610700014-008-A03TAAGCCCACGTAGGCCCAAACNONE 
AK059205TAAGCCCACGTAGGCCCAAACConserved hypothetical protein. 
AK100281TAAGCCCACGTAGGCCCAAACNONE 
J023074H03TAAGCCCACGTAGGCCCAAACNONE 
J065002J16TAAGCCCACGTAGGCCCAAACNONE 
J065032I20TAAGCCCACGTAGGCCCAAACNONE 
J065076A07TAAGCCCACGTAGGCCCAAACNONE 
J065142O21TAAGCCCACGTAGGCCCAAACNONE 
J065203A03TAAGCCCACGTAGGCCCAAACNONE 
J075017F24TAAGCCCACGTAGGCCCAAACNONE 
J075017G24TAAGCCCACGTAGGCCCAAACNONE 
Os02g0621700011-079-F10TAGGCCCATGANONE 
AK101006TAGGCCCATGASimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK103525TAGGCCCATGANONE 
J013026C02TAGGCCCATGANONE 
J013104M10TAGGCCCATGANONE 
J023003D01TAGGCCCATGANONE 
J023007H13TAGGCCCATGANONE 
J023019G09TAGGCCCATGANONE 
J023020L19TAGGCCCATGANONE 
J023022L12TAGGCCCATGANONE 
J023022O14TAGGCCCATGANONE 
J023036F16TAGGCCCATGANONE 
J023047D16TAGGCCCATGANONE 
J023052P08TAGGCCCATGANONE 
J023077C01TAGGCCCATGANONE 
J023083M06TAGGCCCATGANONE 
J023105A11TAGGCCCATGANONE 
J023117F21TAGGCCCATGANONE 
J023119D20TAGGCCCATGANONE 
J023148E03TAGGCCCATGANONE 
J023149B13TAGGCCCATGANONE 
J033029A10TAGGCCCATGANONE 
J033046L17TAGGCCCATGANONE 
J033052M04TAGGCCCATGANONE 
J033057M14TAGGCCCATGANONE 
J033066K24TAGGCCCATGANONE 
J033069K02TAGGCCCATGANONE 
J033079G14TAGGCCCATGANONE 
J033101E06TAGGCCCATGANONE 
J033116E06TAGGCCCATGANONE 
J033118L18TAGGCCCATGANONE 
J033135B13TAGGCCCATGANONE 
J033136C10TAGGCCCATGANONE 
J033136P08TAGGCCCATGANONE 
J043027B13TAGGCCCATGANONE 
J065039I03TAGGCCCATGANONE 
J065185N21TAGGCCCATGANONE 
J090008D14TAGGCCCATGANONE 
J090029K17TAGGCCCATGANONE 
J090047H20TAGGCCCATGANONE 
J090048N17TAGGCCCATGANONE 
J090085G08TAGGCCCATGANONE 
J090089F07TAGGCCCATGANONE 
Os02g0633200012-053-F09CACGGCCCAATAGGCCCATTANONE 
012-053-F09TAGGCCCAGTANONE 
015-051-C09CACGGCCCAATAGGCCCATTANONE 
015-051-C09TAGGCCCAGTANONE 
AK063500CACGGCCCAATAGGCCCATTAProtein prenyltransferase domain containing protein. 
AK063500TAGGCCCAGTAProtein prenyltransferase domain containing protein. 
J065019K23CACGGCCCAATAGGCCCATTANONE 
J065019K23TAGGCCCAGTANONE 
J065205C16CACGGCCCAATAGGCCCATTANONE 
J065205C16TAGGCCCAGTANONE 
Os02g0665400AK073914CTTGGGCCTANONE 
AK109787CTTGGGCCTANONE 
AK120141CTTGGGCCTASimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19CTTGGGCCTANONE 
J075165B08CTTGGGCCTANONE 
J075177B03CTTGGGCCTANONE 
J075191K02CTTGGGCCTANONE 
J090051I12CTTGGGCCTANONE 
J090057E21CTTGGGCCTANONE 
J090058E01CTTGGGCCTANONE 
J090087C06CTTGGGCCTANONE 
J100025K07CTTGGGCCTANONE 
J100026I21CTTGGGCCTANONE 
J100041E12CTTGGGCCTANONE 
J100083B01CTTGGGCCTANONE 
Os02g0666800AK101444TAGGCCCACAAProtein of unknown function DUF788 family protein. 
J033039F09TAGGCCCACAANONE 
J065041E15TAGGCCCACAANONE 
J075087I24TAGGCCCACAANONE 
J100079A10TAGGCCCACAANONE 
Os02g0682600AK108470TGTGGGCCTAZinc finger, Tim10/DDP-type family protein. 
J065019B06TGTGGGCCTANONE 
J065065L01TGTGGGCCTANONE 
Os02g0689200011-024-D04TAGGCCCAAANONE 
AK071254TAGGCCCAAANONE 
AK072660TAGGCCCAAAProtein of unknown function DUF250 domain containing protein. 
J023087G23TAGGCCCAAANONE 
J023134O11TAGGCCCAAANONE 
J033095E21TAGGCCCAAANONE 
J033113F12TAGGCCCAAANONE 
J033124F02TAGGCCCAAANONE 
J065070A01TAGGCCCAAANONE 
J065129C05TAGGCCCAAANONE 
J065165M19TAGGCCCAAANONE 
J090015K07TAGGCCCAAANONE 
J090066D21TAGGCCCAAANONE 
J090075M20TAGGCCCAAANONE 
Os02g0700100AK102954TAGGCCCATATSimilar to WD-repeat protein. 
Os02g0717800009-009-B02TAGGCCCAGTANONE 
J065185P06TAGGCCCAGTANONE 
J100061J04TAGGCCCAGTANONE 
J100064M21TAGGCCCAGTANONE 
Os02g0728600AK063054CTGACAGGTGGGCCTASimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04CTGACAGGTGGGCCTANONE 
Os02g0744100006-070-H12TGATGGGCCTANONE 
006-115-C05TGATGGGCCTANONE 
AK061274TGATGGGCCTASAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0767100011-054-E05TCTGGGCCTANONE 
AK063351TCTGGGCCTANONE 
AK103640TCTGGGCCTAConserved hypothetical protein. 
J090022G11TCTGGGCCTANONE 
J090072L18TCTGGGCCTANONE 
Os02g0767900009-154-G01AGGTGGGCCTAGCCCATCGNONE 
009-172-H09AGGTGGGCCTAGCCCATCGNONE 
AK099885AGGTGGGCCTAGCCCATCGGlutaredoxin 2 family protein. 
Os02g0770700AK106494TGTGGGCCTAPeptidase C50, separase family protein. 
Os02g0788400AK060351TAGGCCCAATANONE 
AK103497TAGGCCCAATASimilar to Eukaryotic translation initiation factor 3 subunit-like protein. 
Os02g0796900009-121-E06TAGGCCCAGTNONE 
D29725TAGGCCCAGTSimilar to 60S ribosomal protein L39. 
J075016N24TAGGCCCAGTNONE 
J075085F03TAGGCCCAGTNONE 
J075147P11TAGGCCCAGTNONE 
J075180E16TAGGCCCAGTNONE 
J075182A19TAGGCCCAGTNONE 
Os02g0816700009-132-E07TAATGGGCCGTAGGCCCATTTNONE 
009-132-E07TAATGGGCCTANONE 
AK059572TAATGGGCCGTAGGCCCATTTConserved hypothetical protein. 
AK059572TAATGGGCCTAConserved hypothetical protein. 
Os02g0816800013-089-A09AAATGGGCCTACGGCCCATTANONE 
013-089-A09TAGGCCCATTANONE 
AK102271AAATGGGCCTACGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
AK102271TAGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
J013105O04AAATGGGCCTACGGCCCATTANONE 
J013105O04TAGGCCCATTANONE 
J013124I08AAATGGGCCTACGGCCCATTANONE 
J013124I08TAGGCCCATTANONE 
J023002E08AAATGGGCCTACGGCCCATTANONE 
J023002E08TAGGCCCATTANONE 
J023025C01AAATGGGCCTACGGCCCATTANONE 
J023025C01TAGGCCCATTANONE 
J023037O12AAATGGGCCTACGGCCCATTANONE 
J023037O12TAGGCCCATTANONE 
J023049N06AAATGGGCCTACGGCCCATTANONE 
J023049N06TAGGCCCATTANONE 
J023069G18AAATGGGCCTACGGCCCATTANONE 
J023069G18TAGGCCCATTANONE 
J033029M02AAATGGGCCTACGGCCCATTANONE 
J033029M02TAGGCCCATTANONE 
J033037L22AAATGGGCCTACGGCCCATTANONE 
J033037L22TAGGCCCATTANONE 
J033089A08AAATGGGCCTACGGCCCATTANONE 
J033089A08TAGGCCCATTANONE 
J033103L07AAATGGGCCTACGGCCCATTANONE 
J033103L07TAGGCCCATTANONE 
J033125L19AAATGGGCCTACGGCCCATTANONE 
J033125L19TAGGCCCATTANONE 
J090008N20AAATGGGCCTACGGCCCATTANONE 
J090008N20TAGGCCCATTANONE 
J090041F23AAATGGGCCTACGGCCCATTANONE 
J090041F23TAGGCCCATTANONE 
J090092H16AAATGGGCCTACGGCCCATTANONE 
J090092H16TAGGCCCATTANONE 
Os02g0819100AK100156TAGGCCCAATAZinc finger, DHHC-type domain containing protein. 
J013088C21TAGGCCCAATANONE 
Os02g0819700AK067374TAGGCCCAATTZinc finger, Zim17-type family protein. 
AK067374TAGGCCCATAZinc finger, Zim17-type family protein. 
AK099160TAGGCCCAATTNONE 
AK099160TAGGCCCATANONE 
J100086K17TAGGCCCAATTNONE 
J100086K17TAGGCCCATANONE 
Os02g0820600AK066549TAGGCCCATTAConserved hypothetical protein. 
J013070F02TAGGCCCATTANONE 
Os02g0820700006-025-E04TAATGGGCCTANONE 
006-052-F06TAATGGGCCTANONE 
006-082-A05TAATGGGCCTANONE 
006-089-B06TAATGGGCCTANONE 
AK060869TAATGGGCCTASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK061365TAATGGGCCTANONE 
AK103008TAATGGGCCTANONE 
AK104724TAATGGGCCTANONE 
J013049H21TAATGGGCCTANONE 
J043027N22TAATGGGCCTANONE 
J075031I15TAATGGGCCTANONE 
J075132D23TAATGGGCCTANONE 
Os02g0823000AK122065TAGGCCCAGGPeptidase A22B, minor histocompatibility antigen H13 family protein. 
Os03g0102200AK120183TAGGCCCAGTTSimilar to DNA-directed RNA polymerase II 14.5 kDa polypeptide (EC 2.7.7.6) (RPB9) (RPB14.5). 
J013034D10TAGGCCCAGTTNONE 
J065116C05TAGGCCCAGTTNONE 
J065120N21TAGGCCCAGTTNONE 
J090049D24TAGGCCCAGTTNONE 
Os03g0116500AF106844TAGGCCCATGAAAGCCCAAACNONE 
AK101870TAGGCCCATGAAAGCCCAAACConstitutive photomorphogenic 11. 
J023055L16TAGGCCCATGAAAGCCCAAACNONE 
J023088I16TAGGCCCATGAAAGCCCAAACNONE 
J033070E21TAGGCCCATGAAAGCCCAAACNONE 
J065124N22TAGGCCCATGAAAGCCCAAACNONE 
J075152A19TAGGCCCATGAAAGCCCAAACNONE 
J075181J21TAGGCCCATGAAAGCCCAAACNONE 
J090011F23TAGGCCCATGAAAGCCCAAACNONE 
Os03g0122200009-052-H10TAGGCCCAGGNONE 
AB042934TAGGCCCAGGNONE 
AK065033TAGGCCCAGGSimilar to 50S ribosomal protein L11. 
J013001H03TAGGCCCAGGNONE 
J023149C23TAGGCCCAGGNONE 
J065025J15TAGGCCCAGGNONE 
J065093D22TAGGCCCAGGNONE 
Os03g0125000006-032-D09TGATGGGCCTANONE 
006-032-D09TGATGGGCCTAAGGCCCAAATNONE 
006-033-B05TGATGGGCCTANONE 
006-033-B05TGATGGGCCTAAGGCCCAAATNONE 
006-048-G06TGATGGGCCTANONE 
006-048-G06TGATGGGCCTAAGGCCCAAATNONE 
006-048-G09TGATGGGCCTANONE 
006-048-G09TGATGGGCCTAAGGCCCAAATNONE 
006-052-D09TGATGGGCCTANONE 
006-052-D09TGATGGGCCTAAGGCCCAAATNONE 
006-072-A04TGATGGGCCTANONE 
006-072-A04TGATGGGCCTAAGGCCCAAATNONE 
006-076-F12TGATGGGCCTANONE 
006-076-F12TGATGGGCCTAAGGCCCAAATNONE 
006-080-B03TGATGGGCCTANONE 
006-080-B03TGATGGGCCTAAGGCCCAAATNONE 
006-092-H03TGATGGGCCTANONE 
006-092-H03TGATGGGCCTAAGGCCCAAATNONE 
006-103-G04TGATGGGCCTANONE 
006-103-G04TGATGGGCCTAAGGCCCAAATNONE 
009-079-E01TGATGGGCCTANONE 
009-079-E01TGATGGGCCTAAGGCCCAAATNONE 
009-150-F03TGATGGGCCTANONE 
009-150-F03TGATGGGCCTAAGGCCCAAATNONE 
AF095708TGATGGGCCTANONE 
AF095708TGATGGGCCTAAGGCCCAAATNONE 
AK059557TGATGGGCCTANONE 
AK059557TGATGGGCCTAAGGCCCAAATNONE 
AK070779TGATGGGCCTASimilar to 50S ribosomal protein L5, chloroplast. 
AK070779TGATGGGCCTAAGGCCCAAATSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999TGATGGGCCTANONE 
AK098999TGATGGGCCTAAGGCCCAAATNONE 
AK104137TGATGGGCCTANONE 
AK104137TGATGGGCCTAAGGCCCAAATNONE 
J065002D07TGATGGGCCTANONE 
J065002D07TGATGGGCCTAAGGCCCAAATNONE 
J065167E24TGATGGGCCTANONE 
J065167E24TGATGGGCCTAAGGCCCAAATNONE 
J075199O14TGATGGGCCTANONE 
J075199O14TGATGGGCCTAAGGCCCAAATNONE 
J100083L01TGATGGGCCTANONE 
J100083L01TGATGGGCCTAAGGCCCAAATNONE 
Os03g0127000AK068479TAGGCCCAGCAAAGCCCACGTConserved hypothetical protein. 
J013152D10TAGGCCCAGCAAAGCCCACGTNONE 
J075167I20TAGGCCCAGCAAAGCCCACGTNONE 
J090067O04TAGGCCCAGCAAAGCCCACGTNONE 
Os03g0143400AK073999TAGGCCCACAACCCGGCCCATTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21TAGGCCCACAACCCGGCCCATTNONE 
J033073C08TAGGCCCACAACCCGGCCCATTNONE 
J033094C19TAGGCCCACAACCCGGCCCATTNONE 
J065017L10TAGGCCCACAACCCGGCCCATTNONE 
J065070H22TAGGCCCACAACCCGGCCCATTNONE 
J065079M09TAGGCCCACAACCCGGCCCATTNONE 
J065091N18TAGGCCCACAACCCGGCCCATTNONE 
J065109N03TAGGCCCACAACCCGGCCCATTNONE 
J065113F05TAGGCCCACAACCCGGCCCATTNONE 
J065135D23TAGGCCCACAACCCGGCCCATTNONE 
J065156L16TAGGCCCACAACCCGGCCCATTNONE 
J065207O04TAGGCCCACAACCCGGCCCATTNONE 
J065208F03TAGGCCCACAACCCGGCCCATTNONE 
J090010M15TAGGCCCACAACCCGGCCCATTNONE 
J090056J18TAGGCCCACAACCCGGCCCATTNONE 
Os03g0197000AK071163TAGGCCCATTConserved hypothetical protein. 
J023079A07TAGGCCCATTNONE 
Os03g0200500005-016-A06CATGGGCCTANONE 
AK069251CATGGGCCTA40S ribosomal protein S3a (CYC07 protein). 
AK104243CATGGGCCTANONE 
AK104699CATGGGCCTANONE 
D26060CATGGGCCTANONE 
J013024H20CATGGGCCTANONE 
J013029C14CATGGGCCTANONE 
J013035O17CATGGGCCTANONE 
J013066B11CATGGGCCTANONE 
J013066B12CATGGGCCTANONE 
J013066B13CATGGGCCTANONE 
J013152M04CATGGGCCTANONE 
J023001A03CATGGGCCTANONE 
J023013H23CATGGGCCTANONE 
J023042L07CATGGGCCTANONE 
J023081L11CATGGGCCTANONE 
J023088I23CATGGGCCTANONE 
J023092N22CATGGGCCTANONE 
J023126A20CATGGGCCTANONE 
J023139A17CATGGGCCTANONE 
J023150G12CATGGGCCTANONE 
J033026M10CATGGGCCTANONE 
J033031H24CATGGGCCTANONE 
J033036C22CATGGGCCTANONE 
J033037P08CATGGGCCTANONE 
J033045G14CATGGGCCTANONE 
J033048A13CATGGGCCTANONE 
J033048B13CATGGGCCTANONE 
J033048K11CATGGGCCTANONE 
J033066A06CATGGGCCTANONE 
J033072H01CATGGGCCTANONE 
J033082K07CATGGGCCTANONE 
J033091G20CATGGGCCTANONE 
J033095C14CATGGGCCTANONE 
J033101N24CATGGGCCTANONE 
J033105L15CATGGGCCTANONE 
J033107J18CATGGGCCTANONE 
J033112L02CATGGGCCTANONE 
J033117I17CATGGGCCTANONE 
J043003K06CATGGGCCTANONE 
J043016I20CATGGGCCTANONE 
J043021A10CATGGGCCTANONE 
J043034F14CATGGGCCTANONE 
J065002O17CATGGGCCTANONE 
J065014B14CATGGGCCTANONE 
J065054N19CATGGGCCTANONE 
J065112P18CATGGGCCTANONE 
J065121B20CATGGGCCTANONE 
J065170M08CATGGGCCTANONE 
J065194B05CATGGGCCTANONE 
J090040F01CATGGGCCTANONE 
J090078O20CATGGGCCTANONE 
J090078P21CATGGGCCTANONE 
J090084E11CATGGGCCTANONE 
J100080B11CATGGGCCTANONE 
Os03g0219200011-045-E01TAGGCCCACAANONE 
AK073785TAGGCCCACAASimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19TAGGCCCACAANONE 
J043009H23TAGGCCCACAANONE 
Os03g0232500AK110980TAGGCCCATATGTP-binding protein, HSR1-related domain containing protein. 
AK110980TATTGGGCCTAGTP-binding protein, HSR1-related domain containing protein. 
AK110980TCTGGGCCTAGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TAGGCCCATATNONE 
J100036C06TATTGGGCCTANONE 
J100036C06TCTGGGCCTANONE 
Os03g0240700009-086-G10AATGGGCCTAGCCCAACANONE 
AK071799AATGGGCCTAGCCCAACAConserved hypothetical protein. 
J023112A13AATGGGCCTAGCCCAACANONE 
J043022A01AATGGGCCTAGCCCAACANONE 
J065106A01AATGGGCCTAGCCCAACANONE 
J075023P22AATGGGCCTAGCCCAACANONE 
J075138I21AATGGGCCTAGCCCAACANONE 
J075173L02AATGGGCCTAGCCCAACANONE 
Os03g0240800006-092-D05TGTTGGGCTAGGCCCATTNONE 
AK059292TGTTGGGCTAGGCCCATTNONE 
AK061178TGTTGGGCTAGGCCCATTSimilar to AGL157Cp. 
AK121552TGTTGGGCTAGGCCCATTNONE 
J023131D06TGTTGGGCTAGGCCCATTNONE 
J033033E14TGTTGGGCTAGGCCCATTNONE 
J033105B01TGTTGGGCTAGGCCCATTNONE 
J033114L18TGTTGGGCTAGGCCCATTNONE 
J033132N24TGTTGGGCTAGGCCCATTNONE 
J065032H03TGTTGGGCTAGGCCCATTNONE 
J065115J20TGTTGGGCTAGGCCCATTNONE 
J065150C05TGTTGGGCTAGGCCCATTNONE 
J080302A11TGTTGGGCTAGGCCCATTNONE 
J080302H16TGTTGGGCTAGGCCCATTNONE 
J080305M12TGTTGGGCTAGGCCCATTNONE 
J080306F13TGTTGGGCTAGGCCCATTNONE 
J080312A06TGTTGGGCTAGGCCCATTNONE 
J090088P09TGTTGGGCTAGGCCCATTNONE 
Os03g0244200003-114-A11TAGGCCCACTCTNONE 
015-089-B03TAGGCCCACTCTNONE 
016-048-G01TAGGCCCACTCTNONE 
AK101837TAGGCCCACTCTSimilar to Thaumatin-like protein. 
AK105771TAGGCCCACTCTNONE 
AK107182TAGGCCCACTCTNONE 
J065054I12TAGGCCCACTCTNONE 
J065208F20TAGGCCCACTCTNONE 
J075088F18TAGGCCCACTCTNONE 
J075092G13TAGGCCCACTCTNONE 
J075120G01TAGGCCCACTCTNONE 
J075147M20TAGGCCCACTCTNONE 
J075151J03TAGGCCCACTCTNONE 
J100064H21TAGGCCCACTCTNONE 
Os03g0249200009-103-B08AAAGCCCACATAGGCCCAAATNONE 
009-103-B08TAGGCCCATTANONE 
AK069944AAAGCCCACATAGGCCCAAATClass I peptide chain release factor domain containing protein. 
AK069944TAGGCCCATTAClass I peptide chain release factor domain containing protein. 
J065166E13AAAGCCCACATAGGCCCAAATNONE 
J065166E13TAGGCCCATTANONE 
Os03g0253100AK119618TAGGCCCACAGCCCACTTGPhosphomevalonate kinase Erg8 family protein. 
J033052A14TAGGCCCACAGCCCACTTGNONE 
Os03g0268300AK102684TAGGCCCAAGCCCAACCSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22TAGGCCCAAGCCCAACCNONE 
J013057J23TAGGCCCAAGCCCAACCNONE 
J013149I10TAGGCCCAAGCCCAACCNONE 
J013149M20TAGGCCCAAGCCCAACCNONE 
J013151D14TAGGCCCAAGCCCAACCNONE 
J013162O11TAGGCCCAAGCCCAACCNONE 
J023001F12TAGGCCCAAGCCCAACCNONE 
J023031B21TAGGCCCAAGCCCAACCNONE 
J023080A07TAGGCCCAAGCCCAACCNONE 
J023081N04TAGGCCCAAGCCCAACCNONE 
J023090C08TAGGCCCAAGCCCAACCNONE 
J023134G05TAGGCCCAAGCCCAACCNONE 
J023139G17TAGGCCCAAGCCCAACCNONE 
J023143I10TAGGCCCAAGCCCAACCNONE 
J023147D04TAGGCCCAAGCCCAACCNONE 
J023147O15TAGGCCCAAGCCCAACCNONE 
J033102K23TAGGCCCAAGCCCAACCNONE 
J033106C17TAGGCCCAAGCCCAACCNONE 
J075033G19TAGGCCCAAGCCCAACCNONE 
J075039J18TAGGCCCAAGCCCAACCNONE 
J075050K20TAGGCCCAAGCCCAACCNONE 
J075075J03TAGGCCCAAGCCCAACCNONE 
J075080E16TAGGCCCAAGCCCAACCNONE 
J075086L08TAGGCCCAAGCCCAACCNONE 
J075091K19TAGGCCCAAGCCCAACCNONE 
J075099O20TAGGCCCAAGCCCAACCNONE 
J075104I06TAGGCCCAAGCCCAACCNONE 
J075137C16TAGGCCCAAGCCCAACCNONE 
J075152G03TAGGCCCAAGCCCAACCNONE 
J075176N12TAGGCCCAAGCCCAACCNONE 
J100086K11TAGGCCCAAGCCCAACCNONE 
Os03g0282900006-088-H05TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK061166TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK102161TAATGGGCCTAGCCCATTTAGGCCCATTTConserved hypothetical protein. 
AK104514TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
Os03g0299900AK069075TAGGCCCAGCCCATGASimilar to Plastid aminotransferase (Fragment). 
AY338235TAGGCCCAGCCCATGANONE 
J053077F07TAGGCCCAGCCCATGANONE 
Os03g0300600003-125-G06AAATGGGCCTANONE 
006-048-C04AAATGGGCCTANONE 
009-044-A09AAATGGGCCTANONE 
AK059801AAATGGGCCTANONE 
AK066250AAATGGGCCTASimilar to Chaperone protein dnaJ. 
AK069897AAATGGGCCTANONE 
AK104186AAATGGGCCTANONE 
J065197D15AAATGGGCCTANONE 
J090031C11AAATGGGCCTANONE 
J100024C23AAATGGGCCTANONE 
J100030B16AAATGGGCCTANONE 
J100033K12AAATGGGCCTANONE 
J100043M19AAATGGGCCTANONE 
J100056N09AAATGGGCCTANONE 
J100058E12AAATGGGCCTANONE 
J100084J08AAATGGGCCTANONE 
Os03g0300700AK071770TCATGGGCCTARetrotransposon gag protein family protein. 
J023112P05TCATGGGCCTANONE 
Os03g0308000016-023-H09TAGGCCCAACANONE 
AK100355TAGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05TAGGCCCAACANONE 
J023043K04TAGGCCCAACANONE 
J023083I20TAGGCCCAACANONE 
J033068F22TAGGCCCAACANONE 
J033125P21TAGGCCCAACANONE 
J065207A22TAGGCCCAACANONE 
J100018D20TAGGCCCAACANONE 
J100026L17TAGGCCCAACANONE 
J100055D14TAGGCCCAACANONE 
J100060P03TAGGCCCAACANONE 
J100078A20TAGGCCCAACANONE 
Os03g0312600AK073391TAGGCCCAGGSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0320900015-016-D07TAGGCCCATANONE 
AK106255TAGGCCCATAGuanylate kinase family protein. 
Os03g0332700AK072820TAAGCCCATTAGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0337100AK107981TAGGCCCAGCConserved hypothetical protein. 
Os03g0340700011-070-H05CGGGCCGAGTTGGGCCTANONE 
AK100470CGGGCCGAGTTGGGCCTATetratricopeptide-like helical domain containing protein. 
J013158I08CGGGCCGAGTTGGGCCTANONE 
J023009H24CGGGCCGAGTTGGGCCTANONE 
J023031L20CGGGCCGAGTTGGGCCTANONE 
J023093E24CGGGCCGAGTTGGGCCTANONE 
J023105J11CGGGCCGAGTTGGGCCTANONE 
J100059O05CGGGCCGAGTTGGGCCTANONE 
J100075G03CGGGCCGAGTTGGGCCTANONE 
J100086J06CGGGCCGAGTTGGGCCTANONE 
Os03g0349000011-089-G05TAGGCCCAGGCCCATCTNONE 
AK099999TAGGCCCAGGCCCATCTNucleoporin interacting component family protein. 
J013134K18TAGGCCCAGGCCCATCTNONE 
J033024G23TAGGCCCAGGCCCATCTNONE 
J033098A12TAGGCCCAGGCCCATCTNONE 
J090001N18TAGGCCCAGGCCCATCTNONE 
J090058F11TAGGCCCAGGCCCATCTNONE 
J090065C04TAGGCCCAGGCCCATCTNONE 
J100067M17TAGGCCCAGGCCCATCTNONE 
J100083P13TAGGCCCAGGCCCATCTNONE 
Os03g0379500AK064760TAGGCCCACCASimilar to 40S ribosomal protein S9. 
AK064760TAGGCCCATAASimilar to 40S ribosomal protein S9. 
J080024D11TAGGCCCACCANONE 
J080024D11TAGGCCCATAANONE 
J080044J02TAGGCCCACCANONE 
J080044J02TAGGCCCATAANONE 
J080050F01TAGGCCCACCANONE 
J080050F01TAGGCCCATAANONE 
J080063D21TAGGCCCACCANONE 
J080063D21TAGGCCCATAANONE 
J080063G04TAGGCCCACCANONE 
J080063G04TAGGCCCATAANONE 
J080078E02TAGGCCCACCANONE 
J080078E02TAGGCCCATAANONE 
Os03g0411500AK058696TAGGCCCATGANONE 
AK071057TAGGCCCATGAPeptidase S14, ClpP family protein. 
Os03g0577000012-055-F04CTTGGGCCTANONE 
AK061051CTTGGGCCTASimilar to Ribosomal protein S3 (Fragment). 
AK099146CTTGGGCCTANONE 
J065060A01CTTGGGCCTANONE 
J075079B17CTTGGGCCTANONE 
J075134K12CTTGGGCCTANONE 
J090048F23CTTGGGCCTANONE 
J090072I19CTTGGGCCTANONE 
J100087C19CTTGGGCCTANONE 
J100090C21CTTGGGCCTANONE 
Os03g0586800003-114-H11TTCGTGGGCCTANONE 
AK063765TTCGTGGGCCTASimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302TTCGTGGGCCTANONE 
J090004H06TTCGTGGGCCTANONE 
J090022N15TTCGTGGGCCTANONE 
J100035E05TTCGTGGGCCTANONE 
J100041L05TTCGTGGGCCTANONE 
J100041M18TTCGTGGGCCTANONE 
J100057P04TTCGTGGGCCTANONE 
J100089H06TTCGTGGGCCTANONE 
J100090C23TTCGTGGGCCTANONE 
Os03g0587600Os03g0587600TAGGCCCAGTZinc finger, CCHC-type domain containing protein. 
Os03g0598200AK068322TAGGCCCATTANop14-like protein family protein. 
Os03g0626250J075100A11ACTGGGCCTANONE 
J075134H15ACTGGGCCTANONE 
J075142J02ACTGGGCCTANONE 
J075181A14ACTGGGCCTANONE 
J075192K17ACTGGGCCTANONE 
J090046B06ACTGGGCCTANONE 
Os03g0647400AK073665TGTTGGGCCTAGCK domain containing protein. 
J033051B07TGTTGGGCCTANONE 
Os03g0683700AK065067TAGGCCCAAAGGCCCAGGProtein of unknown function DUF810 family protein. 
Os03g0685700AK066043TAGGCCCAATProtein prenyltransferase domain containing protein. 
J013048F08TAGGCCCAATNONE 
Os03g0687800AK106820TAGGCCCAATAConserved hypothetical protein. 
Os03g0719100AK065127TAGGCCCATCCAAGCCCAACADNA-binding SAP domain containing protein. 
J013001P07TAGGCCCATCCAAGCCCAACANONE 
J065102J01TAGGCCCATCCAAGCCCAACANONE 
J065205K05TAGGCCCATCCAAGCCCAACANONE 
Os03g0725300011-085-E09TAGGCCCACGAANONE 
AK063969TAGGCCCACGAASimilar to Dbr1-prov protein. 
AK073636TAGGCCCACGAANONE 
J033050L15TAGGCCCACGAANONE 
J053082G03TAGGCCCACGAANONE 
Os03g0746600AK069559TACTGGGCCTAWD40-like domain containing protein. 
J023141K22TACTGGGCCTANONE 
Os03g0749900006-112-A05CTCGGCCCACCTAGGCCCATTTNONE 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
J023020I01CTCGGCCCACCTAGGCCCATTTNONE 
J033060N21CTCGGCCCACCTAGGCCCATTTNONE 
Os03g0754800AK101584TAATGGGCCTAMitochondrial substrate carrier family protein. 
J080305A09TAATGGGCCTANONE 
J080310E24TAATGGGCCTANONE 
J080310O12TAATGGGCCTANONE 
J080311N04TAATGGGCCTANONE 
J080313N20TAATGGGCCTANONE 
J080317H24TAATGGGCCTANONE 
Os03g0788200AK106623TAGGCCCATTAE1 protein and Def2/Der2 allergen family protein. 
J065112K18TAGGCCCATTANONE 
J065123A19TAGGCCCATTANONE 
J065131C15TAGGCCCATTANONE 
J065174D05TAGGCCCATTANONE 
J075011P16TAGGCCCATTANONE 
J075017N24TAGGCCCATTANONE 
J075028P19TAGGCCCATTANONE 
J075052I01TAGGCCCATTANONE 
J075057H20TAGGCCCATTANONE 
J075080F06TAGGCCCATTANONE 
J075091A10TAGGCCCATTANONE 
J075140L23TAGGCCCATTANONE 
J075156J08TAGGCCCATTANONE 
J075182D16TAGGCCCATTANONE 
J075191O21TAGGCCCATTANONE 
J090079E21TAGGCCCATTANONE 
Os03g0797600006-034-B06TAGGCCCATCANONE 
009-066-A01TAGGCCCATCANONE 
014-035-H08TAGGCCCATCANONE 
AK067446TAGGCCCATCASimilar to Helix-loop-helix protein homolog. 
AK068388TAGGCCCATCANONE 
AK104412TAGGCCCATCANONE 
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18GGCCGGGCCGGAACACGTGGGCCTANONE 
J033079G18GGCCGGGCCGGAACACGTGGGCCTANONE 
J043038B19GGCCGGGCCGGAACACGTGGGCCTANONE 
J065091E15GGCCGGGCCGGAACACGTGGGCCTANONE 
J065092P10GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189F18GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189L12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075021B11GGCCGGGCCGGAACACGTGGGCCTANONE 
J075022L15GGCCGGGCCGGAACACGTGGGCCTANONE 
J075046G12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075080H15GGCCGGGCCGGAACACGTGGGCCTANONE 
J090045H01GGCCGGGCCGGAACACGTGGGCCTANONE 
J090077H16GGCCGGGCCGGAACACGTGGGCCTANONE 
J090083D22GGCCGGGCCGGAACACGTGGGCCTANONE 
J100021D24GGCCGGGCCGGAACACGTGGGCCTANONE 
J100023G04GGCCGGGCCGGAACACGTGGGCCTANONE 
J100049J23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100075K23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100077G22GGCCGGGCCGGAACACGTGGGCCTANONE 
Os03g0820100011-030-A10TCGGCCCAATAGGCCCAAGNONE 
011-031-C01TCGGCCCAATAGGCCCAAGNONE 
AK111534TCGGCCCAATAGGCCCAAGSimilar to Auxin-resistance protein AXR1. 
J013033L14TCGGCCCAATAGGCCCAAGNONE 
J013034D14TCGGCCCAATAGGCCCAAGNONE 
J013065N20TCGGCCCAATAGGCCCAAGNONE 
J013127A04TCGGCCCAATAGGCCCAAGNONE 
J013146A11TCGGCCCAATAGGCCCAAGNONE 
J023025D19TCGGCCCAATAGGCCCAAGNONE 
J023083K15TCGGCCCAATAGGCCCAAGNONE 
J033037N01TCGGCCCAATAGGCCCAAGNONE 
J033041H02TCGGCCCAATAGGCCCAAGNONE 
J043009M22TCGGCCCAATAGGCCCAAGNONE 
J090039L03TCGGCCCAATAGGCCCAAGNONE 
J090050L08TCGGCCCAATAGGCCCAAGNONE 
J090053J21TCGGCCCAATAGGCCCAAGNONE 
J090088G07TCGGCCCAATAGGCCCAAGNONE 
Os03g0821900AK070847AGTGGGCCTACCGGGCCAAAGCCCACASimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0823500AK058972TAGGCCCATCGTGF-beta receptor, type I/II extracellular region family protein. 
AK099193TAGGCCCATCGNONE 
J023109G05TAGGCCCATCGNONE 
J023114H09TAGGCCCATCGNONE 
J065017L13TAGGCCCATCGNONE 
J065093G04TAGGCCCATCGNONE 
J065218D16TAGGCCCATCGNONE 
J090036G14TAGGCCCATCGNONE 
Os03g0828100009-088-D04TAGGCCCAACCNONE 
009-125-F01TAGGCCCAACCNONE 
009-169-C06TAGGCCCAACCNONE 
AK059132TAGGCCCAACCNONE 
AK062799TAGGCCCAACCNONE 
AK099043TAGGCCCAACCSimilar to 50S ribosomal protein L18. 
J013146D01TAGGCCCAACCNONE 
J065057J16TAGGCCCAACCNONE 
Os03g0829100AK072669TAGGCCCAGTASimilar to Soluble epoxide hydrolase. 
J013073C22TAGGCCCAGTANONE 
J033067O15TAGGCCCAGTANONE 
J065021D04TAGGCCCAGTANONE 
J065102E20TAGGCCCAGTANONE 
Os03g0831100AK103115TAGGCCCAGCCCATGGGCArmadillo-like helical domain containing protein. 
AK103115TGATGGGCCTAArmadillo-like helical domain containing protein. 
J033119F15TAGGCCCAGCCCATGGGCNONE 
J033119F15TGATGGGCCTANONE 
J065011M19TAGGCCCAGCCCATGGGCNONE 
J065011M19TGATGGGCCTANONE 
J075019I08TAGGCCCAGCCCATGGGCNONE 
J075019I08TGATGGGCCTANONE 
J075047A01TAGGCCCAGCCCATGGGCNONE 
J075047A01TGATGGGCCTANONE 
J075096P21TAGGCCCAGCCCATGGGCNONE 
J075096P21TGATGGGCCTANONE 
J075121I05TAGGCCCAGCCCATGGGCNONE 
J075121I05TGATGGGCCTANONE 
J075121I07TAGGCCCAGCCCATGGGCNONE 
J075121I07TGATGGGCCTANONE 
J090063F13TAGGCCCAGCCCATGGGCNONE 
J090063F13TGATGGGCCTANONE 
J090068F16TAGGCCCAGCCCATGGGCNONE 
J090068F16TGATGGGCCTANONE 
J090094E14TAGGCCCAGCCCATGGGCNONE 
J090094E14TGATGGGCCTANONE 
Os03g0833700011-060-A10ATTTGGGCCTANONE 
AK121918ATTTGGGCCTARNA 3'-terminal phosphate cyclase family protein. 
Os03g0835400AK061773TAGGCCCACTTGSimilar to Uvs101. 
AK098986TAGGCCCACTTGNONE 
AK105896TAGGCCCACTTGNONE 
Os03g0843700AK070364ACACGTGGGCCTAFAR1 domain containing protein. 
J013146A20ACACGTGGGCCTANONE 
J023050I08ACACGTGGGCCTANONE 
J033058E14ACACGTGGGCCTANONE 
J033111G20ACACGTGGGCCTANONE 
J033141H24ACACGTGGGCCTANONE 
J065021K13ACACGTGGGCCTANONE 
J065082M21ACACGTGGGCCTANONE 
J075106L22ACACGTGGGCCTANONE 
J075150L05ACACGTGGGCCTANONE 
J075172H24ACACGTGGGCCTANONE 
J075199F06ACACGTGGGCCTANONE 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0851900AK102145TAGGCCCACAAAFG1-like ATPase family protein. 
AK102145TAGGCCCATTTAFG1-like ATPase family protein. 
J033086B08TAGGCCCACAANONE 
J033086B08TAGGCCCATTTNONE 
Os03g0857500AK072880TAGGCCCATCGProtein of unknown function DUF303, acetylesterase putative domain containing protein. 
Os04g0105700004-005-E05AAATGGGCCTANONE 
006-037-C11AAATGGGCCTANONE 
006-039-E07AAATGGGCCTANONE 
006-049-A02AAATGGGCCTANONE 
006-076-D05AAATGGGCCTANONE 
006-089-E04AAATGGGCCTANONE 
006-097-F12AAATGGGCCTANONE 
AK060872AAATGGGCCTANONE 
AK065082AAATGGGCCTANONE 
AK104254AAATGGGCCTAConserved hypothetical protein. 
AK104546AAATGGGCCTANONE 
AK104634AAATGGGCCTANONE 
AY224557AAATGGGCCTANONE 
J013001L09AAATGGGCCTANONE 
J013151B18AAATGGGCCTANONE 
J023054G18AAATGGGCCTANONE 
Os04g0305700009-180-E11TTTTGGGCCTANONE 
AK068128TTTTGGGCCTAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK105689TTTTGGGCCTANONE 
J065026K17TTTTGGGCCTANONE 
J065122C23TTTTGGGCCTANONE 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0441800AK064785TAGGCCCAGCCTGF-beta receptor, type I/II extracellular region family protein. 
J013000B16TAGGCCCAGCCNONE 
J100043P07TAGGCCCAGCCNONE 
Os04g0465000AK060688TAGGCCCAAAANONE 
AK102302TAGGCCCAAAASterile alpha motif homology domain containing protein. 
J023084D14TAGGCCCAAAANONE 
J023086J22TAGGCCCAAAANONE 
Os04g0520900AK068793TAGGCCCAAATProtein prenyltransferase domain containing protein. 
AK105606TAGGCCCAAATNONE 
Os04g0551300AK103502TAGGCCCATGTSimilar to Growth regulator like protein. 
Os04g0581300009-171-H01ATTTGGGCCTTTTTGGGCCTANONE 
AK063093ATTTGGGCCTTTTTGGGCCTASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0611300009-006-G08TAGGCCCATCANONE 
009-011-C01TAGGCCCATCANONE 
009-036-B09TAGGCCCATCANONE 
009-116-G09TAGGCCCATCANONE 
009-126-E09TAGGCCCATCANONE 
009-132-F09TAGGCCCATCANONE 
009-151-G07TAGGCCCATCANONE 
009-155-C07TAGGCCCATCANONE 
009-163-G01TAGGCCCATCANONE 
009-169-G08TAGGCCCATCANONE 
009-191-B02TAGGCCCATCANONE 
009-196-A08TAGGCCCATCANONE 
009-198-E07TAGGCCCATCANONE 
014-015-F04TAGGCCCATCANONE 
015-087-H04TAGGCCCATCANONE 
AK062605TAGGCCCATCANONE 
AK063022TAGGCCCATCAConserved hypothetical protein. 
AK066749TAGGCCCATCANONE 
AK104924TAGGCCCATCANONE 
J065002M20TAGGCCCATCANONE 
J065045L23TAGGCCCATCANONE 
J065101E05TAGGCCCATCANONE 
J065140J23TAGGCCCATCANONE 
J065179G11TAGGCCCATCANONE 
J065191B18TAGGCCCATCANONE 
J065192E03TAGGCCCATCANONE 
J065199H21TAGGCCCATCANONE 
J075067F01TAGGCCCATCANONE 
J075089L01TAGGCCCATCANONE 
J075147K22TAGGCCCATCANONE 
J080069G23TAGGCCCATCANONE 
J100053D10TAGGCCCATCANONE 
J100078C10TAGGCCCATCANONE 
Os04g0670800AK073170TAGGCCCATATNONE 
Os04g0674100J080097J12TAGGCCCACTThioredoxin-like fold domain containing protein. 
J080097J12TATTGGGCCTAThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965AGTGGGCCTANONE 
AK101965TAGGCCCAATNONE 
AK103795AGTGGGCCTACoenzyme Q biosynthesis Coq4 family protein. 
AK103795TAGGCCCAATCoenzyme Q biosynthesis Coq4 family protein. 
J033076F14AGTGGGCCTANONE 
J033076F14TAGGCCCAATNONE 
J065020P20AGTGGGCCTANONE 
J065020P20TAGGCCCAATNONE 
J065057I21AGTGGGCCTANONE 
J065057I21TAGGCCCAATNONE 
J065059P11AGTGGGCCTANONE 
J065059P11TAGGCCCAATNONE 
J065083A22AGTGGGCCTANONE 
J065083A22TAGGCCCAATNONE 
J065093K10AGTGGGCCTANONE 
J065093K10TAGGCCCAATNONE 
J065097D03AGTGGGCCTANONE 
J065097D03TAGGCCCAATNONE 
J065103P05AGTGGGCCTANONE 
J065103P05TAGGCCCAATNONE 
J065113K09AGTGGGCCTANONE 
J065113K09TAGGCCCAATNONE 
J065118F23AGTGGGCCTANONE 
J065118F23TAGGCCCAATNONE 
J065119M06AGTGGGCCTANONE 
J065119M06TAGGCCCAATNONE 
J065146K17AGTGGGCCTANONE 
J065146K17TAGGCCCAATNONE 
J065161N12AGTGGGCCTANONE 
J065161N12TAGGCCCAATNONE 
J065169L02AGTGGGCCTANONE 
J065169L02TAGGCCCAATNONE 
J065189H12AGTGGGCCTANONE 
J065189H12TAGGCCCAATNONE 
J065192E24AGTGGGCCTANONE 
J065192E24TAGGCCCAATNONE 
J065193K17AGTGGGCCTANONE 
J065193K17TAGGCCCAATNONE 
J065197O21AGTGGGCCTANONE 
J065197O21TAGGCCCAATNONE 
J065214D09AGTGGGCCTANONE 
J065214D09TAGGCCCAATNONE 
J065217B11AGTGGGCCTANONE 
J065217B11TAGGCCCAATNONE 
J075132K07AGTGGGCCTANONE 
J075132K07TAGGCCCAATNONE 
J100059D14AGTGGGCCTANONE 
J100059D14TAGGCCCAATNONE 
Os04g0676100Os04g0676100TCTGGGCCTACATGGGCCAGGCCGAAASimilar to Thioredoxin X, chloroplast precursor. 
Os05g0110700AK102486ATCTGGGCCTAAGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12ATCTGGGCCTAAGCCCAATANONE 
Os05g0121000009-181-E02GTTTGGGCCCACTAGGCCCAACCNONE 
009-181-E02TAGGCCCAGGNONE 
AK058867GTTTGGGCCCACTAGGCCCAACCNONE 
AK058867TAGGCCCAGGNONE 
AK071341GTTTGGGCCCACTAGGCCCAACCProtein of unknown function DUF1218 family protein. 
AK071341TAGGCCCAGGProtein of unknown function DUF1218 family protein. 
J023024H24GTTTGGGCCCACTAGGCCCAACCNONE 
J023024H24TAGGCCCAGGNONE 
J023090B22GTTTGGGCCCACTAGGCCCAACCNONE 
J023090B22TAGGCCCAGGNONE 
J023111G15GTTTGGGCCCACTAGGCCCAACCNONE 
J023111G15TAGGCCCAGGNONE 
J023134K14GTTTGGGCCCACTAGGCCCAACCNONE 
J023134K14TAGGCCCAGGNONE 
J033057C05GTTTGGGCCCACTAGGCCCAACCNONE 
J033057C05TAGGCCCAGGNONE 
J033067J15GTTTGGGCCCACTAGGCCCAACCNONE 
J033067J15TAGGCCCAGGNONE 
J033084L15GTTTGGGCCCACTAGGCCCAACCNONE 
J033084L15TAGGCCCAGGNONE 
J033088B04GTTTGGGCCCACTAGGCCCAACCNONE 
J033088B04TAGGCCCAGGNONE 
J043027A08GTTTGGGCCCACTAGGCCCAACCNONE 
J043027A08TAGGCCCAGGNONE 
J043029L03GTTTGGGCCCACTAGGCCCAACCNONE 
J043029L03TAGGCCCAGGNONE 
J053031K22GTTTGGGCCCACTAGGCCCAACCNONE 
J053031K22TAGGCCCAGGNONE 
J053046I01GTTTGGGCCCACTAGGCCCAACCNONE 
J053046I01TAGGCCCAGGNONE 
J053070B05GTTTGGGCCCACTAGGCCCAACCNONE 
J053070B05TAGGCCCAGGNONE 
J053072C10GTTTGGGCCCACTAGGCCCAACCNONE 
J053072C10TAGGCCCAGGNONE 
J065097M22GTTTGGGCCCACTAGGCCCAACCNONE 
J065097M22TAGGCCCAGGNONE 
J065164I17GTTTGGGCCCACTAGGCCCAACCNONE 
J065164I17TAGGCCCAGGNONE 
J075058I08GTTTGGGCCCACTAGGCCCAACCNONE 
J075058I08TAGGCCCAGGNONE 
J075064C09GTTTGGGCCCACTAGGCCCAACCNONE 
J075064C09TAGGCCCAGGNONE 
J080304C16GTTTGGGCCCACTAGGCCCAACCNONE 
J080304C16TAGGCCCAGGNONE 
J080304H16GTTTGGGCCCACTAGGCCCAACCNONE 
J080304H16TAGGCCCAGGNONE 
J080306E17GTTTGGGCCCACTAGGCCCAACCNONE 
J080306E17TAGGCCCAGGNONE 
J080310L03GTTTGGGCCCACTAGGCCCAACCNONE 
J080310L03TAGGCCCAGGNONE 
J080316J07GTTTGGGCCCACTAGGCCCAACCNONE 
J080316J07TAGGCCCAGGNONE 
J080317L23GTTTGGGCCCACTAGGCCCAACCNONE 
J080317L23TAGGCCCAGGNONE 
J080319A10GTTTGGGCCCACTAGGCCCAACCNONE 
J080319A10TAGGCCCAGGNONE 
J090060F01GTTTGGGCCCACTAGGCCCAACCNONE 
J090060F01TAGGCCCAGGNONE 
J100042N16GTTTGGGCCCACTAGGCCCAACCNONE 
J100042N16TAGGCCCAGGNONE 
J100047F05GTTTGGGCCCACTAGGCCCAACCNONE 
J100047F05TAGGCCCAGGNONE 
J100075J19GTTTGGGCCCACTAGGCCCAACCNONE 
J100075J19TAGGCCCAGGNONE 
Os05g0129400AK102359GTTTGGGCCTAGGCCCACCCGAnkyrin repeat containing protein. 
J033091I05GTTTGGGCCTAGGCCCACCCGNONE 
Os05g0129900AK060436TAGGCCCATATTetratricopeptide-like helical domain containing protein. 
AK102515TAGGCCCATATNONE 
Os05g0153400AK108071TAGGCCCAACACGGCCCATGTProtein prenyltransferase domain containing protein. 
Os05g0168400006-039-A06TAGGCCCAGTANONE 
AK069800TAGGCCCAGTANONE 
AK106195TAGGCCCAGTAConserved hypothetical protein. 
J065086N09TAGGCCCAGTANONE 
J065137B10TAGGCCCAGTANONE 
J075062B04TAGGCCCAGTANONE 
J075193I07TAGGCCCAGTANONE 
J075193K24TAGGCCCAGTANONE 
J075194D10TAGGCCCAGTANONE 
J100037F01TAGGCCCAGTANONE 
J100071E09TAGGCCCAGTANONE 
Os05g0180700J100062K04CCATGGGCCTAConserved hypothetical protein. 
Os05g0182800AK121273TAATGGGCCTAGlutamyl-tRNA synthetase, class Ic family protein. 
AK121273TGATGGGCCTAGlutamyl-tRNA synthetase, class Ic family protein. 
Os05g0186000006-103-D10TAGGCCCAAGNONE 
009-047-D06TAGGCCCAAGNONE 
009-073-G05TAGGCCCAAGNONE 
009-084-G09TAGGCCCAAGNONE 
009-097-G04TAGGCCCAAGNONE 
009-111-D11TAGGCCCAAGNONE 
009-115-G01TAGGCCCAAGNONE 
009-131-B04TAGGCCCAAGNONE 
009-144-F05TAGGCCCAAGNONE 
009-154-D08TAGGCCCAAGNONE 
014-004-H02TAGGCCCAAGNONE 
AK058675TAGGCCCAAGNONE 
AK060420TAGGCCCAAGSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231TAGGCCCAAGNONE 
J065155C08TAGGCCCAAGNONE 
J075143K12TAGGCCCAAGNONE 
Os05g0214100AK100400TGTGGGCCTASimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y- 1140 of Kluyveromyces lactis. 
AK107105TGTGGGCCTANONE 
J013073B12TGTGGGCCTANONE 
J013093B07TGTGGGCCTANONE 
J023086N14TGTGGGCCTANONE 
J065143B06TGTGGGCCTANONE 
J090009B02TGTGGGCCTANONE 
J090075A13TGTGGGCCTANONE 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0295900AK069962TAGGCCCATTAGCCCAAACConserved hypothetical protein. 
Os05g0300700014-079-G07TAGGCCCACTGACNONE 
AK063728TAGGCCCACTGACNONE 
AK067846TAGGCCCACTGACConserved hypothetical protein. 
Os05g0378900AK103841AGATGGGCCTAConserved hypothetical protein. 
J033148I18AGATGGGCCTANONE 
J065085F12AGATGGGCCTANONE 
J075041H24AGATGGGCCTANONE 
J075180P06AGATGGGCCTANONE 
Os05g0435400AK109595TAGGCCCATTTConserved hypothetical protein. 
Os05g0443800AK106590CGATGGGCCTASimilar to Plastid division protein ftsZ1 precursor. 
Os05g0446900AK101748CTTGGGCCTCTGGGCCTAGlycoside hydrolase, starch-binding domain containing protein. 
Os05g0456000AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
AK102036TCCGGCCCAACATGGATGGGCCTANONE 
J065066F02TCCGGCCCAACATGGATGGGCCTANONE 
Os05g0484000AK106829TAGGCCCAAGProtein of unknown function DUF295 family protein. 
Os05g0488900AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0512500009-036-D05ATCTGGGCCTANONE 
AK062441ATCTGGGCCTACT20 family protein. 
J080003C10ATCTGGGCCTANONE 
J080046G11ATCTGGGCCTANONE 
Os05g0513400AK069309TGTGGGCCTAProtein of unknown function DUF803 family protein. 
AK121638TGTGGGCCTANONE 
Os05g0524500AK073571TAGGCCCACCCGProtein kinase-like domain containing protein. 
Os05g0540800AK060731TAGGCCCATACNONE 
AK071090TAGGCCCATACHomeodomain-like containing protein. 
J013095F03TAGGCCCATACNONE 
J023079C11TAGGCCCATACNONE 
J033080E08TAGGCCCATACNONE 
Os05g0541500AK101190TAGGCCCATCACyclin-like F-box domain containing protein. 
AK101531TAGGCCCATCANONE 
J033030F10TAGGCCCATCANONE 
Os05g0543800AK072185AATGGGCCTAConserved hypothetical protein. 
Os05g0552900AK102095TAGGCCCATATMAP65/ASE1 family protein. 
Os05g0559900AK067197AAATGGGCCTAtRNA-binding arm domain containing protein. 
J013074C15AAATGGGCCTANONE 
J013098O16AAATGGGCCTANONE 
J033030M01AAATGGGCCTANONE 
J090058H12AAATGGGCCTANONE 
J090075M06AAATGGGCCTANONE 
Os05g0561500006-066-D12ATTTGGGCTAGGCCCAGGNONE 
AK061788ATTTGGGCTAGGCCCAGGSimilar to CMP-KDO synthetase (EC 2.7.7.38) (Fragment). 
AK098862ATTTGGGCTAGGCCCAGGNONE 
J013000O09ATTTGGGCTAGGCCCAGGNONE 
J033145C24ATTTGGGCTAGGCCCAGGNONE 
Os05g0574500006-021-A08ATCTCGGCCCATTAGGCCCATATNONE 
006-049-A11ATCTCGGCCCATTAGGCCCATATNONE 
006-086-F03ATCTCGGCCCATTAGGCCCATATNONE 
009-051-F06ATCTCGGCCCATTAGGCCCATATNONE 
AB015287ATCTCGGCCCATTAGGCCCATATNONE 
AB015972ATCTCGGCCCATTAGGCCCATATNONE 
AK061714ATCTCGGCCCATTAGGCCCATATNONE 
AK098889ATCTCGGCCCATTAGGCCCATATNONE 
AK121699ATCTCGGCCCATTAGGCCCATATSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCTCGGCCCATTAGGCCCATATNONE 
J013072D17ATCTCGGCCCATTAGGCCCATATNONE 
J023028M04ATCTCGGCCCATTAGGCCCATATNONE 
J023031F01ATCTCGGCCCATTAGGCCCATATNONE 
J023114L22ATCTCGGCCCATTAGGCCCATATNONE 
J033058L12ATCTCGGCCCATTAGGCCCATATNONE 
J033073D17ATCTCGGCCCATTAGGCCCATATNONE 
J043031D08ATCTCGGCCCATTAGGCCCATATNONE 
J043036G01ATCTCGGCCCATTAGGCCCATATNONE 
J065144O04ATCTCGGCCCATTAGGCCCATATNONE 
J065181O08ATCTCGGCCCATTAGGCCCATATNONE 
J080066B20ATCTCGGCCCATTAGGCCCATATNONE 
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os05g0587400AK102121TATTGGGCCTAPrefoldin domain containing protein. 
J033084N12TATTGGGCCTANONE 
Os06g0101300013-080-G09AGTTGGGCCTAATTGGGCCTGGNONE 
015-006-A01AGTTGGGCCTAATTGGGCCTGGNONE 
015-044-F09AGTTGGGCCTAATTGGGCCTGGNONE 
AK109515AGTTGGGCCTAATTGGGCCTGGZinc finger, RING-type domain containing protein. 
AK121897AGTTGGGCCTAATTGGGCCTGGNONE 
J033084O06AGTTGGGCCTAATTGGGCCTGGNONE 
J033105E24AGTTGGGCCTAATTGGGCCTGGNONE 
J033126H24AGTTGGGCCTAATTGGGCCTGGNONE 
J065001F05AGTTGGGCCTAATTGGGCCTGGNONE 
J065002H03AGTTGGGCCTAATTGGGCCTGGNONE 
J065026B12AGTTGGGCCTAATTGGGCCTGGNONE 
J065093E11AGTTGGGCCTAATTGGGCCTGGNONE 
J065122E04AGTTGGGCCTAATTGGGCCTGGNONE 
J065164O07AGTTGGGCCTAATTGGGCCTGGNONE 
J065182M16AGTTGGGCCTAATTGGGCCTGGNONE 
J065217N11AGTTGGGCCTAATTGGGCCTGGNONE 
J090002P22AGTTGGGCCTAATTGGGCCTGGNONE 
Os06g0103400009-138-H04TAGGCCCATCANONE 
AK067021TAGGCCCATCANucleic acid-binding, OB-fold domain containing protein. 
AK071627TAGGCCCATCANONE 
J080307A01TAGGCCCATCANONE 
Os06g0116400006-082-G06TAGGCCCAAACNONE 
AK058327TAGGCCCAAACNONE 
AK105979TAGGCCCAAACHigh-affinity nickel-transporter family protein. 
J065083I24TAGGCCCAAACNONE 
J100072O18TAGGCCCAAACNONE 
Os06g0116800AK058985AATGGGCCTASimilar to GFA2. 
AK120746AATGGGCCTANONE 
Os06g0129000Os06g0129000TGTGGGCCTAConserved hypothetical protein. 
Os06g0132600006-104-C03TAGGCCCATTTNONE 
AK061226TAGGCCCATTTConserved hypothetical protein. 
AK074010TAGGCCCATTTNONE 
J033076A22TAGGCCCATTTNONE 
Os06g0134000AJ417525AACTGGGCCTANONE 
AK062184AACTGGGCCTANONE 
AK106717AACTGGGCCTASimilar to 40S ribosomal protein S20. 
AK120319AACTGGGCCTANONE 
D10402AACTGGGCCTANONE 
D12632AACTGGGCCTANONE 
J013056N13AACTGGGCCTANONE 
J023100G01AACTGGGCCTANONE 
J053059F04AACTGGGCCTANONE 
J053068M21AACTGGGCCTANONE 
J053078H15AACTGGGCCTANONE 
J065050O15AACTGGGCCTANONE 
J065060G15AACTGGGCCTANONE 
J065080K10AACTGGGCCTANONE 
J065108G05AACTGGGCCTANONE 
J065186K16AACTGGGCCTANONE 
J075150J12AACTGGGCCTANONE 
J080002I18AACTGGGCCTANONE 
J080005H04AACTGGGCCTANONE 
J080008I06AACTGGGCCTANONE 
J080010G20AACTGGGCCTANONE 
J080010N10AACTGGGCCTANONE 
J080018H02AACTGGGCCTANONE 
J080022O14AACTGGGCCTANONE 
J080023F23AACTGGGCCTANONE 
J080025D16AACTGGGCCTANONE 
J080027L12AACTGGGCCTANONE 
J080030F16AACTGGGCCTANONE 
J080038N04AACTGGGCCTANONE 
J080048O17AACTGGGCCTANONE 
J080056B05AACTGGGCCTANONE 
J080061D02AACTGGGCCTANONE 
J080062H18AACTGGGCCTANONE 
J080064E06AACTGGGCCTANONE 
J080066D23AACTGGGCCTANONE 
J080071F08AACTGGGCCTANONE 
J080089E06AACTGGGCCTANONE 
J080089K22AACTGGGCCTANONE 
J080091C18AACTGGGCCTANONE 
J080095G10AACTGGGCCTANONE 
J090038G01AACTGGGCCTANONE 
J090062K07AACTGGGCCTANONE 
J100051G19AACTGGGCCTANONE 
Os06g0156900AK110688TAGGCCCATTTGlycosyl transferase, family 31 protein. 
Os06g0174350J043034B05AGTGGGCCTAGTTGGGCCGGAConserved hypothetical protein. 
Os06g0199500AK060939ATGGGCCTANONE 
AK064613ATGGGCCTASimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138ATGGGCCTANONE 
Os06g0213900AK106922TAGGCCCAAGCCCConserved hypothetical protein. 
J090028K09TAGGCCCAAGCCCNONE 
J100078N13TAGGCCCAAGCCCNONE 
Os06g0225300AK065224AAGGCCCAAATAGGCCCACTNONE 
AK100258AAGGCCCAAATAGGCCCACTSimilar to SERK1 (Fragment). 
J013002G23AAGGCCCAAATAGGCCCACTNONE 
Os06g0275500AK111743TAGGCCCATATSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0298400AK066952TAGGCCCAACWW/Rsp5/WWP domain containing protein. 
J013090J20TAGGCCCAACNONE 
J033024J05TAGGCCCAACNONE 
J033033H19TAGGCCCAACNONE 
J033057J15TAGGCCCAACNONE 
J065047L24TAGGCCCAACNONE 
J065198L23TAGGCCCAACNONE 
J065218N03TAGGCCCAACNONE 
J090001F10TAGGCCCAACNONE 
J090025N24TAGGCCCAACNONE 
J090073E16TAGGCCCAACNONE 
Os06g0298500AK108252GTATGGGCCTAConserved hypothetical protein. 
AK108252TAGGCCCACGGConserved hypothetical protein. 
J065144C04GTATGGGCCTANONE 
J065144C04TAGGCCCACGGNONE 
J075054P09GTATGGGCCTANONE 
J075054P09TAGGCCCACGGNONE 
J075165A13GTATGGGCCTANONE 
J075165A13TAGGCCCACGGNONE 
J075172E10GTATGGGCCTANONE 
J075172E10TAGGCCCACGGNONE 
Os06g0304500AK119441CATGGGCCTACRS1/YhbY domain containing protein. 
J075143M24CATGGGCCTANONE 
J075194D03CATGGGCCTANONE 
Os06g0324000AK109614TAGGCCCAAACConserved hypothetical protein. 
Os06g0555500016-056-B08TAGGCCCATAANONE 
AK102375TAGGCCCATAANONE 
AK106546TAGGCCCATAAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08TAGGCCCATAANONE 
J033091P04TAGGCCCATAANONE 
J090082P16TAGGCCCATAANONE 
Os06g0607800012-010-G03ATATGGGCCTANONE 
012-010-G03TAGGCCCAAATNONE 
AB070254ATATGGGCCTANONE 
AB070254TAGGCCCAAATNONE 
AK063158ATATGGGCCTASimilar to 26S proteasome regulatory complex subunit p42D. 
AK063158TAGGCCCAAATSimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695ATATGGGCCTANONE 
AK066695TAGGCCCAAATNONE 
J013074G13ATATGGGCCTANONE 
J013074G13TAGGCCCAAATNONE 
J090015C16ATATGGGCCTANONE 
J090015C16TAGGCCCAAATNONE 
J090069H10ATATGGGCCTANONE 
J090069H10TAGGCCCAAATNONE 
Os06g0667600AK058606ACATGGGCCTANONE 
AK071621ACATGGGCCTASimilar to Glycine decarboxylase complex H-protein. 
J023101D03ACATGGGCCTANONE 
J033095E17ACATGGGCCTANONE 
J065020B16ACATGGGCCTANONE 
Os06g0681000009-105-G11GGATGGGCCTANONE 
AK062780GGATGGGCCTAConserved hypothetical protein. 
J100021E01GGATGGGCCTANONE 
Os06g0704600AK065784ATTGGGCCTANONE 
AK101836ATTGGGCCTASimilar to Delta-aminolevulinic acid dehydratase (Fragment). 
AK119551ATTGGGCCTANONE 
Os06g0709100006-057-D06GTTGGGCCTANONE 
011-040-A08GTTGGGCCTANONE 
016-044-A01GTTGGGCCTANONE 
AK059732GTTGGGCCTANONE 
AK070881GTTGGGCCTACyclin-like F-box domain containing protein. 
AK103683GTTGGGCCTANONE 
J065026P10GTTGGGCCTANONE 
J090017L13GTTGGGCCTANONE 
Os06g0712500AK068531AAATGGGCCTASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
AK068531TAGGCCCAATGGCCCATGGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os07g0123000AK070836GCCCATTAGGCCCACAACyclin-like F-box domain containing protein. 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0154300009-070-E08TAGGCCCATCCNONE 
009-077-E01TAGGCCCATCCNONE 
009-196-F05TAGGCCCATCCNONE 
AK105386TAGGCCCATCCConserved hypothetical protein. 
AK122093TAGGCCCATCCNONE 
J033124K14TAGGCCCATCCNONE 
J075006I22TAGGCCCATCCNONE 
J075185G02TAGGCCCATCCNONE 
J090039C02TAGGCCCATCCNONE 
Os07g0155200006-036-E03AAAGCCCATTTAGGCCCAGCCNONE 
006-036-E04AAAGCCCATTTAGGCCCAGCCNONE 
AK061006AAAGCCCATTTAGGCCCAGCCProtein of unknown function DUF150 family protein. 
AK104606AAAGCCCATTTAGGCCCAGCCNONE 
Os07g0158300006-049-G04TAGGCCCAATTNONE 
AK099188TAGGCCCAATTNONE 
AK104773TAGGCCCAATTNONE 
J013106F16TAGGCCCAATTNONE 
J013123H22TAGGCCCAATTNONE 
J023029J02TAGGCCCAATTNONE 
J023029J03TAGGCCCAATTNONE 
J033138N08TAGGCCCAATTNONE 
J075011F05TAGGCCCAATTNONE 
J075022F10TAGGCCCAATTNONE 
J075071L13TAGGCCCAATTNONE 
J075094B08TAGGCCCAATTNONE 
J075119B21TAGGCCCAATTNONE 
J075140L02TAGGCCCAATTNONE 
J075199O21TAGGCCCAATTNONE 
J080001I17TAGGCCCAATTNONE 
J080005M04TAGGCCCAATTNONE 
J080011P17TAGGCCCAATTNONE 
J080026B14TAGGCCCAATTNONE 
J080026C12TAGGCCCAATTNONE 
J080030N16TAGGCCCAATTNONE 
J080035K23TAGGCCCAATTNONE 
J080039J22TAGGCCCAATTNONE 
J080045D04TAGGCCCAATTNONE 
J080050C06TAGGCCCAATTNONE 
J080050K14TAGGCCCAATTNONE 
J080051I09TAGGCCCAATTNONE 
J080053F18TAGGCCCAATTNONE 
J080053G10TAGGCCCAATTNONE 
J080055F05TAGGCCCAATTNONE 
J080057E22TAGGCCCAATTNONE 
J080058F17TAGGCCCAATTNONE 
J080063C18TAGGCCCAATTNONE 
J080065E02TAGGCCCAATTNONE 
J080066E06TAGGCCCAATTNONE 
J080067O05TAGGCCCAATTNONE 
J080068N15TAGGCCCAATTNONE 
J080071O04TAGGCCCAATTNONE 
J080074A20TAGGCCCAATTNONE 
J080074E14TAGGCCCAATTNONE 
J080074L05TAGGCCCAATTNONE 
J080075E08TAGGCCCAATTNONE 
J080075H07TAGGCCCAATTNONE 
J080077D04TAGGCCCAATTNONE 
J080077N15TAGGCCCAATTNONE 
J080078A07TAGGCCCAATTNONE 
J080079H22TAGGCCCAATTNONE 
J080080F20TAGGCCCAATTNONE 
J080080M22TAGGCCCAATTNONE 
J080081K09TAGGCCCAATTNONE 
J080081L04TAGGCCCAATTNONE 
J080090K09TAGGCCCAATTNONE 
J080093O13TAGGCCCAATTNONE 
J080094A18TAGGCCCAATTNONE 
J080094E10TAGGCCCAATTNONE 
J080094H06TAGGCCCAATTNONE 
J080096I21TAGGCCCAATTNONE 
J100081A19TAGGCCCAATTNONE 
Os07g0164100AK111557GCTGGGCCTAHistone deacetylase superfamily protein. 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0188700011-058-D09ATATGGGCCTANONE 
AK063957ATATGGGCCTANONE 
AK073755ATATGGGCCTASimilar to EXO. 
AK107609ATATGGGCCTANONE 
J033066N03ATATGGGCCTANONE 
Os07g0190900012-063-F11AATTGGGCCTANONE 
AK073533AATTGGGCCTASMAD/FHA domain containing protein. 
J013110O09AATTGGGCCTANONE 
J033041I12AATTGGGCCTANONE 
J033046D05AATTGGGCCTANONE 
J033101K24AATTGGGCCTANONE 
J090009F10AATTGGGCCTANONE 
J090095B17AATTGGGCCTANONE 
Os07g0191000AK071379TAGGCCCAATTInositol monophosphatase family protein. 
AK103440TAGGCCCAATTNONE 
Os07g0191700AK066389TAGGCCCAAAGCCCAGTASimilar to AT.I.24-9 protein (Fragment). 
AK103768TAGGCCCAAAGCCCAGTANONE 
Os07g0202400009-155-C12TAGGCCCACANONE 
AK063024TAGGCCCACAConserved hypothetical protein. 
Os07g0231500AK109283TAGGCCCAAACyclin-like domain containing protein. 
J075001D10TAGGCCCAAANONE 
J075088P14TAGGCCCAAANONE 
J075115C22TAGGCCCAAANONE 
J075199L15TAGGCCCAAANONE 
Os07g0256200AK072904AATTGGGCCTARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23AATTGGGCCTANONE 
Os07g0413800006-021-H08CCTGGGCCTANONE 
006-030-D01CCTGGGCCTANONE 
006-034-B05CCTGGGCCTANONE 
006-034-G03CCTGGGCCTANONE 
006-040-B11CCTGGGCCTANONE 
006-043-D03CCTGGGCCTANONE 
006-052-B04CCTGGGCCTANONE 
006-054-H11CCTGGGCCTANONE 
006-081-A04CCTGGGCCTANONE 
006-095-D10CCTGGGCCTANONE 
006-102-A01CCTGGGCCTANONE 
006-111-E02CCTGGGCCTANONE 
009-136-D03CCTGGGCCTANONE 
009-163-H08CCTGGGCCTANONE 
009-164-D03CCTGGGCCTANONE 
AK060411CCTGGGCCTANONE 
AK061478CCTGGGCCTAConserved hypothetical protein. 
AK104124CCTGGGCCTANONE 
AK104173CCTGGGCCTANONE 
AK120684CCTGGGCCTANONE 
J065112P06CCTGGGCCTANONE 
Os07g0513200015-004-B02TCTGGGCCTANONE 
AK101410TCTGGGCCTANONE 
AK106227TCTGGGCCTANONE 
AK119451TCTGGGCCTAProtein prenyltransferase domain containing protein. 
Os07g0535200011-024-E05TTTTGGGCCTANONE 
AK063926TTTTGGGCCTANONE 
AK101804TTTTGGGCCTACyclin-like F-box domain containing protein. 
J033066K01TTTTGGGCCTANONE 
J033133J23TTTTGGGCCTANONE 
Os07g0549800AK120874AACTGGGCCTASimilar to RGP-3 (Fragment). 
J023026P08AACTGGGCCTANONE 
J065205C05AACTGGGCCTANONE 
J065219M14AACTGGGCCTANONE 
J080010N21AACTGGGCCTANONE 
J080016K09AACTGGGCCTANONE 
J080017M18AACTGGGCCTANONE 
J080024C07AACTGGGCCTANONE 
J080027K09AACTGGGCCTANONE 
J080028E12AACTGGGCCTANONE 
J080028I22AACTGGGCCTANONE 
J080029C01AACTGGGCCTANONE 
J080030I18AACTGGGCCTANONE 
J080030M03AACTGGGCCTANONE 
J080032B11AACTGGGCCTANONE 
J080035B15AACTGGGCCTANONE 
J080038I09AACTGGGCCTANONE 
J080041C15AACTGGGCCTANONE 
J080042B01AACTGGGCCTANONE 
J080042F04AACTGGGCCTANONE 
J080048H05AACTGGGCCTANONE 
J080057F02AACTGGGCCTANONE 
J080069D04AACTGGGCCTANONE 
J080077K01AACTGGGCCTANONE 
J080085N11AACTGGGCCTANONE 
J080093P13AACTGGGCCTANONE 
J080097G10AACTGGGCCTANONE 
J080097L17AACTGGGCCTANONE 
J090026L10AACTGGGCCTANONE 
J090075O05AACTGGGCCTANONE 
Os07g0573600AK073925ATCTGGGCCTAREX1 DNA Repair family protein. 
J033072E11ATCTGGGCCTANONE 
Os07g0591400Os07g0591400GGTTGGGCCTACGTGGGCCCCCACNONE 
Os07g0604500009-018-C07CCTGGGCCTANONE 
009-194-C02CCTGGGCCTANONE 
011-023-C06CCTGGGCCTANONE 
015-035-B10CCTGGGCCTANONE 
AK064312CCTGGGCCTASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085CCTGGGCCTANONE 
J090050I12CCTGGGCCTANONE 
J100027C10CCTGGGCCTANONE 
J100029A05CCTGGGCCTANONE 
J100031P17CCTGGGCCTANONE 
J100039E20CCTGGGCCTANONE 
J100064L15CCTGGGCCTANONE 
J100066K08CCTGGGCCTANONE 
Os07g0633200AK061338TAGGCCCACGASimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451TAGGCCCACGANONE 
J033096E22TAGGCCCACGANONE 
J033125D06TAGGCCCACGANONE 
J075048C23TAGGCCCACGANONE 
J075050G02TAGGCCCACGANONE 
J075104J04TAGGCCCACGANONE 
J075144N04TAGGCCCACGANONE 
Os07g0659500AK073537TGGATGGGCCTANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0665200003-019-A05AATGGGCCTANONE 
009-087-A09AATGGGCCTANONE 
D01000AATGGGCCTANONE 
J033143H14AATGGGCCTANONE 
J043022G14AATGGGCCTANONE 
J043040G10AATGGGCCTANONE 
J065046K22AATGGGCCTANONE 
J065162K09AATGGGCCTANONE 
J065164G02AATGGGCCTANONE 
J075003D09AATGGGCCTANONE 
J075004F23AATGGGCCTANONE 
J075025F23AATGGGCCTANONE 
J075026E23AATGGGCCTANONE 
J075028N04AATGGGCCTANONE 
J075046L05AATGGGCCTANONE 
J075047G14AATGGGCCTANONE 
J075052I05AATGGGCCTANONE 
J075060K13AATGGGCCTANONE 
J075066I02AATGGGCCTANONE 
J075082L08AATGGGCCTANONE 
J075086C20AATGGGCCTANONE 
J075087E13AATGGGCCTANONE 
J075101B12AATGGGCCTASuperoxide dismutase [Cu-Zn] 2 (EC 1.15.1.1). 
J075114M12AATGGGCCTANONE 
J075120J06AATGGGCCTANONE 
J075141D13AATGGGCCTANONE 
J075155D09AATGGGCCTANONE 
J075155N05AATGGGCCTANONE 
J075163H19AATGGGCCTANONE 
J075165C16AATGGGCCTANONE 
J075172N15AATGGGCCTANONE 
J075174A22AATGGGCCTANONE 
J075175M10AATGGGCCTANONE 
J075176D14AATGGGCCTANONE 
J075180H01AATGGGCCTANONE 
J075188H09AATGGGCCTANONE 
J075192G18AATGGGCCTANONE 
J080003I11AATGGGCCTANONE 
J080013F21AATGGGCCTANONE 
J080027D23AATGGGCCTANONE 
J080033F06AATGGGCCTANONE 
J080034C04AATGGGCCTANONE 
J080044E15AATGGGCCTANONE 
J080048M04AATGGGCCTANONE 
J080049J23AATGGGCCTANONE 
J080059A17AATGGGCCTANONE 
J080063A12AATGGGCCTANONE 
J080069K04AATGGGCCTANONE 
J080070K24AATGGGCCTANONE 
J080075F04AATGGGCCTANONE 
J080076A11AATGGGCCTANONE 
J080076J10AATGGGCCTANONE 
J080082C24AATGGGCCTANONE 
J080085B06AATGGGCCTANONE 
J080089C13AATGGGCCTANONE 
J080096E20AATGGGCCTANONE 
J100021E15AATGGGCCTANONE 
J100029A07AATGGGCCTANONE 
J100053A11AATGGGCCTANONE 
J100058L04AATGGGCCTANONE 
J100061J11AATGGGCCTANONE 
J100063A11AATGGGCCTANONE 
Os07g0680300009-195-E06TCGGCCCACTTAGGCCCATATNONE 
AK063800TCGGCCCACTTAGGCCCATATSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCGGCCCACTTAGGCCCATATNONE 
J075066A20TCGGCCCACTTAGGCCCATATNONE 
J075088I17TCGGCCCACTTAGGCCCATATNONE 
J075147M19TCGGCCCACTTAGGCCCATATNONE 
J075153L02TCGGCCCACTTAGGCCCATATNONE 
J080013A21TCGGCCCACTTAGGCCCATATNONE 
J080051B13TCGGCCCACTTAGGCCCATATNONE 
J080077I24TCGGCCCACTTAGGCCCATATNONE 
J080302B14TCGGCCCACTTAGGCCCATATNONE 
J080309D22TCGGCCCACTTAGGCCCATATNONE 
J100083B16TCGGCCCACTTAGGCCCATATNONE 
Os07g0687300AK073043AAATGGGCTTAGGCCCATTSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os07g0693100AB111050TAGGCCCACCNONE 
AK100433TAGGCCCACCSimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC). 
J023054O07TAGGCCCACCNONE 
J023088C24TAGGCCCACCNONE 
J023088I11TAGGCCCACCNONE 
Os07g0695100AB189039AGATGGGCCGGATAGGCCCAGANONE 
AB189042AGATGGGCCGGATAGGCCCAGANONE 
AK059514AGATGGGCCGGATAGGCCCAGANONE 
AK066112AGATGGGCCGGATAGGCCCAGACheY-like domain containing protein. 
J013051N02AGATGGGCCGGATAGGCCCAGANONE 
J013127M02AGATGGGCCGGATAGGCCCAGANONE 
J023007I05AGATGGGCCGGATAGGCCCAGANONE 
Os08g0107900014-055-C03TGTGGGCCTANONE 
J065062G20TGTGGGCCTANONE 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK058365TGTTGGGCCTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
AK068373TGTTGGGCCTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10TGTTGGGCCTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17TGTTGGGCCTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10TGTTGGGCCTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
012-086-F03TAGGCCCAACANONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAGGCCCAACANONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAGGCCCAACANONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
AK121348TAGGCCCAACAConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J033027J18TAGGCCCAACANONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAGGCCCAACANONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAGGCCCAACANONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAGGCCCAACANONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAGGCCCAACANONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAGGCCCAACANONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAGGCCCAACANONE 
Os08g0143500006-072-G06TATTGGGCCTANONE 
016-053-H02TATTGGGCCTANONE 
AK061094TATTGGGCCTANONE 
AK071122TATTGGGCCTAGlycosyl transferase, family 14 protein. 
J023081E17TATTGGGCCTANONE 
J023106O18TATTGGGCCTANONE 
J043001N22TATTGGGCCTANONE 
J065062D05TATTGGGCCTANONE 
J065099M15TATTGGGCCTANONE 
J065180K12TATTGGGCCTANONE 
J090045L23TATTGGGCCTANONE 
J100088K05TATTGGGCCTANONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0158900AK067062TAGGCCCAAGGTP1/OBG domain containing protein. 
J013089F04TAGGCCCAAGNONE 
J013092D16TAGGCCCAAGNONE 
J033120K14TAGGCCCAAGNONE 
J033133F24TAGGCCCAAGNONE 
J033145A10TAGGCCCAAGNONE 
J033145A11TAGGCCCAAGNONE 
J053048H24TAGGCCCAAGNONE 
J053075H10TAGGCCCAAGNONE 
Os08g0159000AK073617CTTGGGCCTANONE 
AK103973CTTGGGCCTASimilar to DnaJ homolog subfamily C member 1. 
J023130H14CTTGGGCCTANONE 
J033051J11CTTGGGCCTANONE 
J065101C10CTTGGGCCTANONE 
J065168B04CTTGGGCCTANONE 
J065184E22CTTGGGCCTANONE 
J080021D11CTTGGGCCTANONE 
J080025H10CTTGGGCCTANONE 
J080026N19CTTGGGCCTANONE 
J080034A12CTTGGGCCTANONE 
J080040L02CTTGGGCCTANONE 
J080042H19CTTGGGCCTANONE 
J080047B05CTTGGGCCTANONE 
J080047E09CTTGGGCCTANONE 
J080047I01CTTGGGCCTANONE 
J080052H19CTTGGGCCTANONE 
J080062K13CTTGGGCCTANONE 
J080063A22CTTGGGCCTANONE 
J080068G18CTTGGGCCTANONE 
J080068N19CTTGGGCCTANONE 
J080076G08CTTGGGCCTANONE 
J080077H13CTTGGGCCTANONE 
J080077K06CTTGGGCCTANONE 
J080093D15CTTGGGCCTANONE 
J080094D21CTTGGGCCTANONE 
J080097A20CTTGGGCCTANONE 
J080097E21CTTGGGCCTANONE 
J080097N17CTTGGGCCTANONE 
J100071K18CTTGGGCCTANONE 
J100072F09CTTGGGCCTANONE 
Os08g0162500AK121633ATTTGGGCCTAConserved hypothetical protein. 
J033105E19ATTTGGGCCTANONE 
J080012K11ATTTGGGCCTANONE 
J080041I12ATTTGGGCCTANONE 
J080049G05ATTTGGGCCTANONE 
J080050P09ATTTGGGCCTANONE 
J080051A10ATTTGGGCCTANONE 
J080054G05ATTTGGGCCTANONE 
J080058M08ATTTGGGCCTANONE 
J080064N23ATTTGGGCCTANONE 
J080072L15ATTTGGGCCTANONE 
J080096H09ATTTGGGCCTANONE 
J100079I08ATTTGGGCCTANONE 
Os08g0208200009-112-E06CCTGGGCCTANONE 
AK062824CCTGGGCCTAPeptidase A1, pepsin family protein. 
Os08g0227100AK071657TAGGCCCAAAATRAF-like domain containing protein. 
AK103481TAGGCCCAAAANONE 
J065183O06TAGGCCCAAAANONE 
J090013C07TAGGCCCAAAANONE 
J090081F11TAGGCCCAAAANONE 
Os08g0282000016-023-A09TAGGCCCAAACNONE 
AK101411TAGGCCCAAACCD9/CD37/CD63 antigen family protein. 
J033037J09TAGGCCCAAACNONE 
J090047I07TAGGCCCAAACNONE 
J100021H13TAGGCCCAAACNONE 
Os08g0433200013-023-E07CATGGGCCTANONE 
013-023-E07CATGGGCCTANONE 
AK099471CATGGGCCTAConserved hypothetical protein. 
AK099471CATGGGCCTAConserved hypothetical protein. 
J013024A05CATGGGCCTANONE 
J013024A05CATGGGCCTANONE 
J013065N03CATGGGCCTANONE 
J013065N03CATGGGCCTANONE 
J023111A21CATGGGCCTANONE 
J023111A21CATGGGCCTANONE 
J065035F10CATGGGCCTANONE 
J065035F10CATGGGCCTANONE 
J065083H01CATGGGCCTANONE 
J065083H01CATGGGCCTANONE 
J065159E03CATGGGCCTANONE 
J065159E03CATGGGCCTANONE 
J065186A03CATGGGCCTANONE 
J065186A03CATGGGCCTANONE 
J075032B02CATGGGCCTANONE 
J075032B02CATGGGCCTANONE 
J075038L14CATGGGCCTANONE 
J075038L14CATGGGCCTANONE 
J075047N21CATGGGCCTANONE 
J075047N21CATGGGCCTANONE 
J075076H05CATGGGCCTANONE 
J075076H05CATGGGCCTANONE 
J075110C08CATGGGCCTANONE 
J075110C08CATGGGCCTANONE 
J090096K17CATGGGCCTANONE 
J090096K17CATGGGCCTANONE 
Os08g0463500AK058457TAGGCCCAAGZinc finger, C2H2-type domain containing protein. 
Os08g0469500AK109599TAGGCCCAAGConserved hypothetical protein. 
AK109599TAGGCCCATCAConserved hypothetical protein. 
Os08g0492100AK060178AGTGGGCCTANONE 
AK071053AGTGGGCCTAParaneoplastic encephalomyelitis antigen family protein. 
AK100101AGTGGGCCTANONE 
J023004I20AGTGGGCCTANONE 
J023067D13AGTGGGCCTANONE 
J033028G05AGTGGGCCTANONE 
J033060L15AGTGGGCCTANONE 
J033103N12AGTGGGCCTANONE 
J033125B19AGTGGGCCTANONE 
J065132A12AGTGGGCCTANONE 
J065161F02AGTGGGCCTANONE 
J065162L05AGTGGGCCTANONE 
J090093I18AGTGGGCCTANONE 
J100061I05AGTGGGCCTANONE 
J100081G13AGTGGGCCTANONE 
Os08g0499200AK120828TAGGCCCAAGSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2. 
Os08g0526500016-063-D04CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
AK073431CCAGCCCAGTTAGGCCCAAGCCCATTASimilar to SOX-1 protein. 
J033042D10CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
J065019E02CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
Os08g0530200009-166-A09AAATGGGCCTANONE 
AK062052AAATGGGCCTANONE 
AK120448AAATGGGCCTASimilar to 60S ribosomal protein L17. 
J013100M19AAATGGGCCTANONE 
J023045K22AAATGGGCCTANONE 
J033046D13AAATGGGCCTANONE 
J033066N01AAATGGGCCTANONE 
J033143N05AAATGGGCCTANONE 
J053070P13AAATGGGCCTANONE 
J065011C18AAATGGGCCTANONE 
J065013C23AAATGGGCCTANONE 
J065016B09AAATGGGCCTANONE 
J065016C21AAATGGGCCTANONE 
J065023K18AAATGGGCCTANONE 
J065028F12AAATGGGCCTANONE 
J065030L02AAATGGGCCTANONE 
J065042H15AAATGGGCCTANONE 
J065078H02AAATGGGCCTANONE 
J065092D07AAATGGGCCTANONE 
J065092E01AAATGGGCCTANONE 
J065104M21AAATGGGCCTANONE 
J065119P21AAATGGGCCTANONE 
J065124B15AAATGGGCCTANONE 
J065146H09AAATGGGCCTANONE 
J065149L09AAATGGGCCTANONE 
J065156A09AAATGGGCCTANONE 
J065157H23AAATGGGCCTANONE 
J065165L14AAATGGGCCTANONE 
J065165M18AAATGGGCCTANONE 
J065172O03AAATGGGCCTANONE 
J065192M18AAATGGGCCTANONE 
J065198D21AAATGGGCCTANONE 
J065200D05AAATGGGCCTANONE 
J065202B20AAATGGGCCTANONE 
J065212P11AAATGGGCCTANONE 
J065215E08AAATGGGCCTANONE 
J065217P19AAATGGGCCTANONE 
J075005I19AAATGGGCCTANONE 
J075134J06AAATGGGCCTANONE 
J075162G12AAATGGGCCTANONE 
J075178H07AAATGGGCCTANONE 
J075186K01AAATGGGCCTANONE 
J080315I17AAATGGGCCTANONE 
J080318P19AAATGGGCCTANONE 
J090004H16AAATGGGCCTANONE 
J090020A16AAATGGGCCTANONE 
J090047J12AAATGGGCCTANONE 
J090080E07AAATGGGCCTANONE 
J090090H23AAATGGGCCTANONE 
J100021G24AAATGGGCCTANONE 
J100037L04AAATGGGCCTANONE 
J100043L09AAATGGGCCTANONE 
J100044A10AAATGGGCCTANONE 
Os08g0535600AK121683GTTGGGCCTAZinc finger, Tim10/DDP-type family protein. 
J065077E05GTTGGGCCTANONE 
J075088M24GTTGGGCCTANONE 
J075140B03GTTGGGCCTANONE 
J090014B14GTTGGGCCTANONE 
Os08g0540500AK106511TAGGCCCAAATSAM (and some other nucleotide) binding motif domain containing protein. 
AK106511TGATGGGCCTASAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0542100AK058490TAATGGGCCTARibosomal protein L7, eukaryotic form family protein. 
AK101416TAATGGGCCTANONE 
J033037N08TAATGGGCCTANONE 
J033086B16TAATGGGCCTANONE 
J043036J02TAATGGGCCTANONE 
J065137E02TAATGGGCCTANONE 
J090015L07TAATGGGCCTANONE 
J100036D02TAATGGGCCTANONE 
Os08g0557000AK059917TAGGCCCATAANONE 
AK100496TAGGCCCATAASimilar to Protein-L-isoaspartate O-methyltransferase. 
Os08g0557400006-024-C02TAGGCCCAACCNONE 
AK060067TAGGCCCAACCProtein tyrosine phosphatase-like protein. 
AY224424TAGGCCCAACCNONE 
Os09g0313500AK065687TAGGCCCAGADisease resistance protein family protein. 
J013039H12TAGGCCCAGANONE 
J090060B10TAGGCCCAGANONE 
Os09g0329800AK069775TTTTGGGCCTAACAGCCCATATConserved hypothetical protein. 
Os09g0329900Os09g0329900TTTTGGGCCTAACAGCCCATATNONE 
Os09g0363700AK103667ATATGGGCCTAConserved hypothetical protein. 
J075001L14ATATGGGCCTANONE 
J075049M23ATATGGGCCTANONE 
J075051I04ATATGGGCCTANONE 
J075073L04ATATGGGCCTANONE 
J075077E03ATATGGGCCTANONE 
J075083J11ATATGGGCCTANONE 
J075094J22ATATGGGCCTANONE 
J075112E08ATATGGGCCTANONE 
J075137J23ATATGGGCCTANONE 
J075192E02ATATGGGCCTANONE 
J100039K04ATATGGGCCTANONE 
Os09g0370300AK108199TAGGCCCATCASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0395400AK109221TAGGCCCATAAGGATGGGCCGTAConserved hypothetical protein. 
J075009I06TAGGCCCATAAGGATGGGCCGTANONE 
Os09g0401200AK063980CTGGCCCAAATAGGCCCAAGGCCCATTTSimilar to HSP associated protein like. 
Os09g0412900014-003-F10GGGCCGGGCCCGTTAGGCCCAACANONE 
AK102254GGGCCGGGCCCGTTAGGCCCAACAProtein prenyltransferase domain containing protein. 
AK102867GGGCCGGGCCCGTTAGGCCCAACANONE 
J033088H22GGGCCGGGCCCGTTAGGCCCAACANONE 
Os09g0463700016-008-D06TAGGCCCATACNONE 
AK060708TAGGCCCATACSimilar to AHM1. 
J090013G05TAGGCCCATACNONE 
Os09g0478400AK107794AAATGGGCCTAConserved hypothetical protein. 
AK107794GTATGGGCCTAConserved hypothetical protein. 
J065082F04AAATGGGCCTANONE 
J065082F04GTATGGGCCTANONE 
Os09g0493700015-091-G11TAGGCCCACGCNONE 
AK068501TAGGCCCACGCSimilar to CUC2. 
AK099237TAGGCCCACGCNONE 
J013155B08TAGGCCCACGCNONE 
J023006E01TAGGCCCACGCNONE 
J023060K23TAGGCCCACGCNONE 
J023100B11TAGGCCCACGCNONE 
J033026L19TAGGCCCACGCNONE 
J033129J12TAGGCCCACGCNONE 
J033149K09TAGGCCCACGCNONE 
J065045I06TAGGCCCACGCNONE 
J065061A10TAGGCCCACGCNONE 
J065101H05TAGGCCCACGCNONE 
J065135A03TAGGCCCACGCNONE 
J065169C16TAGGCCCACGCNONE 
J100047C11TAGGCCCACGCNONE 
J100047K07TAGGCCCACGCNONE 
Os09g0511700AK101420TAGGCCCACGGCCCACCCSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19TAGGCCCACGGCCCACCCNONE 
J013036D23TAGGCCCACGGCCCACCCNONE 
J013037F22TAGGCCCACGGCCCACCCNONE 
J013111M23TAGGCCCACGGCCCACCCNONE 
J023109F14TAGGCCCACGGCCCACCCNONE 
J023119H17TAGGCCCACGGCCCACCCNONE 
J023133H23TAGGCCCACGGCCCACCCNONE 
J033032G17TAGGCCCACGGCCCACCCNONE 
J033038B10TAGGCCCACGGCCCACCCNONE 
J033071M16TAGGCCCACGGCCCACCCNONE 
J033096G04TAGGCCCACGGCCCACCCNONE 
J033109D06TAGGCCCACGGCCCACCCNONE 
J043016E22TAGGCCCACGGCCCACCCNONE 
J043022O09TAGGCCCACGGCCCACCCNONE 
J100023N11TAGGCCCACGGCCCACCCNONE 
J100046I21TAGGCCCACGGCCCACCCNONE 
Os09g0542200006-092-A09TAGGCCCATTNONE 
AK064887TAGGCCCATTThioredoxin fold domain containing protein. 
AK104804TAGGCCCATTNONE 
J013000K12TAGGCCCATTNONE 
J013170A19TAGGCCCATTNONE 
J033103B02TAGGCCCATTNONE 
J065196J20TAGGCCCATTNONE 
J075037H17TAGGCCCATTNONE 
J075069H14TAGGCCCATTNONE 
J075071C16TAGGCCCATTNONE 
J075095N02TAGGCCCATTNONE 
J075136N03TAGGCCCATTNONE 
J075192L16TAGGCCCATTNONE 
J100057N23TAGGCCCATTNONE 
J100060O07TAGGCCCATTNONE 
J100062F10TAGGCCCATTNONE 
J100077I08TAGGCCCATTNONE 
J100086B07TAGGCCCATTNONE 
J100088L14TAGGCCCATTNONE 
Os11g0107500005-005-H05TATGGGCCTANONE 
009-118-E10TATGGGCCTANONE 
009-180-A04TATGGGCCTANONE 
AK121033TATGGGCCTAMacrophage migration inhibitory factor family protein. 
J013070C02TATGGGCCTANONE 
J013132P08TATGGGCCTANONE 
J023050K24TATGGGCCTANONE 
J053064N21TATGGGCCTANONE 
J053070L15TATGGGCCTANONE 
J053099E18TATGGGCCTANONE 
J065032A09TATGGGCCTANONE 
J065035L22TATGGGCCTANONE 
J065134D23TATGGGCCTANONE 
J065161L19TATGGGCCTANONE 
J065210K04TATGGGCCTANONE 
J075150A22TATGGGCCTANONE 
J090019C11TATGGGCCTANONE 
J090057N06TATGGGCCTANONE 
J090084D03TATGGGCCTANONE 
J090098L16TATGGGCCTANONE 
J100021H05TATGGGCCTANONE 
J100021N11TATGGGCCTANONE 
J100052B12TATGGGCCTANONE 
J100083N17TATGGGCCTANONE 
J100089D22TATGGGCCTANONE 
Os11g0130500J065119D16GAGGCCCATCTAGGCCCATANONE 
J065169E14GAGGCCCATCTAGGCCCATACyclin-like F-box domain containing protein. 
Os11g0130600AK066342TTATGGGCCTAGATGGGCCTCConserved hypothetical protein. 
J065192M10TTATGGGCCTAGATGGGCCTCNONE 
Os11g0148600AK100066AAATGGGCCTAConserved hypothetical protein. 
AK102442AAATGGGCCTANONE 
J065167F17AAATGGGCCTANONE 
Os11g0153700AK058576TAGGCCCATATGTGGGCCCAACASimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0156200AK100124AAATGGGCCTAPeptidase S28 family protein. 
Os11g0182400016-077-B04TGATGGGCCTANONE 
AK112089TGATGGGCCTACyclin-like F-box domain containing protein. 
Os11g0202000AK063427GTATGGGCCTAGGCCCATCCACyclin-like F-box domain containing protein. 
AK122020GTATGGGCCTAGGCCCATCCANONE 
J033111N03GTATGGGCCTAGGCCCATCCANONE 
Os11g0216900AK060326GGTGGGCCTASimilar to IDI2. 
AK060549GGTGGGCCTANONE 
AK100869GGTGGGCCTANONE 
Os11g0244200AK107883TGTTGGGCCTASimilar to Pisum sativum 17.9 kDa heat shock protein (hsp17.9) (Fragment). 
Os11g0286800AK072702AATTGGGCCTATerpene synthase family protein. 
AK100763AATTGGGCCTANONE 
AK107355AATTGGGCCTANONE 
J013026O22AATTGGGCCTANONE 
J013065A14AATTGGGCCTANONE 
J013129G22AATTGGGCCTANONE 
J023119J04AATTGGGCCTANONE 
Os11g0549665006-027-H01GCCACACGGCCCAAGTAGGCCCAGGNONE 
006-083-C01GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK072644GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK101587GCCACACGGCCCAAGTAGGCCCAGGConserved hypothetical protein. 
AK106162GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013051C18GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013067E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013169N16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023049M16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023050I19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063H21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063K01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023108O17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023115H08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023117O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023129J01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023133I23GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023143P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033045J08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033050I15GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033051A04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033060C24GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033069L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033103H04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033112L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033118O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033126B10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033133P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033144H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033145H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J043029L04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075066N17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075150D02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075158D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090009I10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090048D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085H13GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100029L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100041M06GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100045B04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100077C04GCCACACGGCCCAAGTAGGCCCAGGNONE 
Os11g0602600006-046-H02TGTGGGCCTANONE 
006-056-H08TGTGGGCCTANONE 
009-116-D05TGTGGGCCTANONE 
AK072671TGTGGGCCTASimilar to 40S ribosomal protein S9. 
AK104660TGTGGGCCTANONE 
J023134P20TGTGGGCCTANONE 
J023141O13TGTGGGCCTANONE 
J033066I15TGTGGGCCTANONE 
J033076A08TGTGGGCCTANONE 
J033150J23TGTGGGCCTANONE 
J065114P19TGTGGGCCTANONE 
J065176B01TGTGGGCCTANONE 
J065207H21TGTGGGCCTANONE 
J080301L21TGTGGGCCTANONE 
J080308A08TGTGGGCCTANONE 
J080318K23TGTGGGCCTANONE 
J080319F17TGTGGGCCTANONE 
J080319I10TGTGGGCCTANONE 
J090028C08TGTGGGCCTANONE 
J090051I24TGTGGGCCTANONE 
J090053L21TGTGGGCCTANONE 
J090069C20TGTGGGCCTANONE 
J100017G08TGTGGGCCTANONE 
J100042B06TGTGGGCCTANONE 
J100045G24TGTGGGCCTANONE 
J100050J19TGTGGGCCTANONE 
J100052D23TGTGGGCCTANONE 
J100053M03TGTGGGCCTANONE 
J100056D08TGTGGGCCTANONE 
J100066B19TGTGGGCCTANONE 
J100071N23TGTGGGCCTANONE 
J100074H01TGTGGGCCTANONE 
J100074H19TGTGGGCCTANONE 
J100077C06TGTGGGCCTANONE 
Os12g0114000009-177-C09GTATGGGCCTANONE 
AK063119GTATGGGCCTAHypothetical protein. 
J065113E12GTATGGGCCTANONE 
Os12g0118900009-090-F10AATGGGCCTANONE 
AK062692AATGGGCCTACytochrome P450 family protein. 
Os12g0244100AK069937TGATGGGCCTANONE 
Os12g0503200014-087-C11TAGGCCCAATTNONE 
AK105377TAGGCCCAATTNONE 
Os12g0506500AK119779TAGGCCCAGAGalactokinase/homoserine kinase family protein. 
Os12g0507600009-155-B05AGTGGGCCTANONE 
AK070613AGTGGGCCTAConserved hypothetical protein. 
J023063G03AGTGGGCCTANONE 
Os12g0533600J065106H15AACTGGGCCTAConserved hypothetical protein. 
J065194D13AACTGGGCCTANONE 
Os12g0554400AK072345TAGGCCCAGATetratricopeptide-like helical domain containing protein. 
Os12g0574800AK073004ATTTGGGCCTAATTGGGCCGTGNONE 
AK102465ATTTGGGCCTAATTGGGCCGTGBromodomain transcription factor containing protein. 
AK121687ATTTGGGCCTAATTGGGCCGTGNONE 
J033070O18ATTTGGGCCTAATTGGGCCGTGNONE 
J075097O17ATTTGGGCCTAATTGGGCCGTGNONE 
J080069F02ATTTGGGCCTAATTGGGCCGTGNONE 
Os12g0584100006-083-C12TAGGCCCAGCCCACCCNONE 
006-104-C06TAGGCCCAGCCCACCCNONE 
AK066829TAGGCCCAGCCCACCCNONE 
AK071424TAGGCCCAGCCCACCCConserved hypothetical protein. 
J013075O22TAGGCCCAGCCCACCCNONE 
J023091J20TAGGCCCAGCCCACCCNONE 
J065167K15TAGGCCCAGCCCACCCNONE 
J065213C02TAGGCCCAGCCCACCCNONE 
J075001B17TAGGCCCAGCCCACCCNONE 
J075165D13TAGGCCCAGCCCACCCNONE 
J075195C24TAGGCCCAGCCCACCCNONE 
Os12g0588900AK069966AAATGGGCCTAConserved hypothetical protein. 
AK069966GACGGCCCAGCTAGGCCCAATTConserved hypothetical protein. 
J023038A10AAATGGGCCTANONE 
J023038A10GACGGCCCAGCTAGGCCCAATTNONE 
J065061J23AAATGGGCCTANONE 
J065061J23GACGGCCCAGCTAGGCCCAATTNONE 
J065176O08AAATGGGCCTANONE 
J065176O08GACGGCCCAGCTAGGCCCAATTNONE 
J075143K13AAATGGGCCTANONE 
J075143K13GACGGCCCAGCTAGGCCCAATTNONE 
Os12g0595800015-057-B08TAGGCCCATGGNONE 
AK121185TAGGCCCATGGProtein kinase-like domain containing protein. 
J065039H15TAGGCCCATGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.