version

Summary of OsREG657 (All List)

OrganismOryza sativa  
IDOsREG657  
SequenceTCAGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count886  

Entry Sequences (886 entries)

LocusGene modelSequenceDescription
Os01g0139600AK073130TCAGCCCATACSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0147200016-005-F02TCAGCCCACCANONE 
AK106463TCAGCCCACCANONE 
AK121921TCAGCCCACCAIWS1, C-terminal family protein. 
J033098O16TCAGCCCACCANONE 
J033106E16TCAGCCCACCANONE 
J043026D12TCAGCCCACCANONE 
J065070B04TCAGCCCACCANONE 
J065162L03TCAGCCCACCANONE 
J065166F01TCAGCCCACCANONE 
J075030A13TCAGCCCACCANONE 
J075093O12TCAGCCCACCANONE 
J075106K15TCAGCCCACCANONE 
J075107F20TCAGCCCACCANONE 
J090031F21TCAGCCCACCANONE 
J090079E17TCAGCCCACCANONE 
Os01g0158900AK066765TCAGCCCACACZinc finger, RING-type domain containing protein. 
Os01g0191800AK061360TCAGCCCANONE 
Os01g0206700J023047B12TTTGGGCTGANONE 
Os01g0295900J065076G19TCAGCCCAAACNONE 
Os01g0346400J100032G11TCAGCCCACCCConserved hypothetical protein. 
Os01g0348600AK062168TCAGCCCATTTNONE 
AK099063TCAGCCCATTTNONE 
J013157A11TCAGCCCATTTNONE 
Os01g0555100AK111255TCAGCCCAAAASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os01g0590300014-089-E04CCATGGGCTGANONE 
AK063740CCATGGGCTGAConserved hypothetical protein. 
Os01g0633000006-075-A01TCAGCCCAAACNONE 
009-064-A11TCAGCCCAAACNONE 
009-153-F07TCAGCCCAAACNONE 
AK062051TCAGCCCAAACSimilar to 50S ribosomal protein L31. 
J013073B08TCAGCCCAAACNONE 
J065006K19TCAGCCCAAACNONE 
J065053P08TCAGCCCAAACNONE 
J065057D08TCAGCCCAAACNONE 
J065086P07TCAGCCCAAACNONE 
J065095C14TCAGCCCAAACNONE 
J065116B05TCAGCCCAAACNONE 
J065164L20TCAGCCCAAACNONE 
J065185K19TCAGCCCAAACNONE 
J065191E21TCAGCCCAAACNONE 
J065199P21TCAGCCCAAACNONE 
J065216M12TCAGCCCAAACNONE 
J075002M09TCAGCCCAAACNONE 
J075016N10TCAGCCCAAACNONE 
J075041K05TCAGCCCAAACNONE 
J075094E04TCAGCCCAAACNONE 
J075154O04TCAGCCCAAACNONE 
J075176D22TCAGCCCAAACNONE 
J075186M09TCAGCCCAAACNONE 
J075191H20TCAGCCCAAACNONE 
Os01g0667900013-097-A02TCAGCCCATCANONE 
014-011-C01TCAGCCCATCANONE 
AK105335TCAGCCCATCAGlutaredoxin-like, plant II family protein. 
J065156F10TCAGCCCATCANONE 
J065163D22TCAGCCCATCANONE 
J065197J04TCAGCCCATCANONE 
J075122C02TCAGCCCATCANONE 
J100047L16TCAGCCCATCANONE 
Os01g0721900AK059581TCAGCCCATGGNONE 
J065191A18TCAGCCCATGGNONE 
J100064H01TCAGCCCATGGNONE 
J100075M23TCAGCCCATGGNONE 
J100090A11TCAGCCCATGGNONE 
Os01g0730500AK100064TCAGCCCAGSimilar to Ferredoxin (Bacterial type ferredoxin family). 
Os01g0742000009-105-F08ATTGGGCTGANONE 
AK062779ATTGGGCTGAtRNA/rRNA methyltransferase, SpoU domain containing protein. 
Os01g0765000AK101905TCAGCCCAGCCCAACSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0832200004-009-E08TCAGCCCANONE 
009-103-F06TCAGCCCANONE 
AK060017TCAGCCCANONE 
AK068980TCAGCCCAConserved hypothetical protein. 
J023085I24TCAGCCCANONE 
J090016I03TCAGCCCANONE 
J090078K06TCAGCCCANONE 
Os01g0834700AK101559TCAGCCCACGAZinc finger, CCCH-type domain containing protein. 
AK106074TCAGCCCACGANONE 
Os01g0848200AK069425GCTGGGCTGASimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230GCTGGGCTGANONE 
Os01g0848300AK120668TCAGCCCAACAProtein prenyltransferase domain containing protein. 
Os01g0850400AJ575220TGGATGGGCTGANONE 
AK108582TGGATGGGCTGASimilar to MYBY1 protein (Fragment). 
Os01g0856500AK103981GGATGGGCTGANONE 
Os01g0861000AK058707TCAGCCCAGConserved hypothetical protein. 
Os01g0868300AB004461TCAGCCCAATSimilar to DNA polymerase alpha catalytic subunit (EC 2.7.7.7). 
Os01g0872100AK099405TCAGCCCATTATGF-beta receptor, type I/II extracellular region family protein. 
J013001K17TCAGCCCATTANONE 
Os01g0908400009-140-E01TCAGCCCANONE 
AK062957TCAGCCCAConserved hypothetical protein. 
AK099301TCAGCCCANONE 
J065123M13TCAGCCCANONE 
J075020O14TCAGCCCANONE 
J075136L21TCAGCCCANONE 
Os01g0913800011-060-B02AGGTGGGCTGANONE 
016-088-H02AGGTGGGCTGAProtein prenyltransferase domain containing protein. 
Os01g0934500AK073211TCAGCCCAGCConserved hypothetical protein. 
Os01g0946200AK071060GGCTGGGCTCAGCCCACANo apical meristem (NAM) protein domain containing protein. 
J023080K20GGCTGGGCTCAGCCCACANONE 
Os02g0120000AK067383GTGGTGGGCCTATTTGGGCTGAProtein prenyltransferase domain containing protein. 
AK101590GTGGTGGGCCTATTTGGGCTGANONE 
J013100B15GTGGTGGGCCTATTTGGGCTGANONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0130300011-005-D07CTGGGCTGANONE 
011-041-B06CTGGGCTGANONE 
015-099-D11CTGGGCTGANONE 
016-049-D06CTGGGCTGANONE 
AK102708CTGGGCTGAZinc finger, RING-type domain containing protein. 
Os02g0135600AK069843TGCGGCCCAATTCAGCCCATGTConserved hypothetical protein. 
J023034H09TGCGGCCCAATTCAGCCCATGTNONE 
J033090D08TGCGGCCCAATTCAGCCCATGTNONE 
J100025N07TGCGGCCCAATTCAGCCCATGTNONE 
J100075G18TGCGGCCCAATTCAGCCCATGTNONE 
Os02g0135700AK100570ACATGGGCTGAATTGGGCCGCADNA polymerase V family protein. 
Os02g0220600AK103901AAGGCCCATTTCAGCCCAACANONE 
J013058O03AAGGCCCATTTCAGCCCAACANONE 
J013124E21AAGGCCCATTTCAGCCCAACANONE 
J023023L03AAGGCCCATTTCAGCCCAACANONE 
J023023L21AAGGCCCATTTCAGCCCAACANONE 
J023061N01AAGGCCCATTTCAGCCCAACANONE 
J023065O09AAGGCCCATTTCAGCCCAACANONE 
J023106J17AAGGCCCATTTCAGCCCAACANONE 
J023119N08AAGGCCCATTTCAGCCCAACANONE 
J033058A19AAGGCCCATTTCAGCCCAACANONE 
J033098O13AAGGCCCATTTCAGCCCAACANONE 
J033100M18AAGGCCCATTTCAGCCCAACANONE 
J033125A21AAGGCCCATTTCAGCCCAACANONE 
J033148C12AAGGCCCATTTCAGCCCAACANONE 
J043017F03AAGGCCCATTTCAGCCCAACANONE 
J043032J02AAGGCCCATTTCAGCCCAACANONE 
J053047N10AAGGCCCATTTCAGCCCAACANONE 
J053089P04AAGGCCCATTTCAGCCCAACANONE 
J065051K09AAGGCCCATTTCAGCCCAACANONE 
J065064H24AAGGCCCATTTCAGCCCAACANONE 
J090001L06AAGGCCCATTTCAGCCCAACANONE 
J090017C24AAGGCCCATTTCAGCCCAACANONE 
J090058G15AAGGCCCATTTCAGCCCAACANONE 
J090058H23AAGGCCCATTTCAGCCCAACANONE 
J090061G20AAGGCCCATTTCAGCCCAACANONE 
J090069N23AAGGCCCATTTCAGCCCAACANONE 
J090071A08AAGGCCCATTTCAGCCCAACANONE 
J090074A08AAGGCCCATTTCAGCCCAACANONE 
J090077B15AAGGCCCATTTCAGCCCAACANONE 
J090081K06AAGGCCCATTTCAGCCCAACANONE 
J090083I05AAGGCCCATTTCAGCCCAACANONE 
J090091O22AAGGCCCATTTCAGCCCAACANONE 
J090097L10AAGGCCCATTTCAGCCCAACANONE 
J100026B11AAGGCCCATTTCAGCCCAACANONE 
J100044M01AAGGCCCATTTCAGCCCAACANONE 
J100046F10AAGGCCCATTTCAGCCCAACANONE 
J100051K14AAGGCCCATTTCAGCCCAACANONE 
J100060D22AAGGCCCATTTCAGCCCAACANONE 
J100060H18AAGGCCCATTTCAGCCCAACANONE 
J100070I06AAGGCCCATTTCAGCCCAACANONE 
J100071C04AAGGCCCATTTCAGCCCAACANONE 
J100078M13AAGGCCCATTTCAGCCCAACANONE 
J100080E17AAGGCCCATTTCAGCCCAACANONE 
J100083I09AAGGCCCATTTCAGCCCAACANONE 
Os02g0227100AK066722TCAGCCCACCConserved hypothetical protein. 
Os02g0241100Os02g0241100AGATGGGCTGAProtein kinase-like domain containing protein. 
Os02g0517333AK105573TCAGCCCAAAANONE 
AK111331TCAGCCCAAAAConserved hypothetical protein. 
Os02g0634800003-004-F03TCAGCCCATGANONE 
AK059694TCAGCCCATGAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17TCAGCCCATGANONE 
J053077G20TCAGCCCATGANONE 
J075195F14TCAGCCCATGANONE 
Os02g0634900006-032-G12TCATGGGCTGANONE 
006-033-E09TCATGGGCTGANONE 
006-117-F10TCATGGGCTGANONE 
006-118-E01TCATGGGCTGANONE 
013-056-G08TCATGGGCTGANONE 
AK059769TCATGGGCTGANONE 
AK068583TCATGGGCTGANONE 
AK072855TCATGGGCTGAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210TCATGGGCTGANONE 
J023138P05TCATGGGCTGANONE 
J023143J07TCATGGGCTGANONE 
J033022O09TCATGGGCTGANONE 
J033111L02TCATGGGCTGANONE 
J033135O03TCATGGGCTGANONE 
J065005K19TCATGGGCTGANONE 
J065044C17TCATGGGCTGANONE 
J065116K09TCATGGGCTGANONE 
J065119O21TCATGGGCTGANONE 
J075014L05TCATGGGCTGANONE 
J075109H16TCATGGGCTGANONE 
J075117D04TCATGGGCTGANONE 
Os02g0651500AK066333TCAGCCCATGANONE 
AK121865TCAGCCCATGAHypothetical protein. 
J090038J11TCAGCCCATGANONE 
Os02g0703900AK102115TCAGCCCAGCCCAGCCCAGCCGAGATSimilar to Nodulin-like protein. 
AK121966TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J023109K03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033051G23TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033084H22TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090056B12TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090059L13TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090080M03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
Os02g0754700AK066904TCAGCCCAAGCCCAAGSimilar to Histidyl-tRNA synthetase (EC 6.1.1.21). 
AK099136TCAGCCCAAGCCCAAGNONE 
Os02g0762300AK106684TCAGCCCAAATProtein of unknown function UPF0021 family protein. 
J090060M09TCAGCCCAAATNONE 
J100083E05TCAGCCCAAATNONE 
Os02g0772500AK100349TTATGGGCTGAProtein prenyltransferase domain containing protein. 
J023082M21TTATGGGCTGANONE 
J065047H11TTATGGGCTGANONE 
J065055F20TTATGGGCTGANONE 
J065082I22TTATGGGCTGANONE 
J100074B04TTATGGGCTGANONE 
Os03g0101400AK120679GCTGGGCTGAConserved hypothetical protein. 
J013162J03GCTGGGCTGANONE 
Os03g0121300AK120047TCAGCCCAACTNONE 
Os03g0151500AK109181TCAGCCCATTConserved hypothetical protein. 
Os03g0156600014-033-H04TCAGCCCATTNONE 
014-051-C04TCAGCCCATTNONE 
AK105367TCAGCCCATTSimilar to Farnesylated protein (ATFP6). 
Os03g0168200AK099530TCAGCCCAGATConserved hypothetical protein. 
Os03g0189400AK067720TCAGCCCACGTSimilar to Alcohol dehydrogenase ADH. 
J043012M09TCAGCCCACGTNONE 
J043026L22TCAGCCCACGTNONE 
J075115C06TCAGCCCACGTNONE 
J100056M03TCAGCCCACGTNONE 
J100064I05TCAGCCCACGTNONE 
Os03g0195800AF493792TGTGGGCTGTGGGCTGANONE 
AK103007TGTGGGCTGTGGGCTGASimilar to Sulfate transporter (Fragment). 
Os03g0197000AK071163TCAGCCCACAConserved hypothetical protein. 
J023079A07TCAGCCCACANONE 
Os03g0241600004-009-G06TCAGCCCAGNONE 
AK060019TCAGCCCAGProtein kinase domain containing protein. 
J013043F06TCAGCCCAGNONE 
J013169B22TCAGCCCAGNONE 
J065048F13TCAGCCCAGNONE 
J065082G24TCAGCCCAGNONE 
J065195I20TCAGCCCAGNONE 
J100041A19TCAGCCCAGNONE 
J100043G20TCAGCCCAGNONE 
J100069E18TCAGCCCAGNONE 
J100084N06TCAGCCCAGNONE 
Os03g0256400AK073854TGTGGGCTGAATTGGGCCTTSimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0260100AK066143TCAGCCCAACAConserved hypothetical protein. 
Os03g0261500AK061995ATCTGGGCTGANONE 
J013044K20ATCTGGGCTGANONE 
J033113A11ATCTGGGCTGANONE 
J100032O18ATCTGGGCTGANONE 
J100037K21ATCTGGGCTGANONE 
Os03g0263500006-112-E09GTTTGGGCTGANONE 
009-122-C01GTTTGGGCTGANONE 
AK106060GTTTGGGCTGASimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0282900006-088-H05ACATGGGCTGATGGGCCGTGNONE 
AK061166ACATGGGCTGATGGGCCGTGNONE 
AK102161ACATGGGCTGATGGGCCGTGConserved hypothetical protein. 
AK104514ACATGGGCTGATGGGCCGTGNONE 
Os03g0299900AK069075TCAGCCCACGGSimilar to Plastid aminotransferase (Fragment). 
AY338235TCAGCCCACGGNONE 
J053077F07TCAGCCCACGGNONE 
Os03g0313600AK067474ATTGGGCTGGGCTGASimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
Os03g0336000AK100067TCAGCCCATCTProtein prenyltransferase domain containing protein. 
J065161K02TCAGCCCATCTNONE 
J065162C21TCAGCCCATCTNONE 
Os03g0338600AK066604TCAGCCCATTAtRNA pseudouridine synthase family protein. 
Os03g0343900009-077-C03TCAGCCCATATNONE 
AK105813TCAGCCCATATPhotosystem II protein PsbX family protein. 
J100059N03TCAGCCCATATNONE 
J100079C20TCAGCCCATATNONE 
Os03g0383100AK107106TCAGCCCAAAAConserved hypothetical protein. 
Os03g0418700AK099879TCAGCCCACANONE 
AK101797TCAGCCCACAConserved hypothetical protein. 
Os03g0639700AK099587AACTGGGCTGASimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0640800AF139210AATGGGCTGANONE 
J023022K02AATGGGCTGANONE 
J023030J24AATGGGCTGANONE 
J023062H06AATGGGCTGANONE 
J033023I12AATGGGCTGANONE 
J033023O07AATGGGCTGANONE 
J033040B18AATGGGCTGANONE 
J033041D08AATGGGCTGANONE 
J033046C22AATGGGCTGANONE 
J033052G04AATGGGCTGANONE 
J033055N17AATGGGCTGANONE 
J033068L18AATGGGCTGANONE 
J033070G21AATGGGCTGANONE 
J033071E05AATGGGCTGANONE 
J033071P14AATGGGCTGANONE 
J033072G03AATGGGCTGANONE 
J033073P10AATGGGCTGANONE 
J033076F02AATGGGCTGANONE 
J033080E23AATGGGCTGANONE 
J033089G17AATGGGCTGANONE 
J033095O20AATGGGCTGANONE 
J033103M02AATGGGCTGANONE 
J033108C06AATGGGCTGANONE 
J033109O14AATGGGCTGANONE 
J033114C01AATGGGCTGANONE 
J033121K12AATGGGCTGANONE 
J033123G23AATGGGCTGANONE 
J033124M18AATGGGCTGANONE 
J033132J15AATGGGCTGANONE 
J033140L20AATGGGCTGANONE 
J065165E15AATGGGCTGANONE 
J065217L02AATGGGCTGANONE 
J090040H05AATGGGCTGANONE 
J090073L17AATGGGCTGANONE 
J090091D11AATGGGCTGANONE 
Os03g0647800003-103-H03TCAGCCCAACCNONE 
006-104-G09TCAGCCCAACCNONE 
AK070243TCAGCCCAACCConserved hypothetical protein. 
J100056F22TCAGCCCAACCNONE 
Os03g0687800AK106820TCAGCCCAConserved hypothetical protein. 
Os03g0699200005-016-G07TCAGCCCAACCCAAGGCCCNONE 
AK066652TCAGCCCAACCCAAGGCCCPescadillo, N-terminal domain containing protein. 
AK099383TCAGCCCAACCCAAGGCCCNONE 
J013069A12TCAGCCCAACCCAAGGCCCNONE 
J033085M11TCAGCCCAACCCAAGGCCCNONE 
J033111P09TCAGCCCAACCCAAGGCCCNONE 
J033128H17TCAGCCCAACCCAAGGCCCNONE 
Os03g0712600015-008-G03TCAGCCCAAAANONE 
AK103705TCAGCCCAAAAHypothetical protein. 
J033136N14TCAGCCCAAAANONE 
Os03g0740700011-093-H12AATTGGGCTGANONE 
AK102723AATTGGGCTGAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19AATTGGGCTGANONE 
J013126N16AATTGGGCTGANONE 
J033105J16AATTGGGCTGANONE 
J090059D19AATTGGGCTGANONE 
Os03g0743200J065049G14TCAGCCCATGANONE 
J065158O18TCAGCCCATGANONE 
Os03g0746000AK073682GTGGCCCATTGGGCTGAConserved hypothetical protein. 
AK111472GTGGCCCATTGGGCTGANONE 
J090083F05GTGGCCCATTGGGCTGANONE 
Os03g0803800012-043-D10TCAGCCCAAGNONE 
AK063484TCAGCCCAAGConserved hypothetical protein. 
Os03g0821700AK102999TGGGCTGAProtein prenyltransferase domain containing protein. 
J033116F23TGGGCTGANONE 
Os03g0840200AK067797TCAGCCCATCATolB, C-terminal domain containing protein. 
AK100408TCAGCCCATCANONE 
J075027I23TCAGCCCATCANONE 
J075049N10TCAGCCCATCANONE 
J100058E07TCAGCCCATCANONE 
Os03g0851900AK102145TCAGCCCATTAAFG1-like ATPase family protein. 
J033086B08TCAGCCCATTANONE 
Os04g0117200AK107523TCAGCCCAAASpectrin repeat containing protein. 
Os04g0197200AK073556TCAGCCCACAProtein kinase-like domain containing protein. 
Os04g0270100AK063713TCATGGGCTGANONE 
AK107968TCATGGGCTGANONE 
Os04g0329500015-081-E12TCAGCCCAACANONE 
AK064343TCAGCCCAACAProtein of unknown function DUF295 family protein. 
AK073994TCAGCCCAACANONE 
J033072H16TCAGCCCAACANONE 
Os04g0418000006-025-C05TCAGCCCACACNONE 
006-025-D11TCAGCCCACACNONE 
006-045-F02TCAGCCCACACNONE 
006-060-B04TCAGCCCACACNONE 
006-063-E03TCAGCCCACACNONE 
006-070-G08TCAGCCCACACNONE 
006-072-H05TCAGCCCACACNONE 
AK061030TCAGCCCACACNONE 
AK099124TCAGCCCACACNONE 
AK106155TCAGCCCACACConserved hypothetical protein. 
AK119714TCAGCCCACACNONE 
J023039I07TCAGCCCACACNONE 
J065025N03TCAGCCCACACNONE 
Os04g0485400AK109290TCAGCCCAAGSimilar to Nucleotide-binding protein. 
AK120649TCAGCCCAAGNONE 
J013156K04TCAGCCCAAGNONE 
J043026O10TCAGCCCAAGNONE 
Os04g0542900AK068610TCAGCCCAACConserved hypothetical protein. 
Os04g0555900009-154-G03ATATGGGCTGANONE 
AK063168ATATGGGCTGAPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11ATATGGGCTGANONE 
Os04g0577000AK073711ACATGGGCTGAUbiquitin fusion degradation protein UFD1 family protein. 
AK119957ACATGGGCTGANONE 
J013127H04ACATGGGCTGANONE 
J033035G06ACATGGGCTGANONE 
J033061G23ACATGGGCTGANONE 
J033127L07ACATGGGCTGANONE 
J065015F17ACATGGGCTGANONE 
J065062G08ACATGGGCTGANONE 
J065132M07ACATGGGCTGANONE 
J065155C12ACATGGGCTGANONE 
J075055I08ACATGGGCTGANONE 
J075140D07ACATGGGCTGANONE 
J090055B21ACATGGGCTGANONE 
J100031D23ACATGGGCTGANONE 
Os04g0638800AK070319TTTGGGCTGAProtein of unknown function DUF617, plant family protein. 
AK071753TTTGGGCTGANONE 
Os04g0675400AK068186TCAGCCCAGSimilar to Chaperone protein dnaJ. 
J013029J20TCAGCCCAGNONE 
J013072I16TCAGCCCAGNONE 
J013134H18TCAGCCCAGNONE 
J013159H06TCAGCCCAGNONE 
Os04g0676100Os04g0676100TGGGCTGASimilar to Thioredoxin X, chloroplast precursor. 
Os04g0688500013-068-C11TCAGCCCATATNONE 
013-082-D10TCAGCCCATATNONE 
AK067667TCAGCCCATATPeroxidase (EC 1.11.1.7). 
J013044F01TCAGCCCATATNONE 
J013068J12TCAGCCCATATNONE 
J013075A19TCAGCCCATATNONE 
J013118D03TCAGCCCATATNONE 
J013126C19TCAGCCCATATNONE 
J013162J15TCAGCCCATATNONE 
J075110L20TCAGCCCATATNONE 
J075156K24TCAGCCCATATNONE 
Os05g0103100AK103317AAATGGGCTGATGGGCTranslocon-associated beta family protein. 
J033125H15AAATGGGCTGATGGGCNONE 
J065021L01AAATGGGCTGATGGGCNONE 
J065029M01AAATGGGCTGATGGGCNONE 
J065089F17AAATGGGCTGATGGGCNONE 
J065112N04AAATGGGCTGATGGGCNONE 
J065163L03AAATGGGCTGATGGGCNONE 
J065175B04AAATGGGCTGATGGGCNONE 
J065192E02AAATGGGCTGATGGGCNONE 
J075046C20AAATGGGCTGATGGGCNONE 
J075192A01AAATGGGCTGATGGGCNONE 
J100018H13AAATGGGCTGATGGGCNONE 
J100067K20AAATGGGCTGATGGGCNONE 
J100080N03AAATGGGCTGATGGGCNONE 
Os05g0111000AK073598TCAGCCCAATTSimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0123400AK069521TCAGCCCAGCConserved hypothetical protein. 
J023022O05TCAGCCCAGCNONE 
Os05g0124700011-003-D10ATTGGGCTGANONE 
AK063257ATTGGGCTGADeoxynucleoside kinase family protein. 
Os05g0132800AK108629GTTGGTGGGCTGAConserved hypothetical protein. 
Os05g0153400AK108071TCAGCCCACCAACProtein prenyltransferase domain containing protein. 
AK108071TCAGCCCAGProtein prenyltransferase domain containing protein. 
Os05g0155100006-075-B02TCAGCCCATGNONE 
AK061929TCAGCCCATGNONE 
AK102810TCAGCCCATGNONE 
AK120877TCAGCCCATGSimilar to 60S ribosomal protein L18. 
J013023E03TCAGCCCATGNONE 
J013038C16TCAGCCCATGNONE 
J013120M14TCAGCCCATGNONE 
J013153B04TCAGCCCATGNONE 
J013159B07TCAGCCCATGNONE 
J023012A02TCAGCCCATGNONE 
J023027F08TCAGCCCATGNONE 
J023027I12TCAGCCCATGNONE 
J023120F05TCAGCCCATGNONE 
J023138O03TCAGCCCATGNONE 
J023142H13TCAGCCCATGNONE 
J023143P06TCAGCCCATGNONE 
J033023P09TCAGCCCATGNONE 
J033035O14TCAGCCCATGNONE 
J033042N19TCAGCCCATGNONE 
J033043B12TCAGCCCATGNONE 
J033065D10TCAGCCCATGNONE 
J033081A12TCAGCCCATGNONE 
J033084N05TCAGCCCATGNONE 
J033085M03TCAGCCCATGNONE 
J033112D15TCAGCCCATGNONE 
J033114O07TCAGCCCATGNONE 
J033119D15TCAGCCCATGNONE 
J033140E06TCAGCCCATGNONE 
J033141K23TCAGCCCATGNONE 
J043040I22TCAGCCCATGNONE 
J053050B21TCAGCCCATGNONE 
J053065I18TCAGCCCATGNONE 
J053074O16TCAGCCCATGNONE 
J065072K13TCAGCCCATGNONE 
J065211I09TCAGCCCATGNONE 
J090004K04TCAGCCCATGNONE 
J090016L06TCAGCCCATGNONE 
J090040F22TCAGCCCATGNONE 
J090063F22TCAGCCCATGNONE 
J090081J09TCAGCCCATGNONE 
J100032A10TCAGCCCATGNONE 
J100037G20TCAGCCCATGNONE 
J100056O10TCAGCCCATGNONE 
J100071D10TCAGCCCATGNONE 
J100075K13TCAGCCCATGNONE 
J100079F16TCAGCCCATGNONE 
J100080O16TCAGCCCATGNONE 
J100086N05TCAGCCCATGNONE 
Os05g0168400006-039-A06TACTGGGCTGANONE 
AK069800TACTGGGCTGANONE 
AK106195TACTGGGCTGAConserved hypothetical protein. 
J065086N09TACTGGGCTGANONE 
J065137B10TACTGGGCTGANONE 
J075062B04TACTGGGCTGANONE 
J075193I07TACTGGGCTGANONE 
J075193K24TACTGGGCTGANONE 
J075194D10TACTGGGCTGANONE 
J100037F01TACTGGGCTGANONE 
J100071E09TACTGGGCTGANONE 
Os05g0227100009-045-C06TCAGCCCANONE 
009-109-A08TCAGCCCANONE 
J075072D22TCAGCCCAHypothetical protein. 
Os05g0227300Os05g0227300TCAGCCCANONE 
Os05g0495100AK108028TCAGCCCACCCConserved hypothetical protein. 
Os05g0526800016-054-G05ATATGGGCTGATGGGCCATNONE 
AK066551ATATGGGCTGATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013074J04ATATGGGCTGATGGGCCATNONE 
J013095M02ATATGGGCTGATGGGCCATNONE 
J065195O21ATATGGGCTGATGGGCCATNONE 
Os05g0541900009-130-F05TCAGCCCATTNONE 
009-200-E07TCAGCCCATTNONE 
013-057-G09TCAGCCCATTNONE 
Os05g0577200AK069756TCAGCCCAACACarboxylesterase, type B family protein. 
Os05g0597100011-044-C10TCAGCCCAAGCCCAATNONE 
AF255711TCAGCCCAAGCCCAATNONE 
AK072845TCAGCCCAAGCCCAATSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16TCAGCCCAAGCCCAATNONE 
J023135M22TCAGCCCAAGCCCAATNONE 
J023141B21TCAGCCCAAGCCCAATNONE 
J023142J09TCAGCCCAAGCCCAATNONE 
J033025E09TCAGCCCAAGCCCAATNONE 
J033111A20TCAGCCCAAGCCCAATNONE 
J033126I01TCAGCCCAAGCCCAATNONE 
Os06g0128400AK064390AATGGGCTGATAAGCCCATGGNONE 
AK121983AATGGGCTGATAAGCCCATGGWD40-like domain containing protein. 
Os06g0130000AK064427TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK070084TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK119321TATTGGGCTCAGCCCATGAGCCCATGTSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment). 
Os06g0135340J065061D17TCAGCCCAATANONE 
J065159A10TCAGCCCAATAConserved hypothetical protein. 
Os06g0156900AK110688CTTGGGCTGAGlycosyl transferase, family 31 protein. 
Os06g0219800011-090-C04CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J065063P03CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100032E17CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100081I18CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
Os06g0291100J043017O10CCGAGCCGGCCCAAGTCAGCCCACAAHypothetical protein. 
Os06g0316100011-089-C01TCAGCCCACAANONE 
015-030-D11TCAGCCCACAANONE 
015-044-H10TCAGCCCACAANONE 
AK105260TCAGCCCACAAConserved hypothetical protein. 
AK119646TCAGCCCACAANONE 
Os06g0335500AK121989TCAGCCCAAAAAUX/IAA protein family protein. 
Os06g0343900AK070940CCACGGCCACACGCCTCAGCCCAACTConserved hypothetical protein. 
Os06g0573600AK102756GCTGGGCTGASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase). 
J023001F23GCTGGGCTGANONE 
J033107B05GCTGGGCTGANONE 
J090078G02GCTGGGCTGANONE 
J090099E09GCTGGGCTGANONE 
Os06g0607800012-010-G03AAATGGGCTGANONE 
AB070254AAATGGGCTGANONE 
AK063158AAATGGGCTGASimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695AAATGGGCTGANONE 
J013074G13AAATGGGCTGANONE 
J090015C16AAATGGGCTGANONE 
J090069H10AAATGGGCTGANONE 
Os06g0646900AY222862GCGGCCCAATGGGCTGANONE 
Os06g0670100AK102577AGTTGGGCTGAHypothetical protein. 
Os06g0673500J100018J12ATATGGGCTCAGCCCAGCCCATCANONE 
J100072F13ATATGGGCTCAGCCCAGCCCATCASimilar to Ubiquitin. 
Os07g0133700J065005A21TCAGCCCAGCCCAGCCCAAGHypothetical protein. 
J065096D02TCAGCCCAGCCCAGCCCAAGNONE 
J065097G13TCAGCCCAGCCCAGCCCAAGNONE 
Os07g0176600AK066812TCAGCCCAATTNONE 
AK067073TCAGCCCAATTSimilar to Kinase-like protein. 
Os07g0181000AK060932TCAGCCCAAATNONE 
Os07g0247000AK072232TCAGCCCATGPectinesterase inhibitor domain containing protein. 
AK099091TCAGCCCATGNONE 
Os07g0472300AK070792CCGTGGGCTGAConserved hypothetical protein. 
J023007O06CCGTGGGCTGANONE 
J023041I11CCGTGGGCTGANONE 
J023065F23CCGTGGGCTGANONE 
Os07g0513200015-004-B02TTTGGGCTGANONE 
AK101410TTTGGGCTGANONE 
AK106227TTTGGGCTGANONE 
AK119451TTTGGGCTGAProtein prenyltransferase domain containing protein. 
Os07g0530400AK107269TCAGCCCAAAConserved hypothetical protein. 
Os07g0543000AB110196TCAGCCCATTANONE 
AK058889TCAGCCCATTASimilar to Helix-loop-helix-like protein (Fragment). 
Os07g0549200006-072-D03TCAGCCCATTNONE 
AK073657TCAGCCCATTNONE 
AK109365TCAGCCCATTProtein prenyltransferase domain containing protein. 
J033051K19TCAGCCCATTNONE 
J100084G13TCAGCCCATTNONE 
Os07g0555400AK070977CTTGGGCCGTGCTTGGGCTGAConserved hypothetical protein. 
Os07g0604500009-018-C07AGTTGGGCTGANONE 
009-018-C07ATTTGGGCTGANONE 
009-018-C07CTTGGGCTGANONE 
009-194-C02AGTTGGGCTGANONE 
009-194-C02ATTTGGGCTGANONE 
009-194-C02CTTGGGCTGANONE 
011-023-C06AGTTGGGCTGANONE 
011-023-C06ATTTGGGCTGANONE 
011-023-C06CTTGGGCTGANONE 
015-035-B10AGTTGGGCTGANONE 
015-035-B10ATTTGGGCTGANONE 
015-035-B10CTTGGGCTGANONE 
AK064312AGTTGGGCTGASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK064312ATTTGGGCTGASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK064312CTTGGGCTGASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085AGTTGGGCTGANONE 
AK069085ATTTGGGCTGANONE 
AK069085CTTGGGCTGANONE 
J090050I12AGTTGGGCTGANONE 
J090050I12ATTTGGGCTGANONE 
J090050I12CTTGGGCTGANONE 
J100027C10AGTTGGGCTGANONE 
J100027C10ATTTGGGCTGANONE 
J100027C10CTTGGGCTGANONE 
J100029A05AGTTGGGCTGANONE 
J100029A05ATTTGGGCTGANONE 
J100029A05CTTGGGCTGANONE 
J100031P17AGTTGGGCTGANONE 
J100031P17ATTTGGGCTGANONE 
J100031P17CTTGGGCTGANONE 
J100039E20AGTTGGGCTGANONE 
J100039E20ATTTGGGCTGANONE 
J100039E20CTTGGGCTGANONE 
J100064L15AGTTGGGCTGANONE 
J100064L15ATTTGGGCTGANONE 
J100064L15CTTGGGCTGANONE 
J100066K08AGTTGGGCTGANONE 
J100066K08ATTTGGGCTGANONE 
J100066K08CTTGGGCTGANONE 
Os07g0604600009-114-E05TCAGCCCACANONE 
AK062832TCAGCCCACAB12D family protein. 
Os07g0625500AK064628ATATGGGCTGASimilar to Fimbriata-associated protein (Fragment). 
AK064628TCAGCCCATTSimilar to Fimbriata-associated protein (Fragment). 
Os07g0644300AK066726TCAGCCCAAAASimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483TCAGCCCAAAANONE 
Os07g0667400AK073297TCAGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
AK073297TCAGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
J033027J22TCAGCCCAACTNONE 
J033027J22TCAGCCCAACTNONE 
J033122B17TCAGCCCAACTNONE 
J033122B17TCAGCCCAACTNONE 
J065017H12TCAGCCCAACTNONE 
J065017H12TCAGCCCAACTNONE 
J065106D19TCAGCCCAACTNONE 
J065106D19TCAGCCCAACTNONE 
J065196J16TCAGCCCAACTNONE 
J065196J16TCAGCCCAACTNONE 
J090084F01TCAGCCCAACTNONE 
J090084F01TCAGCCCAACTNONE 
Os07g0691100AK071728TCATGGGCTGASimilar to Pectin methylesterase 6 (Fragment). 
J023108P03TCATGGGCTGANONE 
J023112F11TCATGGGCTGANONE 
J023143A10TCATGGGCTGANONE 
Os08g0107900014-055-C03TGGTGGGCTGANONE 
J065062G20TGGTGGGCTGANONE 
Os08g0139000009-092-A05TCAGCCCATGANONE 
009-150-B08TCAGCCCATGANONE 
AK070704TCAGCCCATGANONE 
AK119802TCAGCCCATGASimilar to RNA-binding glycine rich protein (RGP-2). 
J023024E19TCAGCCCATGANONE 
J023056N10TCAGCCCATGANONE 
J065028B04TCAGCCCATGANONE 
J065119H20TCAGCCCATGANONE 
J065121E01TCAGCCCATGANONE 
J065139C18TCAGCCCATGANONE 
J065160O15TCAGCCCATGANONE 
J065211A15TCAGCCCATGANONE 
J090038G23TCAGCCCATGANONE 
J100024D11TCAGCCCATGANONE 
J100032C04TCAGCCCATGANONE 
J100038G14TCAGCCCATGANONE 
J100051E19TCAGCCCATGANONE 
Os08g0386300AK059323TAAGCCCATTGGGCTGANONE 
AK070379TAAGCCCATTGGGCTGACytochrome b5 domain containing protein. 
J023054P20TAAGCCCATTGGGCTGANONE 
J033089H01TAAGCCCATTGGGCTGANONE 
J065013I01TAAGCCCATTGGGCTGANONE 
J065212E17TAAGCCCATTGGGCTGANONE 
J080317O15TAAGCCCATTGGGCTGANONE 
J090018O07TAAGCCCATTGGGCTGANONE 
Os08g0414200AK102789TCAGCCCACCTBRCT domain containing protein. 
J033048B10TCAGCCCACCTNONE 
J033071G24TCAGCCCACCTNONE 
J033107O17TCAGCCCACCTNONE 
Os08g0485700AK068131TCAGCCCATATNONE 
AK069097TCAGCCCATATMethyl-CpG binding domain containing protein. 
J013130L03TCAGCCCATATNONE 
Os08g0496000011-009-D02TCAGCCCAAAANONE 
AK103187TCAGCCCAAAACytochrome oxidase assembly family protein. 
J033121L24TCAGCCCAAAANONE 
J033149A07TCAGCCCAAAANONE 
J065198L20TCAGCCCAAAANONE 
J090096F24TCAGCCCAAAANONE 
Os08g0511000AK107578AATGGGCTGAProtein prenyltransferase domain containing protein. 
Os08g0511800011-007-H01AAGGCCCACTGGGCTGANONE 
AK063264AAGGCCCACTGGGCTGAConserved hypothetical protein. 
Os08g0527100AK119411TCAGCCCAGCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12TCAGCCCAGCCNONE 
J090029K18TCAGCCCAGCCNONE 
Os08g0539700AB013451GGGCTGGGCTGANONE 
AK065693GGGCTGGGCTGADisease resistance protein family protein. 
AK099855GGGCTGGGCTGANONE 
J013022K17GGGCTGGGCTGANONE 
J013035D04GGGCTGGGCTGANONE 
J013037A20GGGCTGGGCTGANONE 
J013043I01GGGCTGGGCTGANONE 
J013051J07GGGCTGGGCTGANONE 
J013056G09GGGCTGGGCTGANONE 
J013067C09GGGCTGGGCTGANONE 
J013067M22GGGCTGGGCTGANONE 
J013089C05GGGCTGGGCTGANONE 
J013106J08GGGCTGGGCTGANONE 
J013110K12GGGCTGGGCTGANONE 
J013114K06GGGCTGGGCTGANONE 
J013135N19GGGCTGGGCTGANONE 
J013149H06GGGCTGGGCTGANONE 
J075111G14GGGCTGGGCTGANONE 
Os08g0549300009-008-F01TCAGCCCACCAACNONE 
009-033-G10TCAGCCCACCAACNONE 
AK120938TCAGCCCACCAACSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420TCAGCCCACCAACNONE 
J023037A21TCAGCCCACCAACNONE 
J023066D20TCAGCCCACCAACNONE 
J033099K13TCAGCCCACCAACNONE 
J065116C14TCAGCCCACCAACNONE 
J075009K15TCAGCCCACCAACNONE 
J075071P13TCAGCCCACCAACNONE 
J075080D18TCAGCCCACCAACNONE 
J075124F24TCAGCCCACCAACNONE 
J075198F23TCAGCCCACCAACNONE 
J080006B15TCAGCCCACCAACNONE 
J090078H13TCAGCCCACCAACNONE 
J090089J09TCAGCCCACCAACNONE 
J100017A03TCAGCCCACCAACNONE 
J100023G03TCAGCCCACCAACNONE 
Os08g0550100AB070258GACGGCCCAGCTCAGCCCAGCNONE 
AK061287GACGGCCCAGCTCAGCCCAGCSimilar to 26S proteasome subunit RPN3a. 
Os08g0556200009-008-D12TGTGGGCTGANONE 
AK121222TGTGGGCTGASimilar to Dihydroneopterin aldolase. 
J023090H22TGTGGGCTGANONE 
J075027J23TGTGGGCTGANONE 
J075032L14TGTGGGCTGANONE 
J075053H04TGTGGGCTGANONE 
J075171P20TGTGGGCTGANONE 
J100057F12TGTGGGCTGANONE 
Os09g0322100AK107018TCAGCCCACCACConserved hypothetical protein. 
Os09g0324200AK109621TTTCGGCCTTTTGGGCTGACyclin-like F-box domain containing protein. 
Os09g0370300AK108199TCAGCCCAACCSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0459200AK110733AATTGGGCTGAConserved hypothetical protein. 
J065131C07AATTGGGCTGANONE 
Os09g0534800009-128-G09TCAGCCCAGTCGGACGGACNONE 
AF464908TCAGCCCAGTCGGACGGACNONE 
AK068941TCAGCCCAGTCGGACGGACTranscription initiation factor IIB (General transcription factor TFIIB). 
J013170A08TCAGCCCAGTCGGACGGACNONE 
J023123L05TCAGCCCAGTCGGACGGACNONE 
J043020O05TCAGCCCAGTCGGACGGACNONE 
Os09g0559800AK071542AGATGGGCTGASimilar to Transporter-like protein. 
J013063N24AGATGGGCTGANONE 
Os11g0130500J065119D16ATATGGGCTGANONE 
J065169E14ATATGGGCTGACyclin-like F-box domain containing protein. 
Os11g0130600AK066342TCAGCCCATATConserved hypothetical protein. 
J065192M10TCAGCCCATATNONE 
Os11g0137500AK070070CGCGTGGGCTGATranscription factor TFIIE, alpha subunit family protein. 
Os11g0139500AK121845TCGTGGGCTGTATATGGGCTGANONE 
Os11g0151700AK073222TCAGCCCAGSimilar to Purple acid phosphatase. 
J033148F11TCAGCCCAGNONE 
Os11g0162200009-059-H04AGCCCAATTCAGCCCATCTNONE 
AK060396AGCCCAATTCAGCCCATCTSimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11AGCCCAATTCAGCCCATCTNONE 
J065105K09AGCCCAATTCAGCCCATCTNONE 
J075024G12AGCCCAATTCAGCCCATCTNONE 
J075040K04AGCCCAATTCAGCCCATCTNONE 
J075066D13AGCCCAATTCAGCCCATCTNONE 
J075108A11AGCCCAATTCAGCCCATCTNONE 
J100031D04AGCCCAATTCAGCCCATCTNONE 
J100060O05AGCCCAATTCAGCCCATCTNONE 
J100075M22AGCCCAATTCAGCCCATCTNONE 
Os11g0175500015-087-F02TCAGCCCAACANONE 
AK064320TCAGCCCAACAZinc finger, RING-type domain containing protein. 
AK101592TCAGCCCAACANONE 
Os11g0182200006-059-C11TCAGCCCANONE 
006-087-H05TCAGCCCANONE 
006-100-A06TCAGCCCANONE 
AK060023TCAGCCCANONE 
AK099589TCAGCCCATransferase family protein. 
AK104889TCAGCCCANONE 
J013026J22TCAGCCCANONE 
J013043H09TCAGCCCANONE 
J023042E04TCAGCCCANONE 
J023065L03TCAGCCCANONE 
J033052E01TCAGCCCANONE 
J033129B17TCAGCCCANONE 
J053065B17TCAGCCCANONE 
J090006P20TCAGCCCANONE 
J090013P20TCAGCCCANONE 
Os11g0199600AK101774TCAGCCCATCAZinc finger, CCHC-type domain containing protein. 
AK120040TCAGCCCATCANONE 
J023047I06TCAGCCCATCANONE 
J033064L23TCAGCCCATCANONE 
J033117I01TCAGCCCATCANONE 
J033123I18TCAGCCCATCANONE 
J053026H17TCAGCCCATCANONE 
J053078G05TCAGCCCATCANONE 
J065102A09TCAGCCCATCANONE 
J065113G11TCAGCCCATCANONE 
J065207F20TCAGCCCATCANONE 
J075027K21TCAGCCCATCANONE 
Os11g0264600J100079I22TCAGCCCAAAANONE 
Os11g0306300006-102-D09GTGGTGGGCTGANONE 
AK109384GTGGTGGGCTGASimilar to Herbicide safener binding protein. 
Os11g0414000012-012-F01TCAGCCCACACGNONE 
AK071277TCAGCCCACACGeIF4-gamma/eIF5/eIF2-epsilon domain containing protein. 
J023082M08TCAGCCCACACGNONE 
J023083E17TCAGCCCACACGNONE 
J023128I07TCAGCCCACACGNONE 
J033098J04TCAGCCCACACGNONE 
J033135G10TCAGCCCACACGNONE 
J043007L23TCAGCCCACACGNONE 
J065011N07TCAGCCCACACGNONE 
J065016E01TCAGCCCACACGNONE 
J065162N12TCAGCCCACACGNONE 
J065164O22TCAGCCCACACGNONE 
J065173J06TCAGCCCACACGNONE 
J065200E24TCAGCCCACACGNONE 
J065203K20TCAGCCCACACGNONE 
J075033N16TCAGCCCACACGNONE 
J075047L06TCAGCCCACACGNONE 
J075064J24TCAGCCCACACGNONE 
J075100O07TCAGCCCACACGNONE 
J075121G11TCAGCCCACACGNONE 
J075134A13TCAGCCCACACGNONE 
J075190F20TCAGCCCACACGNONE 
J075190H08TCAGCCCACACGNONE 
J080033L04TCAGCCCACACGNONE 
J080045O09TCAGCCCACACGNONE 
J080064J07TCAGCCCACACGNONE 
J080066N22TCAGCCCACACGNONE 
J080075C09TCAGCCCACACGNONE 
J090002C08TCAGCCCACACGNONE 
J090058G21TCAGCCCACACGNONE 
J090074M07TCAGCCCACACGNONE 
J100090G06TCAGCCCACACGNONE 
Os11g0438700012-011-H02TCAGCCCAAAANONE 
AK063434TCAGCCCAAAASimilar to Tropinone reductase-I (EC 1.1.1.206) (TR-I) (Tropine dehydrogenase). 
AK073524TCAGCCCAAAANONE 
J033046I10TCAGCCCAAAANONE 
J043029B09TCAGCCCAAAANONE 
J065033C17TCAGCCCAAAANONE 
J065062D11TCAGCCCAAAANONE 
J065138G10TCAGCCCAAAANONE 
J065184I11TCAGCCCAAAANONE 
J080030B02TCAGCCCAAAANONE 
J090063K06TCAGCCCAAAANONE 
Os11g0497000AK111924GGGCCTGGCCCATCAGCCCATATAGCCCATCASimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065097A08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065123J10GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J075096F04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J080065C15GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090033J04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090072N23GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100021E08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100063H21GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
Os11g0545000011-025-F09CCCGGCCCAACTCAGCCCAATANONE 
AK058871CCCGGCCCAACTCAGCCCAATAConserved hypothetical protein. 
AK063297CCCGGCCCAACTCAGCCCAATANONE 
AK100607CCCGGCCCAACTCAGCCCAATANONE 
Os11g0605800J075009I22TCAGCCCANONE 
Os12g0127500AK064595TCAGCCCATATConserved hypothetical protein. 
J065067F11TCAGCCCATATNONE 
J090007D02TCAGCCCATATNONE 
J100035G10TCAGCCCATATNONE 
J100077J10TCAGCCCATATNONE 
Os12g0136200AK068700TATTGGGCTGANONE 
AK069493TATTGGGCTGAWD40-like domain containing protein. 
Os12g0190100AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
Os12g0595800AK072425TCAGCCCATTNONE 
AK101874TCAGCCCATTNONE 
Os12g0633200009-073-D03TTGTGGGCTGANONE 
AK062615TTGTGGGCTGAErg28-like family protein. 
Os12g0636600AK111056GGATGGGCTGAConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.