version

Summary of OsREG658 (All List)

OrganismOryza sativa  
IDOsREG658  
SequenceTCGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3305  

Entry Sequences (3305 entries)

LocusGene modelSequenceDescription
Os01g0103600006-072-A01GCCACGTCGGCCCATTNONE 
009-148-C12GCCACGTCGGCCCATTNONE 
AK059848GCCACGTCGGCCCATTEmopamil-binding family protein. 
AK102848GCCACGTCGGCCCATTNONE 
J033036P20GCCACGTCGGCCCATTNONE 
J065171N21GCCACGTCGGCCCATTNONE 
J065209M02GCCACGTCGGCCCATTNONE 
J075067A03GCCACGTCGGCCCATTNONE 
J075110C09GCCACGTCGGCCCATTNONE 
Os01g0104000AK072087TGTTGGGCCGANONE 
AK103808TGTTGGGCCGAC-type lectin domain containing protein. 
Os01g0104100AK072797TCGGCCCAACAZinc finger, RING-type domain containing protein. 
AK104280TCGGCCCAACANONE 
Os01g0132800AK068422TAATGGGCCGAAAPeptidyl-tRNA hydrolase family protein. 
Os01g0155600006-048-F03ATCTCGGCCCATANONE 
AK060171ATCTCGGCCCATANONE 
AK071635ATCTCGGCCCATASimilar to Splicing factor RSZ33. 
J023080A03ATCTCGGCCCATANONE 
J023100L15ATCTCGGCCCATANONE 
J033075I17ATCTCGGCCCATANONE 
J033085O09ATCTCGGCCCATANONE 
J033105E15ATCTCGGCCCATANONE 
J033132N10ATCTCGGCCCATANONE 
J033132P12ATCTCGGCCCATANONE 
J033149H12ATCTCGGCCCATANONE 
J043026M03ATCTCGGCCCATANONE 
J080305J10ATCTCGGCCCATANONE 
J080308K03ATCTCGGCCCATANONE 
J090023M04ATCTCGGCCCATANONE 
J090078F24ATCTCGGCCCATANONE 
J100066P05ATCTCGGCCCATANONE 
Os01g0179901J075009I05GAGGCCCATTGGGCCGAAANONE 
J075058D09GAGGCCCATTGGGCCGAAANONE 
J075153K16GAGGCCCATTGGGCCGAAAConserved hypothetical protein. 
Os01g0184500AK060699GCTGGGCCGAAADEAD/DEAH box helicase, N-terminal domain containing protein. 
Os01g0191800AK061360TCTCGGCCCAGTANONE 
Os01g0219100J065130F20TAATGGGCCGAANONE 
J065208O10TAATGGGCCGAASFT2-like family protein. 
Os01g0221300011-021-E12TCGGCCCAAGNONE 
011-021-E12TCTCGGCCCAACANONE 
AK073330TCGGCCCAAGConserved hypothetical protein. 
AK073330TCTCGGCCCAACAConserved hypothetical protein. 
J013130J18TCGGCCCAAGNONE 
J013130J18TCTCGGCCCAACANONE 
J033024A12TCGGCCCAAGNONE 
J033024A12TCTCGGCCCAACANONE 
J065063H09TCGGCCCAAGNONE 
J065063H09TCTCGGCCCAACANONE 
J065093G05TCGGCCCAAGNONE 
J065093G05TCTCGGCCCAACANONE 
J090007K12TCGGCCCAAGNONE 
J090007K12TCTCGGCCCAACANONE 
Os01g0222700012-011-E01GTTTGGGCCGACCGTTGNONE 
AK068883GTTTGGGCCGACCGTTGNONE 
AK101946GTTTGGGCCGACCGTTGZinc finger, BED-type predicted domain containing protein. 
J033075C16GTTTGGGCCGACCGTTGNONE 
J043013D08GTTTGGGCCGACCGTTGNONE 
J065089G19GTTTGGGCCGACCGTTGNONE 
J065197K19GTTTGGGCCGACCGTTGNONE 
J075161L21GTTTGGGCCGACCGTTGNONE 
Os01g0229100006-113-G08ACGTGGGCCGAAANONE 
011-075-E08ACGTGGGCCGAAANONE 
AK061285ACGTGGGCCGAAANONE 
AK070838ACGTGGGCCGAAATetratricopeptide-like helical domain containing protein. 
J013059F08ACGTGGGCCGAAANONE 
J013059G08ACGTGGGCCGAAANONE 
J013059G09ACGTGGGCCGAAANONE 
J013069M12ACGTGGGCCGAAANONE 
J013105A19ACGTGGGCCGAAANONE 
J013149F07ACGTGGGCCGAAANONE 
J023073J07ACGTGGGCCGAAANONE 
J023130F24ACGTGGGCCGAAANONE 
J023147J08ACGTGGGCCGAAANONE 
J033028F13ACGTGGGCCGAAANONE 
J033115A16ACGTGGGCCGAAANONE 
J033135F02ACGTGGGCCGAAANONE 
J065031G16ACGTGGGCCGAAANONE 
J065058A09ACGTGGGCCGAAANONE 
J065089N15ACGTGGGCCGAAANONE 
J065130I09ACGTGGGCCGAAANONE 
J065191P09ACGTGGGCCGAAANONE 
J065197P14ACGTGGGCCGAAANONE 
J080306D15ACGTGGGCCGAAANONE 
J080308M06ACGTGGGCCGAAANONE 
J080315A03ACGTGGGCCGAAANONE 
J080315N11ACGTGGGCCGAAANONE 
J090046E14ACGTGGGCCGAAANONE 
J090058G09ACGTGGGCCGAAANONE 
J090077H05ACGTGGGCCGAAANONE 
J090087O20ACGTGGGCCGAAANONE 
Os01g0229200AK066024TTTCGGCCCACGTVHS domain containing protein. 
Os01g0279700AK067683TTTGGGCCGANONE 
AK100107TTTGGGCCGAMajor facilitator superfamily protein. 
J023004N09TTTGGGCCGANONE 
J075019L14TTTGGGCCGANONE 
J075187F21TTTGGGCCGANONE 
Os01g0286000AK109824AACGGGCCGTAAGTGGGCCGAGSnf7 family protein. 
Os01g0301100AK105556AATTGGGCCGAConserved hypothetical protein. 
Os01g0306100AK111041TTATGGGCCGAGAPlant specific eukaryotic initiation factor 4B family protein. 
AK111041TTTCGGCCCAATPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0346400J100032G11GTGGTGGGCCGAAAConserved hypothetical protein. 
Os01g0348700009-125-H02CAAGGCCCAATCGGCCCACAANONE 
009-156-F08CAAGGCCCAATCGGCCCACAANONE 
009-177-A11CAAGGCCCAATCGGCCCACAANONE 
009-195-D02CAAGGCCCAATCGGCCCACAANONE 
013-040-B06CAAGGCCCAATCGGCCCACAANONE 
013-051-B09CAAGGCCCAATCGGCCCACAANONE 
AK120842CAAGGCCCAATCGGCCCACAASimilar to 60S ribosomal protein L23a (L25). 
J013071O22CAAGGCCCAATCGGCCCACAANONE 
J023022J07CAAGGCCCAATCGGCCCACAANONE 
J033028J08CAAGGCCCAATCGGCCCACAANONE 
J033109M11CAAGGCCCAATCGGCCCACAANONE 
J043022K15CAAGGCCCAATCGGCCCACAANONE 
J043031N11CAAGGCCCAATCGGCCCACAANONE 
J053023I10CAAGGCCCAATCGGCCCACAANONE 
J053045F16CAAGGCCCAATCGGCCCACAANONE 
J053054F22CAAGGCCCAATCGGCCCACAANONE 
J053094P15CAAGGCCCAATCGGCCCACAANONE 
J065048F01CAAGGCCCAATCGGCCCACAANONE 
J075012F16CAAGGCCCAATCGGCCCACAANONE 
J075089C09CAAGGCCCAATCGGCCCACAANONE 
J075179J20CAAGGCCCAATCGGCCCACAANONE 
J080305E19CAAGGCCCAATCGGCCCACAANONE 
J080309B21CAAGGCCCAATCGGCCCACAANONE 
J090017L05CAAGGCCCAATCGGCCCACAANONE 
J090058B11CAAGGCCCAATCGGCCCACAANONE 
Os01g0358300AK060388TTCGGCCCAACTNONE 
AK072081TTCGGCCCAACTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AGTTGGGCCGAANONE 
006-083-B11AGTTGGGCCGAANONE 
006-083-C09AGTTGGGCCGAANONE 
006-088-H03AGTTGGGCCGAANONE 
006-102-H05AGTTGGGCCGAANONE 
AK061826AGTTGGGCCGAASimilar to 40S ribosomal protein S4. 
J013105M07AGTTGGGCCGAANONE 
J013155A16AGTTGGGCCGAANONE 
J033025C03AGTTGGGCCGAANONE 
J033072L20AGTTGGGCCGAANONE 
J033095I15AGTTGGGCCGAANONE 
J033105E03AGTTGGGCCGAANONE 
J033112G18AGTTGGGCCGAANONE 
J033125D09AGTTGGGCCGAANONE 
J065100L16AGTTGGGCCGAANONE 
J065176I05AGTTGGGCCGAANONE 
J090001C14AGTTGGGCCGAANONE 
J090058E15AGTTGGGCCGAANONE 
J090068F07AGTTGGGCCGAANONE 
Os01g0513800012-032-E11AGATGGGCCGAANONE 
AK100776AGATGGGCCGAASimilar to Brix domain containing protein 1 homolog. 
J023120C10AGATGGGCCGAANONE 
J033044A22AGATGGGCCGAANONE 
J033048H13AGATGGGCCGAANONE 
J033118F03AGATGGGCCGAANONE 
J065176B05AGATGGGCCGAANONE 
J075026B19AGATGGGCCGAANONE 
J075048I23AGATGGGCCGAANONE 
J075141A19AGATGGGCCGAANONE 
J075148E05AGATGGGCCGAANONE 
J090031M12AGATGGGCCGAANONE 
Os01g0514300AK121086TTTCGGCCCATTTLissencephaly type-1-like homology motif domain containing protein. 
Os01g0530300AK111105AAGGCCCAATTGGGCCGAHypothetical protein. 
J090023M11AAGGCCCAATTGGGCCGANONE 
J090053G13AAGGCCCAATTGGGCCGANONE 
Os01g0530366J075001P06CTCGGCCCAAAANONE 
J075006K21CTCGGCCCAAAARNA polymerase Rbp10 domain containing protein. 
J075030G13CTCGGCCCAAAANONE 
Os01g0596300016-083-D09TTTCGGCCCACACNONE 
AK069151TTTCGGCCCACACCyclin-like F-box domain containing protein. 
J023007D17TTTCGGCCCACACNONE 
J065141M02TTTCGGCCCACACNONE 
Os01g0604100AK099765AAATGGGCCGAGCCCAACTUspA domain containing protein. 
J013094O21AAATGGGCCGAGCCCAACTNONE 
Os01g0612800AK071035AAATGGGCCGAConserved hypothetical protein. 
AK071035TGTGGGCCGAAConserved hypothetical protein. 
J090075K01AAATGGGCCGANONE 
J090075K01TGTGGGCCGAANONE 
Os01g0618500011-019-D03TAATGGGCCGANONE 
AK067476TAATGGGCCGASimilar to RNA helicase (Fragment). 
J013020E19TAATGGGCCGANONE 
J033046J12TAATGGGCCGANONE 
J033055D06TAATGGGCCGANONE 
Os01g0642900009-109-F01TCGGCCCAAANONE 
AK063836TCGGCCCAAASingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560TCGGCCCAAANONE 
J033043K18TCGGCCCAAANONE 
J100023C05TCGGCCCAAANONE 
J100038C15TCGGCCCAAANONE 
J100039C23TCGGCCCAAANONE 
Os01g0649000AK073564TCGGCCCAACGGCCWD40-like domain containing protein. 
Os01g0678600009-114-H06CTCGGCCCAGCNONE 
AK063019CTCGGCCCAGCNONE 
AK071536CTCGGCCCAGCNONE 
AK120629CTCGGCCCAGCRibosomal protein S20 family protein. 
J013045E23CTCGGCCCAGCNONE 
J013153D21CTCGGCCCAGCNONE 
J013157A14CTCGGCCCAGCNONE 
J023048M04CTCGGCCCAGCNONE 
J065006P11CTCGGCCCAGCNONE 
J065042O14CTCGGCCCAGCNONE 
J065080D15CTCGGCCCAGCNONE 
J065096M02CTCGGCCCAGCNONE 
J065109M14CTCGGCCCAGCNONE 
J065204H02CTCGGCCCAGCNONE 
J065207L21CTCGGCCCAGCNONE 
J075028D22CTCGGCCCAGCNONE 
J075040O12CTCGGCCCAGCNONE 
J075051O03CTCGGCCCAGCNONE 
J075071M13CTCGGCCCAGCNONE 
J075151H15CTCGGCCCAGCNONE 
J075153D16CTCGGCCCAGCNONE 
J075153I21CTCGGCCCAGCNONE 
J080311L16CTCGGCCCAGCNONE 
J100053A20CTCGGCCCAGCNONE 
J100071P19CTCGGCCCAGCNONE 
Os01g0680400AK067914TCGGCCCAGATAFII28-like protein family protein. 
J065039K13TCGGCCCAGANONE 
J065042K22TCGGCCCAGANONE 
J080016E23TCGGCCCAGANONE 
J080064E22TCGGCCCAGANONE 
Os01g0684800AK073525TCGGCCCACAProtein prenyltransferase domain containing protein. 
Os01g0696000AK066735TGGATGGGCCGAAATTTCGGCCCATCANONE 
AK110917TGGATGGGCCGAAATTTCGGCCCATCASimilar to Calcium-activated outward-rectifying potassium channel 1 (AtKCO1). 
J013088G11TGGATGGGCCGAAATTTCGGCCCATCANONE 
J013102H08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J033126F08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J065053G13TGGATGGGCCGAAATTTCGGCCCATCANONE 
J075109I06TGGATGGGCCGAAATTTCGGCCCATCANONE 
J100073H07TGGATGGGCCGAAATTTCGGCCCATCANONE 
Os01g0725900AK108128TCGGCCCACCTPollen Ole e 1 allergen and extensin domain containing protein. 
J075119G24TCGGCCCACCTNONE 
J075150F06TCGGCCCACCTNONE 
Os01g0752300AK121755ATATGGGCTTCGGCCCATGASimilar to 60S ribosomal protein L18a-1. 
J013049F10ATATGGGCTTCGGCCCATGANONE 
J013088L10ATATGGGCTTCGGCCCATGANONE 
J023020B21ATATGGGCTTCGGCCCATGANONE 
J023038M01ATATGGGCTTCGGCCCATGANONE 
J033058H15ATATGGGCTTCGGCCCATGANONE 
J033088C04ATATGGGCTTCGGCCCATGANONE 
J033115N19ATATGGGCTTCGGCCCATGANONE 
J033131H04ATATGGGCTTCGGCCCATGANONE 
J065067E05ATATGGGCTTCGGCCCATGANONE 
J065085C07ATATGGGCTTCGGCCCATGANONE 
J065095D12ATATGGGCTTCGGCCCATGANONE 
J065124B19ATATGGGCTTCGGCCCATGANONE 
J065181H07ATATGGGCTTCGGCCCATGANONE 
J065197B09ATATGGGCTTCGGCCCATGANONE 
J075090K22ATATGGGCTTCGGCCCATGANONE 
J075101P17ATATGGGCTTCGGCCCATGANONE 
J075181F13ATATGGGCTTCGGCCCATGANONE 
J075190H19ATATGGGCTTCGGCCCATGANONE 
J090004P17ATATGGGCTTCGGCCCATGANONE 
J090066I03ATATGGGCTTCGGCCCATGANONE 
Os01g0764600AK060621GTTTGGGCCGAGAFosfomycin resistance kinase FomA family protein. 
J013111L18GTTTGGGCCGAGANONE 
J013134N08GTTTGGGCCGAGANONE 
Os01g0765000AK101905TTTTGGGCCGASimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0770500AK071653TCGGCCCATCANONE 
AK099603TCGGCCCATCASimilar to ABC transporter ATP-binding protein. 
Os01g0773600AK067004TCGGCCCATTGlycoside hydrolase, family 47 protein. 
J013091F09TCGGCCCATTNONE 
J013134K14TCGGCCCATTNONE 
J013158J15TCGGCCCATTNONE 
J033060O20TCGGCCCATTNONE 
J033074C16TCGGCCCATTNONE 
J075086F05TCGGCCCATTNONE 
J075150H08TCGGCCCATTNONE 
J090006E02TCGGCCCATTNONE 
J090074E02TCGGCCCATTNONE 
J100030M05TCGGCCCATTNONE 
J100036M16TCGGCCCATTNONE 
J100063H18TCGGCCCATTNONE 
Os01g0784600AK067527TCGGCCCATATConserved hypothetical protein. 
Os01g0801700AK073813TTCGGCCCAAGGCCCConserved hypothetical protein. 
J033067K14TTCGGCCCAAGGCCCNONE 
Os01g0839300AK064685GAGGCCCACTGGGCCGAAASimilar to 50S ribosomal protein L17. 
J065060I21GAGGCCCACTGGGCCGAAANONE 
Os01g0842200003-126-E01TCTCGGCCCAGGNONE 
AK102593TCTCGGCCCAGGNONE 
AK119896TCTCGGCCCAGGSimilar to Scarecrow-like 9 (Fragment). 
J013151G12TCTCGGCCCAGGNONE 
J033098G15TCTCGGCCCAGGNONE 
J090041L03TCTCGGCCCAGGNONE 
J090069J20TCTCGGCCCAGGNONE 
Os01g0854800AK109676CTTGGGCCGASimilar to Cytochrome P450 86A1 (EC 1.14.-.-) (CYPLXXXVI) (P450-dependent fatty acid omega-hydroxylase). 
J100041A10CTTGGGCCGANONE 
Os01g0861000AK058707CCTGGGCCGAConserved hypothetical protein. 
Os01g0869000AK067351TTTCGGCCCATCCNONE 
AK121602TTTCGGCCCATCCProtein of unknown function DUF639 family protein. 
Os01g0872700AK066633CTCGGCCCAAAANONE 
AK100381CTCGGCCCAAAAPutative 5-3 exonuclease domain containing protein. 
J013028K13CTCGGCCCAAAANONE 
J013038C19CTCGGCCCAAAANONE 
J023024P16CTCGGCCCAAAANONE 
J023074N21CTCGGCCCAAAANONE 
J023085E21CTCGGCCCAAAANONE 
J033034K14CTCGGCCCAAAANONE 
J033044N04CTCGGCCCAAAANONE 
J033052O10CTCGGCCCAAAANONE 
J033087J09CTCGGCCCAAAANONE 
J033129L17CTCGGCCCAAAANONE 
J033143O07CTCGGCCCAAAANONE 
J065014M22CTCGGCCCAAAANONE 
J065025H10CTCGGCCCAAAANONE 
J065051H21CTCGGCCCAAAANONE 
J065123E05CTCGGCCCAAAANONE 
J065181P03CTCGGCCCAAAANONE 
J100064B21CTCGGCCCAAAANONE 
Os01g0889000AK103621TCGGCCCAGCTetratricopeptide-like helical domain containing protein. 
Os01g0891400J065077E24TTTTGGGCCGAAConserved hypothetical protein. 
J065206I07TTTTGGGCCGAANONE 
Os01g0908100AK072293GCTGGGCCGAAATTTCGGCCCAGTARabGAP/TBC domain containing protein. 
J065010B13GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065010M12GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065047C19GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065069B18GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065071K24GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065142P04GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065170E11GCTGGGCCGAAATTTCGGCCCAGTANONE 
Os01g0908800AK065889ATTTGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0950900AK101121AGTGGGCCGAGProtein of unknown function DUF221 domain containing protein. 
J023036H24AGTGGGCCGAGNONE 
J023084G23AGTGGGCCGAGNONE 
J033025J04AGTGGGCCGAGNONE 
J033139J18AGTGGGCCGAGNONE 
J090006A09AGTGGGCCGAGNONE 
J090036D02AGTGGGCCGAGNONE 
Os01g0954400003-009-F12TAATGGGCCGANONE 
012-080-B09TAATGGGCCGANONE 
AK065709TAATGGGCCGASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335TAATGGGCCGANONE 
J013039J02TAATGGGCCGANONE 
J033081E17TAATGGGCCGANONE 
J075058B02TAATGGGCCGANONE 
J075067K19TAATGGGCCGANONE 
J075120E23TAATGGGCCGANONE 
J075147I16TAATGGGCCGANONE 
Os01g0960800AK073977TTTGGGCCGAAProtein Transporter, Pam16 family protein. 
AY313247TTTGGGCCGAANONE 
J033075P16TTTGGGCCGAANONE 
J065051H06TTTGGGCCGAANONE 
J065167L02TTTGGGCCGAANONE 
J090083C22TTTGGGCCGAANONE 
Os01g0971600AK070366GTTTGGGCCGAGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
Os01g0973400AK060011TCGGCCCAGGNONE 
AK068879TCGGCCCAGGConserved hypothetical protein 48 family protein. 
AK099210TCGGCCCAGGNONE 
AK104863TCGGCCCAGGNONE 
J013170C09TCGGCCCAGGNONE 
J033106K13TCGGCCCAGGNONE 
J075018P18TCGGCCCAGGNONE 
J075039C18TCGGCCCAGGNONE 
J075104L18TCGGCCCAGGNONE 
Os02g0130300011-005-D07AAATGGGCCGAGNONE 
011-041-B06AAATGGGCCGAGNONE 
015-099-D11AAATGGGCCGAGNONE 
016-049-D06AAATGGGCCGAGNONE 
AK102708AAATGGGCCGAGZinc finger, RING-type domain containing protein. 
Os02g0133800006-092-D12TCGGCCCAAAANONE 
006-111-G01TCGGCCCAAAANONE 
AK103646TCGGCCCAAAANONE 
AK109376TCGGCCCAAAAProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886TCGGCCCAAAANONE 
J033135B19TCGGCCCAAAANONE 
J065200F01TCGGCCCAAAANONE 
J065213J11TCGGCCCAAAANONE 
J075031N16TCGGCCCAAAANONE 
J075032N17TCGGCCCAAAANONE 
J075047P04TCGGCCCAAAANONE 
J075063D01TCGGCCCAAAANONE 
J075105F23TCGGCCCAAAANONE 
J075121E16TCGGCCCAAAANONE 
J075176F10TCGGCCCAAAANONE 
J075182M16TCGGCCCAAAANONE 
J075190E09TCGGCCCAAAANONE 
J075191B14TCGGCCCAAAANONE 
J100055J24TCGGCCCAAAANONE 
J100066H24TCGGCCCAAAANONE 
J100073N01TCGGCCCAAAANONE 
Os02g0136800011-089-E11CTCGGCCCATTNONE 
AK070727CTCGGCCCATTNONE 
AK103485CTCGGCCCATTProtein of unknown function DUF1677, Oryza sativa family protein. 
J023058D10CTCGGCCCATTNONE 
J033140H14CTCGGCCCATTNONE 
J033142H14CTCGGCCCATTNONE 
J065151O09CTCGGCCCATTNONE 
J090076K09CTCGGCCCATTNONE 
J090085K04CTCGGCCCATTNONE 
Os02g0175800009-083-C02TCGGCCCAGCCNONE 
009-184-H07TCGGCCCAGCCNONE 
009-199-D07TCGGCCCAGCCNONE 
AK058292TCGGCCCAGCCNONE 
AK120215TCGGCCCAGCCConserved hypothetical protein. 
J013040G12TCGGCCCAGCCNONE 
J065050N21TCGGCCCAGCCNONE 
J065077O07TCGGCCCAGCCNONE 
J065102G05TCGGCCCAGCCNONE 
J065197A04TCGGCCCAGCCNONE 
J075024L24TCGGCCCAGCCNONE 
J075038K01TCGGCCCAGCCNONE 
J075044L04TCGGCCCAGCCNONE 
J075063D23TCGGCCCAGCCNONE 
J075079P13TCGGCCCAGCCNONE 
J075084G03TCGGCCCAGCCNONE 
J075135G07TCGGCCCAGCCNONE 
J075148D17TCGGCCCAGCCNONE 
J075150F13TCGGCCCAGCCNONE 
J075157F06TCGGCCCAGCCNONE 
J090054A05TCGGCCCAGCCNONE 
J090085O04TCGGCCCAGCCNONE 
J100023C04TCGGCCCAGCCNONE 
J100023H23TCGGCCCAGCCNONE 
J100026A16TCGGCCCAGCCNONE 
J100035K13TCGGCCCAGCCNONE 
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein. 
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE 
Os02g0176400009-099-H11TCATGGGCCGAAANONE 
AK062746TCATGGGCCGAAAProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0188500AK102004AGCCCATACAACTGGGCCTCGGCCCATCANONE 
AK106917AGCCCATACAACTGGGCCTCGGCCCATCAUbiquitin domain containing protein. 
J090039N13AGCCCATACAACTGGGCCTCGGCCCATCANONE 
Os02g0192700004-020-H12TTTCGGCCCAACANONE 
006-024-H06TTTCGGCCCAACANONE 
006-042-F06TTTCGGCCCAACANONE 
006-050-D04TTTCGGCCCAACANONE 
006-059-E10TTTCGGCCCAACANONE 
006-070-B02TTTCGGCCCAACANONE 
006-084-A09TTTCGGCCCAACANONE 
006-114-E11TTTCGGCCCAACANONE 
006-117-E05TTTCGGCCCAACANONE 
009-126-D11TTTCGGCCCAACANONE 
AK061629TTTCGGCCCAACASimilar to Thioredoxin peroxidase. 
AK065909TTTCGGCCCAACANONE 
J013043E11TTTCGGCCCAACANONE 
J065038I09TTTCGGCCCAACANONE 
J065078C12TTTCGGCCCAACANONE 
J065122O14TTTCGGCCCAACANONE 
J065198H04TTTCGGCCCAACANONE 
Os02g0193500009-092-G09TCTCGGCCCATCANONE 
AK101237TCTCGGCCCATCAHypothetical protein. 
J033031K13TCTCGGCCCATCANONE 
J033034P12TCTCGGCCCATCANONE 
J080304L19TCTCGGCCCATCANONE 
J100059N21TCTCGGCCCATCANONE 
Os02g0198000AK067695TGTGGGCCGAGProtein of unknown function DUF1677, Oryza sativa family protein. 
Os02g0219200016-016-C03GTTTGGGCCGANONE 
AK059059GTTTGGGCCGASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase) (Exo-(1-->4)-beta-D-galactanase). 
Os02g0226900AK064279TTCGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0241100Os02g0241100TTCGGCCCAAAAProtein kinase-like domain containing protein. 
Os02g0266500AK100307TCGGCCCATTTSimilar to RASPBERRY3. 
Os02g0510300AK067961CTCGGCCCACAConserved hypothetical protein. 
AK104001CTCGGCCCACANONE 
J013123J20CTCGGCCCACANONE 
J065169H15CTCGGCCCACANONE 
Os02g0562700006-035-C05GCCGGCCCACGTCGGCCCATCANONE 
AB110167GCCGGCCCACGTCGGCCCATCANONE 
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61). 
AK104168GCCGGCCCACGTCGGCCCATCANONE 
AK109435GCCGGCCCACGTCGGCCCATCANONE 
AY224558GCCGGCCCACGTCGGCCCATCANONE 
J023013M13GCCGGCCCACGTCGGCCCATCANONE 
J023059I08GCCGGCCCACGTCGGCCCATCANONE 
J023084C06GCCGGCCCACGTCGGCCCATCANONE 
J023114G06GCCGGCCCACGTCGGCCCATCANONE 
J023142A09GCCGGCCCACGTCGGCCCATCANONE 
J033026E14GCCGGCCCACGTCGGCCCATCANONE 
J053042M10GCCGGCCCACGTCGGCCCATCANONE 
J053082K21GCCGGCCCACGTCGGCCCATCANONE 
J065105J15GCCGGCCCACGTCGGCCCATCANONE 
J065150F02GCCGGCCCACGTCGGCCCATCANONE 
J075177H05GCCGGCCCACGTCGGCCCATCANONE 
J080040B16GCCGGCCCACGTCGGCCCATCANONE 
J090077J10GCCGGCCCACGTCGGCCCATCANONE 
Os02g0591800AK060611TCGGCCCATAABrix domain containing protein. 
AK102534TCGGCCCATAANONE 
J075057H08TCGGCCCATAANONE 
J075179P18TCGGCCCATAANONE 
J080011H01TCGGCCCATAANONE 
J080018E14TCGGCCCATAANONE 
J080026N17TCGGCCCATAANONE 
J080047A13TCGGCCCATAANONE 
J080049C17TCGGCCCATAANONE 
J080050G07TCGGCCCATAANONE 
J080064D10TCGGCCCATAANONE 
J080080A03TCGGCCCATAANONE 
J080080G20TCGGCCCATAANONE 
J080080I03TCGGCCCATAANONE 
J080081H12TCGGCCCATAANONE 
J080090K07TCGGCCCATAANONE 
J080092O06TCGGCCCATAANONE 
J080096B07TCGGCCCATAANONE 
J080097M08TCGGCCCATAANONE 
Os02g0593900Os02g0593900TATTGGGCCGAAAMethyltransferases-related family protein. 
Os02g0616600AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
J065062G16CCGAGCCGGCCCAAATCGGCCCACACNONE 
Os02g0621500AK120798TTTCGGCCCAACCZinc finger, RING-type domain containing protein. 
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
Os02g0638400AK060633AGCCCAATGGCCCAGATGGGCCGABRO1 domain containing protein. 
J065083J17AGCCCAATGGCCCAGATGGGCCGANONE 
Os02g0643500AK068423TCTCGGCCCACAAPentapeptide repeat containing protein. 
Os02g0656500011-045-C08AAATGGGCCGAANONE 
011-045-E06AAATGGGCCGAANONE 
016-046-A01AAATGGGCCGAANONE 
016-046-B01AAATGGGCCGAANONE 
AK062239AAATGGGCCGAANONE 
AK066420AAATGGGCCGAADnaJ-like protein. 
J013067J21AAATGGGCCGAANONE 
J065047L09AAATGGGCCGAANONE 
J065104M20AAATGGGCCGAANONE 
J065134B04AAATGGGCCGAANONE 
J065152C10AAATGGGCCGAANONE 
J065161O03AAATGGGCCGAANONE 
J065169F18AAATGGGCCGAANONE 
J065210M21AAATGGGCCGAANONE 
J065217B03AAATGGGCCGAANONE 
J065218C10AAATGGGCCGAANONE 
J075041F09AAATGGGCCGAANONE 
J075048A02AAATGGGCCGAANONE 
J075083F21AAATGGGCCGAANONE 
J080005F10AAATGGGCCGAANONE 
J080013P21AAATGGGCCGAANONE 
J080027J09AAATGGGCCGAANONE 
J080037O17AAATGGGCCGAANONE 
J080039F02AAATGGGCCGAANONE 
J080039G01AAATGGGCCGAANONE 
J080041I09AAATGGGCCGAANONE 
J080043M01AAATGGGCCGAANONE 
J080060H17AAATGGGCCGAANONE 
J080062O07AAATGGGCCGAANONE 
J080079F05AAATGGGCCGAANONE 
J080093H04AAATGGGCCGAANONE 
J080096B15AAATGGGCCGAANONE 
J080097H24AAATGGGCCGAANONE 
J090032O11AAATGGGCCGAANONE 
J090044F01AAATGGGCCGAANONE 
J090045E04AAATGGGCCGAANONE 
J090048O03AAATGGGCCGAANONE 
J090049E04AAATGGGCCGAANONE 
J090070E19AAATGGGCCGAANONE 
J090079E13AAATGGGCCGAANONE 
J090089L14AAATGGGCCGAANONE 
J090095K13AAATGGGCCGAANONE 
J090096I19AAATGGGCCGAANONE 
J090098B04AAATGGGCCGAANONE 
J100027P13AAATGGGCCGAANONE 
J100048H06AAATGGGCCGAANONE 
J100060J15AAATGGGCCGAANONE 
J100070K16AAATGGGCCGAANONE 
J100074O22AAATGGGCCGAANONE 
Os02g0665400AK073914TGGATGGGCCGANONE 
AK109787TGGATGGGCCGANONE 
AK120141TGGATGGGCCGASimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19TGGATGGGCCGANONE 
J075165B08TGGATGGGCCGANONE 
J075177B03TGGATGGGCCGANONE 
J075191K02TGGATGGGCCGANONE 
J090051I12TGGATGGGCCGANONE 
J090057E21TGGATGGGCCGANONE 
J090058E01TGGATGGGCCGANONE 
J090087C06TGGATGGGCCGANONE 
J100025K07TGGATGGGCCGANONE 
J100026I21TGGATGGGCCGANONE 
J100041E12TGGATGGGCCGANONE 
J100083B01TGGATGGGCCGANONE 
Os02g0679200AK110789TTCGGCCCATACTetratricopeptide-like helical domain containing protein. 
Os02g0736500AK065166TAATGGGCCGAANicastrin family protein. 
J013099D16TAATGGGCCGAANONE 
Os02g0740300AK067833TTCGGCCCATATAAA ATPase domain containing protein. 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
Os02g0757900006-114-B06AGATGGGCCGANONE 
AK061269AGATGGGCCGASimilar to Poly(A)-binding protein II-like. 
AK071146AGATGGGCCGANONE 
J023081D16AGATGGGCCGANONE 
J043034B17AGATGGGCCGANONE 
J065027M09AGATGGGCCGANONE 
J065043F02AGATGGGCCGANONE 
J065086G05AGATGGGCCGANONE 
J065093A05AGATGGGCCGANONE 
J065109F16AGATGGGCCGANONE 
J065130N09AGATGGGCCGANONE 
J065154D24AGATGGGCCGANONE 
J065199L11AGATGGGCCGANONE 
J075166H22AGATGGGCCGANONE 
Os02g0758000013-065-E04TCGGCCCATCTNONE 
014-002-E03TCGGCCCATCTNONE 
014-004-B07TCGGCCCATCTNONE 
014-038-F03TCGGCCCATCTNONE 
014-072-G02TCGGCCCATCTNONE 
014-078-E02TCGGCCCATCTNONE 
014-081-H11TCGGCCCATCTNONE 
016-060-C11TCGGCCCATCTNONE 
AK064389TCGGCCCATCTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003TCGGCCCATCTNONE 
AK105464TCGGCCCATCTNONE 
J033076P21TCGGCCCATCTNONE 
Os02g0759800012-036-G11TCGGCCCAGCCCAAATNONE 
AK067153TCGGCCCAGCCCAAATSimilar to GAMYB-binding protein (Fragment). 
AK071666TCGGCCCAGCCCAAATNONE 
J013098N03TCGGCCCAGCCCAAATNONE 
J023100L02TCGGCCCAGCCCAAATNONE 
J023106G20TCGGCCCAGCCCAAATNONE 
J033057G09TCGGCCCAGCCCAAATNONE 
J100043H19TCGGCCCAGCCCAAATNONE 
J100061H16TCGGCCCAGCCCAAATNONE 
J100079O17TCGGCCCAGCCCAAATNONE 
Os02g0767100011-054-E05AGATGGGCCGAGNONE 
AK063351AGATGGGCCGAGNONE 
AK103640AGATGGGCCGAGConserved hypothetical protein. 
J090022G11AGATGGGCCGAGNONE 
J090072L18AGATGGGCCGAGNONE 
Os02g0769700AK111328ACATGGGCCGAProtein kinase-like domain containing protein. 
Os02g0776800AB042415ACGTGGGCCGAGNONE 
AK072308ACGTGGGCCGAGReplication protein A 70kDa. 
AK101212ACGTGGGCCGAGNONE 
J033031B02ACGTGGGCCGAGNONE 
J090004E18ACGTGGGCCGAGNONE 
J090084C24ACGTGGGCCGAGNONE 
Os02g0778600AK100098TCTGGGCCGAANONE 
AK100190TCTGGGCCGAANONE 
AK106971TCTGGGCCGAASimilar to CEL5=CELLULASE 5 (Fragment). 
J065021O09TCTGGGCCGAANONE 
Os02g0780800J090080O19TTTCGGCCCATTTNONE 
J090091I06TTTCGGCCCATTTNONE 
Os02g0782500013-043-A07TTCGGCCCAATNONE 
013-068-B10TTCGGCCCAATNONE 
013-093-A08TTCGGCCCAATNONE 
014-083-C12TTCGGCCCAATNONE 
AK063602TTCGGCCCAATNONE 
AK119261TTCGGCCCAATSimilar to Small heat stress protein class CIII. 
J065013N12TTCGGCCCAATNONE 
J075136E01TTCGGCCCAATNONE 
J075149G04TTCGGCCCAATNONE 
Os02g0788500006-024-A02AGATGGGCCGAGNONE 
006-031-G02AGATGGGCCGAGNONE 
006-081-F11AGATGGGCCGAGNONE 
006-082-H05AGATGGGCCGAGNONE 
AK061452AGATGGGCCGAGConserved hypothetical protein. 
AK104117AGATGGGCCGAGNONE 
AK104526AGATGGGCCGAGNONE 
J075024D11AGATGGGCCGAGNONE 
J075056B12AGATGGGCCGAGNONE 
J075108H12AGATGGGCCGAGNONE 
J075156P10AGATGGGCCGAGNONE 
J075197A19AGATGGGCCGAGNONE 
Os02g0791300J100026B09TCTCGGCCCAGANONE 
J100039D05TCTCGGCCCAGAHelix-loop-helix DNA-binding domain containing protein. 
Os02g0804300006-046-D12TCTCGGCCCATTTCACGTGTCNONE 
AK060165TCTCGGCCCATTTCACGTGTCNONE 
AK067584TCTCGGCCCATTTCACGTGTCSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12TCTCGGCCCATTTCACGTGTCNONE 
J023098C22TCTCGGCCCATTTCACGTGTCNONE 
J033123P06TCTCGGCCCATTTCACGTGTCNONE 
J065060N24TCTCGGCCCATTTCACGTGTCNONE 
J065069H22TCTCGGCCCATTTCACGTGTCNONE 
J065155N20TCTCGGCCCATTTCACGTGTCNONE 
J065170K07TCTCGGCCCATTTCACGTGTCNONE 
J090033D12TCTCGGCCCATTTCACGTGTCNONE 
Os02g0810300AK059363TCGGCCCAAGGCCCAGTASimilar to NBD-like protein. 
AK099203TCGGCCCAAGGCCCAGTANONE 
Os02g0819100AK100156TTCGGCCCATTAZinc finger, DHHC-type domain containing protein. 
J013088C21TTCGGCCCATTANONE 
Os02g0819700AK067374CTCGGCCCAGTTZinc finger, Zim17-type family protein. 
AK067374GTTTGGGCCGAAZinc finger, Zim17-type family protein. 
AK067374TCGGCCCACAAZinc finger, Zim17-type family protein. 
AK099160CTCGGCCCAGTTNONE 
AK099160GTTTGGGCCGAANONE 
AK099160TCGGCCCACAANONE 
J100086K17CTCGGCCCAGTTNONE 
J100086K17GTTTGGGCCGAANONE 
J100086K17TCGGCCCACAANONE 
Os02g0829900009-044-G07AACTGGGCCGAANONE 
AK120917AACTGGGCCGAASimilar to BRICK1. 
AY224582AACTGGGCCGAANONE 
J023034L01AACTGGGCCGAANONE 
J023034M01AACTGGGCCGAANONE 
J090010G06AACTGGGCCGAANONE 
J090020D07AACTGGGCCGAANONE 
J100041L04AACTGGGCCGAANONE 
J100061D05AACTGGGCCGAANONE 
J100070L18AACTGGGCCGAANONE 
Os02g0830000011-075-D11TTCGGCCCAGTTNONE 
AK101841TTCGGCCCAGTTProtein prenyltransferase domain containing protein. 
J033069G13TTCGGCCCAGTTNONE 
Os02g0834700AK061331CTCGGCCCAAATNONE 
AK067965CTCGGCCCAAATSimilar to Cell division inhibitor. 
Os03g0115200009-112-E09TTTCGGCCCAATANONE 
AK071287TTTCGGCCCAATASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06TTTCGGCCCAATANONE 
J065075D17TTTCGGCCCAATANONE 
J065108G15TTTCGGCCCAATANONE 
J065165A16TTTCGGCCCAATANONE 
J075015O12TTTCGGCCCAATANONE 
J075022O06TTTCGGCCCAATANONE 
J075031H14TTTCGGCCCAATANONE 
J075033D10TTTCGGCCCAATANONE 
J075070A04TTTCGGCCCAATANONE 
J075127A05TTTCGGCCCAATANONE 
J100070B16TTTCGGCCCAATANONE 
Os03g0116500AF106844TAATGGGCCGANONE 
AK101870TAATGGGCCGAConstitutive photomorphogenic 11. 
J023055L16TAATGGGCCGANONE 
J023088I16TAATGGGCCGANONE 
J033070E21TAATGGGCCGANONE 
J065124N22TAATGGGCCGANONE 
J075152A19TAATGGGCCGANONE 
J075181J21TAATGGGCCGANONE 
J090011F23TAATGGGCCGANONE 
Os03g0120300AK066854TTTCGGCCCATATProtein of unknown function DUF1084 family protein. 
AK104882TTTCGGCCCATATNONE 
J013075C10TTTCGGCCCATATNONE 
J090012B18TTTCGGCCCATATNONE 
J090087J08TTTCGGCCCATATNONE 
Os03g0125000006-032-D09CGATGGGCCGAANONE 
006-033-B05CGATGGGCCGAANONE 
006-048-G06CGATGGGCCGAANONE 
006-048-G09CGATGGGCCGAANONE 
006-052-D09CGATGGGCCGAANONE 
006-072-A04CGATGGGCCGAANONE 
006-076-F12CGATGGGCCGAANONE 
006-080-B03CGATGGGCCGAANONE 
006-092-H03CGATGGGCCGAANONE 
006-103-G04CGATGGGCCGAANONE 
009-079-E01CGATGGGCCGAANONE 
009-150-F03CGATGGGCCGAANONE 
AF095708CGATGGGCCGAANONE 
AK059557CGATGGGCCGAANONE 
AK070779CGATGGGCCGAASimilar to 50S ribosomal protein L5, chloroplast. 
AK098999CGATGGGCCGAANONE 
AK104137CGATGGGCCGAANONE 
J065002D07CGATGGGCCGAANONE 
J065167E24CGATGGGCCGAANONE 
J075199O14CGATGGGCCGAANONE 
J100083L01CGATGGGCCGAANONE 
Os03g0125700009-132-G03TAATGGGCCGAAANONE 
AK062913TAATGGGCCGAAAConserved hypothetical protein. 
J075046C16TAATGGGCCGAAANONE 
J075115L05TAATGGGCCGAAANONE 
J075143I05TAATGGGCCGAAANONE 
J075197O07TAATGGGCCGAAANONE 
Os03g0138600Os03g0138600AGTTGGGCCGAAGAAGCCCATAProtein of unknown function DUF810 family protein. 
Os03g0161400Os03g0161400TCGGCCCAACCIQ calmodulin-binding region domain containing protein. 
Os03g0162200009-031-E05GTTTGGGCCGAGNONE 
013-049-D04GTTTGGGCCGAGNONE 
013-082-E03GTTTGGGCCGAGNONE 
014-039-G04GTTTGGGCCGAGNONE 
014-098-G11GTTTGGGCCGAGNONE 
AK061605GTTTGGGCCGAGNONE 
AK121533GTTTGGGCCGAGSimilar to Histone H2A. 
J033024D06GTTTGGGCCGAGNONE 
J033030P21GTTTGGGCCGAGNONE 
J065063C20GTTTGGGCCGAGNONE 
J065064A18GTTTGGGCCGAGNONE 
J065147G02GTTTGGGCCGAGNONE 
J065204K06GTTTGGGCCGAGNONE 
J090004C22GTTTGGGCCGAGNONE 
J090014K02GTTTGGGCCGAGNONE 
J090074E10GTTTGGGCCGAGNONE 
J090086L09GTTTGGGCCGAGNONE 
Os03g0220700J100064H16TCGGCCCACTNONE 
Os03g0243300013-024-B05GGACGGACGTGGGCCGAANONE 
AB010740GGACGGACGTGGGCCGAANONE 
AB037151GGACGGACGTGGGCCGAASimilar to 26S proteasome non-ATPase regulatory subunit 4 (26S proteasome regulatory subunit S5A) (Multiubiquitin chain binding protein). 
AK073601GGACGGACGTGGGCCGAANONE 
J023010M13GGACGGACGTGGGCCGAANONE 
J023030M11GGACGGACGTGGGCCGAANONE 
J023066I02GGACGGACGTGGGCCGAANONE 
J023080H21GGACGGACGTGGGCCGAANONE 
J023123O15GGACGGACGTGGGCCGAANONE 
J033029N24GGACGGACGTGGGCCGAANONE 
J033031G18GGACGGACGTGGGCCGAANONE 
J033046D23GGACGGACGTGGGCCGAANONE 
J033046P11GGACGGACGTGGGCCGAANONE 
J033079C14GGACGGACGTGGGCCGAANONE 
J033125G12GGACGGACGTGGGCCGAANONE 
J033133I21GGACGGACGTGGGCCGAANONE 
J033141F22GGACGGACGTGGGCCGAANONE 
J065035O21GGACGGACGTGGGCCGAANONE 
J090008P15GGACGGACGTGGGCCGAANONE 
J090033F15GGACGGACGTGGGCCGAANONE 
J090059A16GGACGGACGTGGGCCGAANONE 
J090080N01GGACGGACGTGGGCCGAANONE 
J100022C16GGACGGACGTGGGCCGAANONE 
J100023K05GGACGGACGTGGGCCGAANONE 
J100043B19GGACGGACGTGGGCCGAANONE 
J100046G11GGACGGACGTGGGCCGAANONE 
J100049L11GGACGGACGTGGGCCGAANONE 
J100054M01GGACGGACGTGGGCCGAANONE 
J100068G15GGACGGACGTGGGCCGAANONE 
J100085A18GGACGGACGTGGGCCGAANONE 
Os03g0243350J065025D24TTCGGCCCACGTCCGTCCNONE 
J065046A15TTCGGCCCACGTCCGTCCHypothetical protein. 
J065064E08TTCGGCCCACGTCCGTCCNONE 
Os03g0249400009-059-H08AGTTGGGCCGAGANONE 
AK062522AGTTGGGCCGAGASimilar to 40S ribosomal protein S20 (S22) (Fragment). 
J053031I05AGTTGGGCCGAGANONE 
J053052E06AGTTGGGCCGAGANONE 
J053061K22AGTTGGGCCGAGANONE 
J065108I02AGTTGGGCCGAGANONE 
Os03g0253100AK119618TTCGGCCCATTTPhosphomevalonate kinase Erg8 family protein. 
J033052A14TTCGGCCCATTTNONE 
Os03g0257600Os03g0257600TCGGCCCAACProtein of unknown function DUF292, eukaryotic domain containing protein. 
Os03g0257900009-150-G06AATTGGGCCTTTTTGGGCCGANONE 
009-181-H05AATTGGGCCTTTTTGGGCCGANONE 
AK063892AATTGGGCCTTTTTGGGCCGANONE 
AK100114AATTGGGCCTTTTTGGGCCGASimilar to Lectin-like receptor kinase 7;2. 
AK103486AATTGGGCCTTTTTGGGCCGANONE 
J023006K11AATTGGGCCTTTTTGGGCCGANONE 
J075005E15AATTGGGCCTTTTTGGGCCGANONE 
J075007K24AATTGGGCCTTTTTGGGCCGANONE 
J075034G06AATTGGGCCTTTTTGGGCCGANONE 
J075051I19AATTGGGCCTTTTTGGGCCGANONE 
J075076A08AATTGGGCCTTTTTGGGCCGANONE 
J075096H04AATTGGGCCTTTTTGGGCCGANONE 
J075115I09AATTGGGCCTTTTTGGGCCGANONE 
J075132K23AATTGGGCCTTTTTGGGCCGANONE 
J075147C17AATTGGGCCTTTTTGGGCCGANONE 
J090059O20AATTGGGCCTTTTTGGGCCGANONE 
Os03g0266900013-080-C12ATTTGGGCCGAAANONE 
014-010-A09ATTTGGGCCGAAANONE 
014-013-G10ATTTGGGCCGAAANONE 
014-019-D06ATTTGGGCCGAAANONE 
014-030-F08ATTTGGGCCGAAANONE 
014-039-C05ATTTGGGCCGAAANONE 
014-053-H08ATTTGGGCCGAAANONE 
014-089-F06ATTTGGGCCGAAANONE 
014-094-A05ATTTGGGCCGAAANONE 
014-098-C12ATTTGGGCCGAAANONE 
AK119243ATTTGGGCCGAAALow molecular mass heat shock protein Oshsp17.3. 
AK119717ATTTGGGCCGAAANONE 
D12635ATTTGGGCCGAAANONE 
M80186ATTTGGGCCGAAANONE 
Os03g0270000006-051-C05ATTGGGCCGANONE 
006-100-A03ATTGGGCCGANONE 
006-114-F11ATTGGGCCGANONE 
AK061579ATTGGGCCGANONE 
AK106069ATTGGGCCGAProtein of unknown function DUF296 domain containing protein. 
J023102O16ATTGGGCCGANONE 
J065017C10ATTGGGCCGANONE 
J065059M01ATTGGGCCGANONE 
J065104I08ATTGGGCCGANONE 
J065120B10ATTGGGCCGANONE 
J065130K08ATTGGGCCGANONE 
J065140F09ATTGGGCCGANONE 
J065166E07ATTGGGCCGANONE 
Os03g0270200012-009-A03TCGGCCCACGTNONE 
AK066896TCGGCCCACGTNONE 
AK102826TCGGCCCACGTSplicing factor PWI domain containing protein. 
J013042L05TCGGCCCACGTNONE 
J013091L22TCGGCCCACGTNONE 
J013096P13TCGGCCCACGTNONE 
J013118M15TCGGCCCACGTNONE 
J013151N20TCGGCCCACGTNONE 
J033061D07TCGGCCCACGTNONE 
J033086L04TCGGCCCACGTNONE 
J033099J11TCGGCCCACGTNONE 
J033109C10TCGGCCCACGTNONE 
J033116F13TCGGCCCACGTNONE 
J065019F13TCGGCCCACGTNONE 
J065089O14TCGGCCCACGTNONE 
J065158D07TCGGCCCACGTNONE 
J065160G19TCGGCCCACGTNONE 
J065168N10TCGGCCCACGTNONE 
J065208E17TCGGCCCACGTNONE 
J075001A15TCGGCCCACGTNONE 
J075010G15TCGGCCCACGTNONE 
J075016L23TCGGCCCACGTNONE 
J075019A06TCGGCCCACGTNONE 
J075023B13TCGGCCCACGTNONE 
J075032P15TCGGCCCACGTNONE 
J075045F05TCGGCCCACGTNONE 
J075053O13TCGGCCCACGTNONE 
J075057P06TCGGCCCACGTNONE 
J075061C19TCGGCCCACGTNONE 
J075078B10TCGGCCCACGTNONE 
J075086A20TCGGCCCACGTNONE 
J075127A16TCGGCCCACGTNONE 
J075128E07TCGGCCCACGTNONE 
J075129C06TCGGCCCACGTNONE 
J075130M14TCGGCCCACGTNONE 
J075136H13TCGGCCCACGTNONE 
J075149M17TCGGCCCACGTNONE 
J075156L08TCGGCCCACGTNONE 
J075160P12TCGGCCCACGTNONE 
J075164J01TCGGCCCACGTNONE 
J075173N05TCGGCCCACGTNONE 
J075177O03TCGGCCCACGTNONE 
J075188K11TCGGCCCACGTNONE 
J090009A02TCGGCCCACGTNONE 
J090019O12TCGGCCCACGTNONE 
J090065H05TCGGCCCACGTNONE 
J090067E24TCGGCCCACGTNONE 
J090080C03TCGGCCCACGTNONE 
J090090A04TCGGCCCACGTNONE 
J090098D13TCGGCCCACGTNONE 
J100060D03TCGGCCCACGTNONE 
J100062D05TCGGCCCACGTNONE 
J100074A08TCGGCCCACGTNONE 
Os03g0283100006-097-E01ATTTGGGCCGAGNONE 
AK061849ATTTGGGCCGAGNONE 
AK065887ATTTGGGCCGAGSimilar to In2-1 protein. 
J013044J05ATTTGGGCCGAGNONE 
J013130I02ATTTGGGCCGAGNONE 
J013162M18ATTTGGGCCGAGNONE 
J023014O17ATTTGGGCCGAGNONE 
J023139N17ATTTGGGCCGAGNONE 
Os03g0299600009-037-H11TCTCGGCCCAGACTGACAGNONE 
011-072-E02TCTCGGCCCAGACTGACAGNONE 
AK068151TCTCGGCCCAGACTGACAGWound-induced WI12 family protein. 
J013132L05TCTCGGCCCAGACTGACAGNONE 
J023012P15TCTCGGCCCAGACTGACAGNONE 
J023022H03TCTCGGCCCAGACTGACAGNONE 
J023026N15TCTCGGCCCAGACTGACAGNONE 
J023056A21TCTCGGCCCAGACTGACAGNONE 
J023093P10TCTCGGCCCAGACTGACAGNONE 
J075143J10TCTCGGCCCAGACTGACAGNONE 
J075166I19TCTCGGCCCAGACTGACAGNONE 
J090010G13TCTCGGCCCAGACTGACAGNONE 
J090033D23TCTCGGCCCAGACTGACAGNONE 
J090090L22TCTCGGCCCAGACTGACAGNONE 
Os03g0302700006-099-F12ATTTGGGCCGAAANONE 
AK112010ATTTGGGCCGAAAZinc finger, RING-type domain containing protein. 
AK121656ATTTGGGCCGAAANONE 
J075090A19ATTTGGGCCGAAANONE 
J075148M06ATTTGGGCCGAAANONE 
Os03g0321800006-065-G02GGCCGTGGGCCGAGANONE 
AK061075GGCCGTGGGCCGAGANONE 
AK111447GGCCGTGGGCCGAGASimilar to WRKY transcription factor 55. 
J065122E07GGCCGTGGGCCGAGANONE 
J065187N05GGCCGTGGGCCGAGANONE 
J065214K09GGCCGTGGGCCGAGANONE 
J090050M01GGCCGTGGGCCGAGANONE 
Os03g0333000AK109811TGATGGGCCGAGConserved hypothetical protein. 
J065152D04TGATGGGCCGAGNONE 
J090011B05TGATGGGCCGAGNONE 
Os03g0333100AK101050CTCGGCCCATCAProtein of unknown function DUF663 domain containing protein. 
Os03g0336000AK100067CTCGGCCCATCTProtein prenyltransferase domain containing protein. 
J065161K02CTCGGCCCATCTNONE 
J065162C21CTCGGCCCATCTNONE 
Os03g0337600AF119232ACGTGGGCCGANONE 
AF119232CTCGGCCCAGTNONE 
AK070859ACGTGGGCCGASimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
AK070859CTCGGCCCAGTSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18ACGTGGGCCGANONE 
J013110I18CTCGGCCCAGTNONE 
J013147M17ACGTGGGCCGANONE 
J013147M17CTCGGCCCAGTNONE 
J065083M01ACGTGGGCCGANONE 
J065083M01CTCGGCCCAGTNONE 
J065199H24ACGTGGGCCGANONE 
J065199H24CTCGGCCCAGTNONE 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0338600AK066604CTTGGGCCGAtRNA pseudouridine synthase family protein. 
Os03g0343500009-042-G06CTCGGCCCATTANONE 
009-063-D01CTCGGCCCATTANONE 
009-156-H09CTCGGCCCATTANONE 
AB117995CTCGGCCCATTANONE 
AK058737CTCGGCCCATTANONE 
AK059599CTCGGCCCATTASimilar to 60S ribosomal protein L22-2. 
AK121502CTCGGCCCATTANONE 
J023082D10CTCGGCCCATTANONE 
J033022G11CTCGGCCCATTANONE 
J075048M16CTCGGCCCATTANONE 
J075049O20CTCGGCCCATTANONE 
J075082I02CTCGGCCCATTANONE 
J075105G01CTCGGCCCATTANONE 
J075131K05CTCGGCCCATTANONE 
J080002H01CTCGGCCCATTANONE 
J080003H01CTCGGCCCATTANONE 
J080005G08CTCGGCCCATTANONE 
J080011M13CTCGGCCCATTANONE 
J080020M02CTCGGCCCATTANONE 
J080026N24CTCGGCCCATTANONE 
J080028L09CTCGGCCCATTANONE 
J080032O14CTCGGCCCATTANONE 
J080033J12CTCGGCCCATTANONE 
J080035D05CTCGGCCCATTANONE 
J080039H01CTCGGCCCATTANONE 
J080044B07CTCGGCCCATTANONE 
J080044E23CTCGGCCCATTANONE 
J080049N11CTCGGCCCATTANONE 
J080050A21CTCGGCCCATTANONE 
J080055L24CTCGGCCCATTANONE 
J080059N20CTCGGCCCATTANONE 
J080061F04CTCGGCCCATTANONE 
J080078I16CTCGGCCCATTANONE 
J080079G24CTCGGCCCATTANONE 
J080080K13CTCGGCCCATTANONE 
J080083G20CTCGGCCCATTANONE 
J080087B08CTCGGCCCATTANONE 
J080091L19CTCGGCCCATTANONE 
J080094D06CTCGGCCCATTANONE 
J090038L06CTCGGCCCATTANONE 
J090075H06CTCGGCCCATTANONE 
J090081D12CTCGGCCCATTANONE 
Os03g0347800AK073756TCGGCCCAAACPeptidyl-tRNA hydrolase family protein. 
Os03g0349000011-089-G05AGATGGGCCGANONE 
AK099999AGATGGGCCGANucleoporin interacting component family protein. 
J013134K18AGATGGGCCGANONE 
J033024G23AGATGGGCCGANONE 
J033098A12AGATGGGCCGANONE 
J090001N18AGATGGGCCGANONE 
J090058F11AGATGGGCCGANONE 
J090065C04AGATGGGCCGANONE 
J100067M17AGATGGGCCGANONE 
J100083P13AGATGGGCCGANONE 
Os03g0372700AK064323GGTTGGGCCGAAANONE 
AK073312GGTTGGGCCGAAALow temperature viability protein family protein. 
Os03g0390400009-175-E06TTCGGCCCAACTNONE 
013-040-G01TTCGGCCCAACTNONE 
014-050-G05TTCGGCCCAACTNONE 
AB025187TTCGGCCCAACTSimilar to Cytochrome c oxidase subunit 6b. 
AK120174TTCGGCCCAACTNONE 
J013033A17TTCGGCCCAACTNONE 
J023028J08TTCGGCCCAACTNONE 
J023061N05TTCGGCCCAACTNONE 
J023077A03TTCGGCCCAACTNONE 
J023086E01TTCGGCCCAACTNONE 
J033022A08TTCGGCCCAACTNONE 
J033040F24TTCGGCCCAACTNONE 
J075073I24TTCGGCCCAACTNONE 
J075081H01TTCGGCCCAACTNONE 
J075175N19TTCGGCCCAACTNONE 
J100025M03TTCGGCCCAACTNONE 
J100036J06TTCGGCCCAACTNONE 
J100045O18TTCGGCCCAACTNONE 
J100062G15TTCGGCCCAACTNONE 
J100090N19TTCGGCCCAACTNONE 
Os03g0448600AK111867CTCGGCCCATGWD40-like domain containing protein. 
Os03g0566800AK103270AGTGGGCCGAGSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18AGTGGGCCGAGNONE 
J023136P06AGTGGGCCGAGNONE 
J033081A22AGTGGGCCGAGNONE 
J033109N12AGTGGGCCGAGNONE 
J033124H10AGTGGGCCGAGNONE 
J033141B09AGTGGGCCGAGNONE 
J090026G23AGTGGGCCGAGNONE 
J090077J20AGTGGGCCGAGNONE 
Os03g0647500015-025-E10CTCGGCCCACAANONE 
AK064308CTCGGCCCACAAConserved hypothetical protein. 
AK103649CTCGGCCCACAANONE 
J033135D01CTCGGCCCACAANONE 
Os03g0656900AK066416TTTCGGCCCATGANusB/RsmB/TIM44 domain containing protein. 
J065157L23TTTCGGCCCATGANONE 
J065166P22TTTCGGCCCATGANONE 
Os03g0668900AK108369AATGGGCCGAAConserved hypothetical protein. 
Os03g0681900006-042-F08TCGGCCCAATTNONE 
009-043-F12TCGGCCCAATTNONE 
AK061750TCGGCCCAATTNONE 
AK062094TCGGCCCAATTSimilar to RGP-3 (Fragment). 
J033034F01TCGGCCCAATTNONE 
J033131F11TCGGCCCAATTNONE 
J033143N03TCGGCCCAATTNONE 
Os03g0712200AK073205TCGGCCCAAACZinc finger, RanBP2-type domain containing protein. 
AK098968TCGGCCCAAACNONE 
Os03g0734700AK072060TTCGGCCCATCCMitochondrial substrate carrier family protein. 
AK120533TTCGGCCCATCCNONE 
J043026E20TTCGGCCCATCCNONE 
Os03g0737600014-094-E01TACTGGGCCGAGCCGNONE 
AB038234TACTGGGCCGAGCCGNONE 
AK101854TACTGGGCCGAGCCGCyclin H-1. 
AK105468TACTGGGCCGAGCCGNONE 
J033069N12TACTGGGCCGAGCCGNONE 
J043017A22TACTGGGCCGAGCCGNONE 
J065154A20TACTGGGCCGAGCCGNONE 
Os03g0740700011-093-H12CGGGCCGATGGGCCGANONE 
AK102723CGGGCCGATGGGCCGAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19CGGGCCGATGGGCCGANONE 
J013126N16CGGGCCGATGGGCCGANONE 
J033105J16CGGGCCGATGGGCCGANONE 
J090059D19CGGGCCGATGGGCCGANONE 
Os03g0744800AK059983TCTCGGCCCAGCCCAAATemp24/gp25L/p24 family protein. 
J065067D01TCTCGGCCCAGCCCAAATNONE 
J065122L19TCTCGGCCCAGCCCAAATNONE 
J090041I03TCTCGGCCCAGCCCAAATNONE 
J100039H03TCTCGGCCCAGCCCAAATNONE 
Os03g0746000AK073682TTTCGGCCCAGGConserved hypothetical protein. 
AK111472TTTCGGCCCAGGNONE 
J090083F05TTTCGGCCCAGGNONE 
Os03g0748500AK110695TTTCGGCCCAAGNONE 
AK110695TTTCGGCCCAAGNONE 
Os03g0749900006-112-A05CTCGGCCCACCTAGGCCCATTTNONE 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
J023020I01CTCGGCCCACCTAGGCCCATTTNONE 
J033060N21CTCGGCCCACCTAGGCCCATTTNONE 
Os03g0752800AB041020TCGGCCCAGAAAAGCCCACGANONE 
AF058697TCGGCCCAGAAAAGCCCACGAMADS14 protein. 
AF139664TCGGCCCAGAAAAGCCCACGANONE 
AK121171TCGGCCCAGAAAAGCCCACGANONE 
AY332478TCGGCCCAGAAAAGCCCACGANONE 
AY551916TCGGCCCAGAAAAGCCCACGANONE 
J023081C04TCGGCCCAGAAAAGCCCACGANONE 
Os03g0763000AK120812CCTGGGCCGAASimilar to Casein kinase II alpha subunit. 
AK120812GTTGGGCCGAACAGCCCASimilar to Casein kinase II alpha subunit. 
Os03g0767700AK073586TCGGCCCAATAAACGGGCCCGGTConserved hypothetical protein. 
J033050D05TCGGCCCAATAAACGGGCCCGGTNONE 
Os03g0784400AK103474CAAGCCCAATGGGCCGAGAProtein of unknown function DUF1692 domain containing protein. 
J023135I15CAAGCCCAATGGGCCGAGANONE 
J033130D12CAAGCCCAATGGGCCGAGANONE 
J043035E20CAAGCCCAATGGGCCGAGANONE 
J065206K15CAAGCCCAATGGGCCGAGANONE 
J075053J20CAAGCCCAATGGGCCGAGANONE 
J075129B11CAAGCCCAATGGGCCGAGANONE 
J090003E22CAAGCCCAATGGGCCGAGANONE 
J100023E23CAAGCCCAATGGGCCGAGANONE 
Os03g0784900006-053-H11CGATGGGCCGAGANONE 
009-165-F11CGATGGGCCGAGANONE 
AK060949CGATGGGCCGAGAConserved hypothetical protein. 
AK099097CGATGGGCCGAGANONE 
J023019M19CGATGGGCCGAGANONE 
J065024O11CGATGGGCCGAGANONE 
J065106D20CGATGGGCCGAGANONE 
J065201L15CGATGGGCCGAGANONE 
J075031B04CGATGGGCCGAGANONE 
J075033C19CGATGGGCCGAGANONE 
J075035F11CGATGGGCCGAGANONE 
J075074K14CGATGGGCCGAGANONE 
J075083A22CGATGGGCCGAGANONE 
J075120O10CGATGGGCCGAGANONE 
J075153L20CGATGGGCCGAGANONE 
J075159G02CGATGGGCCGAGANONE 
J080001J18CGATGGGCCGAGANONE 
J080015I03CGATGGGCCGAGANONE 
J080027E23CGATGGGCCGAGANONE 
J080046D24CGATGGGCCGAGANONE 
J080053B17CGATGGGCCGAGANONE 
J080070P07CGATGGGCCGAGANONE 
J080076D18CGATGGGCCGAGANONE 
J080078E13CGATGGGCCGAGANONE 
J080090H03CGATGGGCCGAGANONE 
J100024F19CGATGGGCCGAGANONE 
J100052D15CGATGGGCCGAGANONE 
J100079B14CGATGGGCCGAGANONE 
Os03g0786500016-056-D08AGATGGGCCGANONE 
AK106487AGATGGGCCGASimilar to Glycine-rich protein 2. 
J080001C23AGATGGGCCGANONE 
J080005A02AGATGGGCCGANONE 
J080009A14AGATGGGCCGANONE 
J080009B11AGATGGGCCGANONE 
J080011L03AGATGGGCCGANONE 
J080017E21AGATGGGCCGANONE 
J080018H08AGATGGGCCGANONE 
J080021E11AGATGGGCCGANONE 
J080025O20AGATGGGCCGANONE 
J080026H21AGATGGGCCGANONE 
J080029I10AGATGGGCCGANONE 
J080036L01AGATGGGCCGANONE 
J080038M15AGATGGGCCGANONE 
J080051H09AGATGGGCCGANONE 
J080053E18AGATGGGCCGANONE 
J080054I12AGATGGGCCGANONE 
J080055B14AGATGGGCCGANONE 
J080060L16AGATGGGCCGANONE 
J080067G06AGATGGGCCGANONE 
J080069K14AGATGGGCCGANONE 
J080070N14AGATGGGCCGANONE 
J080071G10AGATGGGCCGANONE 
J080076D08AGATGGGCCGANONE 
J080076O11AGATGGGCCGANONE 
J080078E10AGATGGGCCGANONE 
J080079B15AGATGGGCCGANONE 
J080079K03AGATGGGCCGANONE 
J080079O15AGATGGGCCGANONE 
J080087B18AGATGGGCCGANONE 
Os03g0795900012-092-G05AGATGGGCCGANONE 
012-092-G05CTCGGCCCAATNONE 
015-043-D09AGATGGGCCGANONE 
015-043-D09CTCGGCCCAATNONE 
016-078-G11AGATGGGCCGANONE 
016-078-G11CTCGGCCCAATNONE 
AK068660AGATGGGCCGASimilar to Heat shock transcription factor 31 (Fragment). 
AK068660CTCGGCCCAATSimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14AGATGGGCCGANONE 
J013162K14CTCGGCCCAATNONE 
J023001L04AGATGGGCCGANONE 
J023001L04CTCGGCCCAATNONE 
J053032K11AGATGGGCCGANONE 
J053032K11CTCGGCCCAATNONE 
J065059E10AGATGGGCCGANONE 
J065059E10CTCGGCCCAATNONE 
J065095H19AGATGGGCCGANONE 
J065095H19CTCGGCCCAATNONE 
J065181M06AGATGGGCCGANONE 
J065181M06CTCGGCCCAATNONE 
J100047D11AGATGGGCCGANONE 
J100047D11CTCGGCCCAATNONE 
J100068G04AGATGGGCCGANONE 
J100068G04CTCGGCCCAATNONE 
Os03g0802300AK120564AGTGGGCCTTGGGCCGAGAConserved hypothetical protein. 
AK120687AGTGGGCCTTGGGCCGAGANONE 
Os03g0803800012-043-D10TCTCGGCCCAATANONE 
AK063484TCTCGGCCCAATAConserved hypothetical protein. 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0820100011-030-A10TCGGCCCAATAGGCCCAAGNONE 
011-031-C01TCGGCCCAATAGGCCCAAGNONE 
AK111534TCGGCCCAATAGGCCCAAGSimilar to Auxin-resistance protein AXR1. 
J013033L14TCGGCCCAATAGGCCCAAGNONE 
J013034D14TCGGCCCAATAGGCCCAAGNONE 
J013065N20TCGGCCCAATAGGCCCAAGNONE 
J013127A04TCGGCCCAATAGGCCCAAGNONE 
J013146A11TCGGCCCAATAGGCCCAAGNONE 
J023025D19TCGGCCCAATAGGCCCAAGNONE 
J023083K15TCGGCCCAATAGGCCCAAGNONE 
J033037N01TCGGCCCAATAGGCCCAAGNONE 
J033041H02TCGGCCCAATAGGCCCAAGNONE 
J043009M22TCGGCCCAATAGGCCCAAGNONE 
J090039L03TCGGCCCAATAGGCCCAAGNONE 
J090050L08TCGGCCCAATAGGCCCAAGNONE 
J090053J21TCGGCCCAATAGGCCCAAGNONE 
J090088G07TCGGCCCAATAGGCCCAAGNONE 
Os03g0824500AK058990TCATGGGCCGAGCCGConserved hypothetical protein. 
J065057L18TCATGGGCCGAGCCGNONE 
J065083L02TCATGGGCCGAGCCGNONE 
J065086L24TCATGGGCCGAGCCGNONE 
J065121L10TCATGGGCCGAGCCGNONE 
J065168N03TCATGGGCCGAGCCGNONE 
J100035J22TCATGGGCCGAGCCGNONE 
J100050G18TCATGGGCCGAGCCGNONE 
J100055F15TCATGGGCCGAGCCGNONE 
Os03g0829100AK072669TCGGCCCATCCASimilar to Soluble epoxide hydrolase. 
J013073C22TCGGCCCATCCANONE 
J033067O15TCGGCCCATCCANONE 
J065021D04TCGGCCCATCCANONE 
J065102E20TCGGCCCATCCANONE 
Os03g0831100AK103115CTCGGCCCAGTArmadillo-like helical domain containing protein. 
J033119F15CTCGGCCCAGTNONE 
J065011M19CTCGGCCCAGTNONE 
J075019I08CTCGGCCCAGTNONE 
J075047A01CTCGGCCCAGTNONE 
J075096P21CTCGGCCCAGTNONE 
J075121I05CTCGGCCCAGTNONE 
J075121I07CTCGGCCCAGTNONE 
J090063F13CTCGGCCCAGTNONE 
J090068F16CTCGGCCCAGTNONE 
J090094E14CTCGGCCCAGTNONE 
Os03g0836200009-165-F07CTCGGCCCACAAGCGGCCCAACTNONE 
015-092-G01CTCGGCCCACAAGCGGCCCAACTNONE 
AK058443CTCGGCCCACAAGCGGCCCAACTNONE 
AK067084CTCGGCCCACAAGCGGCCCAACTSimilar to RNA-binding protein RZ-1. 
AK101225CTCGGCCCACAAGCGGCCCAACTNONE 
J013092A03CTCGGCCCACAAGCGGCCCAACTNONE 
J013095N17CTCGGCCCACAAGCGGCCCAACTNONE 
J013147J18CTCGGCCCACAAGCGGCCCAACTNONE 
J023019O10CTCGGCCCACAAGCGGCCCAACTNONE 
J023065N18CTCGGCCCACAAGCGGCCCAACTNONE 
J033113E18CTCGGCCCACAAGCGGCCCAACTNONE 
J033133E03CTCGGCCCACAAGCGGCCCAACTNONE 
J065059J15CTCGGCCCACAAGCGGCCCAACTNONE 
J065075O11CTCGGCCCACAAGCGGCCCAACTNONE 
J065119I07CTCGGCCCACAAGCGGCCCAACTNONE 
J065171J03CTCGGCCCACAAGCGGCCCAACTNONE 
J090016D21CTCGGCCCACAAGCGGCCCAACTNONE 
J090081O03CTCGGCCCACAAGCGGCCCAACTNONE 
J100040G18CTCGGCCCACAAGCGGCCCAACTNONE 
J100040L10CTCGGCCCACAAGCGGCCCAACTNONE 
J100055H13CTCGGCCCACAAGCGGCCCAACTNONE 
J100059I22CTCGGCCCACAAGCGGCCCAACTNONE 
J100078A08CTCGGCCCACAAGCGGCCCAACTNONE 
Os03g0837300AK111243TTCGGCCCATTTNONE 
AK121140TTCGGCCCATTTNicotinate phosphoribosyltransferase and related family protein. 
AY214337TTCGGCCCATTTNONE 
J023077G12TTCGGCCCATTTNONE 
J023078M10TTCGGCCCATTTNONE 
J033031B10TTCGGCCCATTTNONE 
J033067L18TTCGGCCCATTTNONE 
J043005P09TTCGGCCCATTTNONE 
J090013J15TTCGGCCCATTTNONE 
J090042E10TTCGGCCCATTTNONE 
J090045A20TTCGGCCCATTTNONE 
J100022H02TTCGGCCCATTTNONE 
Os03g0837900AK068346GCCACGTCGGCCCAGAStreptomyces cyclase/dehydrase family protein. 
Os03g0841100AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
Os03g0851900AK102145ACATGGGCCGAAAFG1-like ATPase family protein. 
J033086B08ACATGGGCCGAANONE 
Os03g0852400006-021-C11AGATGGGCCGAAANONE 
006-048-D09AGATGGGCCGAAANONE 
006-059-C05AGATGGGCCGAAANONE 
006-078-E01AGATGGGCCGAAANONE 
006-082-H09AGATGGGCCGAAANONE 
AK060985AGATGGGCCGAAANONE 
AK109338AGATGGGCCGAAAConserved hypothetical protein. 
Os03g0853800006-064-F07CTGGCCCATATCGGCCCATGTNONE 
006-069-B11CTGGCCCATATCGGCCCATGTNONE 
006-104-B10CTGGCCCATATCGGCCCATGTNONE 
AK059849CTGGCCCATATCGGCCCATGTNONE 
AK102872CTGGCCCATATCGGCCCATGTNONE 
AK120043CTGGCCCATATCGGCCCATGTProtein of unknown function DUF1301 family protein. 
J033112B07CTGGCCCATATCGGCCCATGTNONE 
J053059J20CTGGCCCATATCGGCCCATGTNONE 
J065155F15CTGGCCCATATCGGCCCATGTNONE 
Os04g0103200003-106-F06AATTGGGCCGAANONE 
015-058-G03AATTGGGCCGAANONE 
AK060850AATTGGGCCGAANONE 
AK066032AATTGGGCCGAAProteasome component region PCI domain containing protein. 
J013046D12AATTGGGCCGAANONE 
J013088L18AATTGGGCCGAANONE 
J013093J06AATTGGGCCGAANONE 
J013111I01AATTGGGCCGAANONE 
J013120B15AATTGGGCCGAANONE 
J013149K17AATTGGGCCGAANONE 
J023010J08AATTGGGCCGAANONE 
J023034J10AATTGGGCCGAANONE 
J023055D05AATTGGGCCGAANONE 
J033023L03AATTGGGCCGAANONE 
J033025N21AATTGGGCCGAANONE 
J033026A19AATTGGGCCGAANONE 
J033026M14AATTGGGCCGAANONE 
J033046J22AATTGGGCCGAANONE 
J033052H11AATTGGGCCGAANONE 
J033058P05AATTGGGCCGAANONE 
J033064A11AATTGGGCCGAANONE 
J033067K11AATTGGGCCGAANONE 
J033076H02AATTGGGCCGAANONE 
J033094E04AATTGGGCCGAANONE 
J033106A02AATTGGGCCGAANONE 
J033108N14AATTGGGCCGAANONE 
J033114I06AATTGGGCCGAANONE 
J033118H18AATTGGGCCGAANONE 
J033148C05AATTGGGCCGAANONE 
J043010I24AATTGGGCCGAANONE 
J043037C07AATTGGGCCGAANONE 
J053025M02AATTGGGCCGAANONE 
J053026N08AATTGGGCCGAANONE 
J053027O14AATTGGGCCGAANONE 
J065038N11AATTGGGCCGAANONE 
J065219C03AATTGGGCCGAANONE 
J090011F14AATTGGGCCGAANONE 
J090027C03AATTGGGCCGAANONE 
J090067M19AATTGGGCCGAANONE 
J090069C17AATTGGGCCGAANONE 
J090070P21AATTGGGCCGAANONE 
J090075N11AATTGGGCCGAANONE 
J090095C22AATTGGGCCGAANONE 
J100027O14AATTGGGCCGAANONE 
J100055E01AATTGGGCCGAANONE 
Os04g0115400015-048-B05ACGTGGGCCGAANONE 
AK070523ACGTGGGCCGAAD111/G-patch domain containing protein. 
Os04g0206500AK110892TCGGCCCAAGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os04g0303950J065204E07GGGTGGGCCGAANONE 
J075044A07GGGTGGGCCGAANONE 
Os04g0378200AK103076TGATGGGCCGAGSterile alpha motif SAM domain containing protein. 
J033118E02TGATGGGCCGAGNONE 
J065065F15TGATGGGCCGAGNONE 
J090080I24TGATGGGCCGAGNONE 
Os04g0397901J065050P16TCGGCCCATCGConserved hypothetical protein. 
Os04g0413600009-142-B05CTCGGCCCAATANONE 
AK121192CTCGGCCCAATASimilar to 40S ribosomal protein S14 (Clone MCH2). 
J023086F11CTCGGCCCAATANONE 
J065085D06CTCGGCCCAATANONE 
J075062H12CTCGGCCCAATANONE 
J075072I22CTCGGCCCAATANONE 
J075074H21CTCGGCCCAATANONE 
J075087L16CTCGGCCCAATANONE 
J075088D11CTCGGCCCAATANONE 
J075115N15CTCGGCCCAATANONE 
J100064G10CTCGGCCCAATANONE 
J100080E09CTCGGCCCAATANONE 
Os04g0476400J033082D17CCATGGGCCGANONE 
Os04g0477900006-046-B01ATTGGGCCGAAANONE 
006-103-C03ATTGGGCCGAAANONE 
006-106-F09ATTGGGCCGAAANONE 
009-093-B07ATTGGGCCGAAANONE 
AK059948ATTGGGCCGAAASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK104268ATTGGGCCGAAANONE 
J013158A11ATTGGGCCGAAANONE 
J023050E17ATTGGGCCGAAANONE 
J023078J03ATTGGGCCGAAANONE 
J033027G18ATTGGGCCGAAANONE 
J033086G10ATTGGGCCGAAANONE 
J090060G14ATTGGGCCGAAANONE 
Os04g0479000AK106344TCATGGGCCGASimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0481800AK109152TCGGCCCATGGMembrane bound O-acyl transferase, MBOAT family protein. 
J065002K24TCGGCCCATGGNONE 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0508000AK071432ATTGGGCCGAGATProtein of unknown function DUF231, plant domain containing protein. 
Os04g0508100009-180-A02AACTGGGCCGAGTCATGGGCCGCANONE 
009-180-A02ATCTCGGCCCAATNONE 
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein. 
AK121759ATCTCGGCCCAATConserved hypothetical protein. 
J023007G10AACTGGGCCGAGTCATGGGCCGCANONE 
J023007G10ATCTCGGCCCAATNONE 
J033089A17AACTGGGCCGAGTCATGGGCCGCANONE 
J033089A17ATCTCGGCCCAATNONE 
J065193E13AACTGGGCCGAGTCATGGGCCGCANONE 
J065193E13ATCTCGGCCCAATNONE 
J075025M02AACTGGGCCGAGTCATGGGCCGCANONE 
J075025M02ATCTCGGCCCAATNONE 
J075027J10AACTGGGCCGAGTCATGGGCCGCANONE 
J075027J10ATCTCGGCCCAATNONE 
J075030N03AACTGGGCCGAGTCATGGGCCGCANONE 
J075030N03ATCTCGGCCCAATNONE 
J075045I20AACTGGGCCGAGTCATGGGCCGCANONE 
J075045I20ATCTCGGCCCAATNONE 
J075065E04AACTGGGCCGAGTCATGGGCCGCANONE 
J075065E04ATCTCGGCCCAATNONE 
J075134M16AACTGGGCCGAGTCATGGGCCGCANONE 
J075134M16ATCTCGGCCCAATNONE 
J075140B10AACTGGGCCGAGTCATGGGCCGCANONE 
J075140B10ATCTCGGCCCAATNONE 
Os04g0520900AK068793TCTCGGCCCAAATProtein prenyltransferase domain containing protein. 
AK105606TCTCGGCCCAAATNONE 
Os04g0528100009-090-G06TTTCGGCCCAGCCNONE 
009-168-C11TTTCGGCCCAGCCNONE 
AK065957TTTCGGCCCAGCCConserved hypothetical protein. 
J013039G20TTTCGGCCCAGCCNONE 
J013044D08TTTCGGCCCAGCCNONE 
J065013L14TTTCGGCCCAGCCNONE 
J065143H08TTTCGGCCCAGCCNONE 
J065146C14TTTCGGCCCAGCCNONE 
J065149K22TTTCGGCCCAGCCNONE 
J065156B18TTTCGGCCCAGCCNONE 
J065201A04TTTCGGCCCAGCCNONE 
J065209A04TTTCGGCCCAGCCNONE 
Os04g0530000009-106-E11TCGGCCCATTTNONE 
009-106-E11TTCGGCCCACCANONE 
011-012-E12TCGGCCCATTTNONE 
011-012-E12TTCGGCCCACCANONE 
AK066169TCGGCCCATTTConserved hypothetical protein. 
AK066169TTCGGCCCACCAConserved hypothetical protein. 
J013052P20TCGGCCCATTTNONE 
J013052P20TTCGGCCCACCANONE 
J090060G12TCGGCCCATTTNONE 
J090060G12TTCGGCCCACCANONE 
J100073H10TCGGCCCATTTNONE 
J100073H10TTCGGCCCACCANONE 
Os04g0530400AK067634CTCGGCCCAGTt-snare domain containing protein. 
Os04g0542900AK068610TCGGCCCATTAConserved hypothetical protein. 
Os04g0577500006-039-C03TACTGGGCCGATAAGCCCAGNONE 
006-043-H01TACTGGGCCGATAAGCCCAGNONE 
AK061538TACTGGGCCGATAAGCCCAGNONE 
AK065648TACTGGGCCGATAAGCCCAGTatD-related deoxyribonuclease family protein. 
AK104763TACTGGGCCGATAAGCCCAGNONE 
J013035E21TACTGGGCCGATAAGCCCAGNONE 
J013066M11TACTGGGCCGATAAGCCCAGNONE 
J100026B02TACTGGGCCGATAAGCCCAGNONE 
Os04g0586500015-095-E09CCTGGGCCGAANONE 
AK106447CCTGGGCCGAAConserved hypothetical protein. 
J075065I17CCTGGGCCGAANONE 
J100078J08CCTGGGCCGAANONE 
Os04g0591000006-090-E02ACTGGGCCGANONE 
AK072902ACTGGGCCGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065061E23ACTGGGCCGANONE 
Os04g0592500AK066893ACTGGGCCGAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18ACTGGGCCGANONE 
Os04g0611300009-006-G08AGATGGGCCGAGATNONE 
009-011-C01AGATGGGCCGAGATNONE 
009-036-B09AGATGGGCCGAGATNONE 
009-116-G09AGATGGGCCGAGATNONE 
009-126-E09AGATGGGCCGAGATNONE 
009-132-F09AGATGGGCCGAGATNONE 
009-151-G07AGATGGGCCGAGATNONE 
009-155-C07AGATGGGCCGAGATNONE 
009-163-G01AGATGGGCCGAGATNONE 
009-169-G08AGATGGGCCGAGATNONE 
009-191-B02AGATGGGCCGAGATNONE 
009-196-A08AGATGGGCCGAGATNONE 
009-198-E07AGATGGGCCGAGATNONE 
014-015-F04AGATGGGCCGAGATNONE 
015-087-H04AGATGGGCCGAGATNONE 
AK062605AGATGGGCCGAGATNONE 
AK063022AGATGGGCCGAGATConserved hypothetical protein. 
AK066749AGATGGGCCGAGATNONE 
AK104924AGATGGGCCGAGATNONE 
J065002M20AGATGGGCCGAGATNONE 
J065045L23AGATGGGCCGAGATNONE 
J065101E05AGATGGGCCGAGATNONE 
J065140J23AGATGGGCCGAGATNONE 
J065179G11AGATGGGCCGAGATNONE 
J065191B18AGATGGGCCGAGATNONE 
J065192E03AGATGGGCCGAGATNONE 
J065199H21AGATGGGCCGAGATNONE 
J075067F01AGATGGGCCGAGATNONE 
J075089L01AGATGGGCCGAGATNONE 
J075147K22AGATGGGCCGAGATNONE 
J080069G23AGATGGGCCGAGATNONE 
J100053D10AGATGGGCCGAGATNONE 
J100078C10AGATGGGCCGAGATNONE 
Os04g0612800016-010-G05TGGATGGGCCGAGCACGGCCCAAANONE 
AK071230TGGATGGGCCGAGCACGGCCCAAAProtein prenyltransferase domain containing protein. 
Os04g0636400006-064-G07TTCGGCCCAGGCCCAGCNONE 
006-097-D05TTCGGCCCAGGCCCAGCNONE 
AK061848TTCGGCCCAGGCCCAGCSimilar to Senescence-associated protein 6. 
AK099573TTCGGCCCAGGCCCAGCNONE 
J013035J20TTCGGCCCAGGCCCAGCNONE 
Os04g0640800AK065522TTTCGGCCCACGTTCCGTProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0650200AK072573TTCGGCCCACANONE 
AK109786TTCGGCCCACALipolytic enzyme, G-D-S-L family protein. 
Os04g0650500AK066690TTCGGCCCAGAConserved hypothetical protein. 
AK104273TTCGGCCCAGANONE 
Os04g0674100J080097J12TAATGGGCCGAGThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965CTCGGCCCATTANONE 
AK103795CTCGGCCCATTACoenzyme Q biosynthesis Coq4 family protein. 
J033076F14CTCGGCCCATTANONE 
J065020P20CTCGGCCCATTANONE 
J065057I21CTCGGCCCATTANONE 
J065059P11CTCGGCCCATTANONE 
J065083A22CTCGGCCCATTANONE 
J065093K10CTCGGCCCATTANONE 
J065097D03CTCGGCCCATTANONE 
J065103P05CTCGGCCCATTANONE 
J065113K09CTCGGCCCATTANONE 
J065118F23CTCGGCCCATTANONE 
J065119M06CTCGGCCCATTANONE 
J065146K17CTCGGCCCATTANONE 
J065161N12CTCGGCCCATTANONE 
J065169L02CTCGGCCCATTANONE 
J065189H12CTCGGCCCATTANONE 
J065192E24CTCGGCCCATTANONE 
J065193K17CTCGGCCCATTANONE 
J065197O21CTCGGCCCATTANONE 
J065214D09CTCGGCCCATTANONE 
J065217B11CTCGGCCCATTANONE 
J075132K07CTCGGCCCATTANONE 
J100059D14CTCGGCCCATTANONE 
Os04g0674350J065104O14TCTCGGCCCATGGNONE 
J065118J19TCTCGGCCCATGGNONE 
J065167I12TCTCGGCCCATGGHypothetical protein. 
Os04g0678800AK072212AAATGGGCCGAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065AAATGGGCCGANONE 
Os04g0683500AK071538AGTGGGCCGANONE 
AK071538TGGTGGGCCGAANONE 
AK105871AGTGGGCCGANONE 
AK105871TGGTGGGCCGAANONE 
AK106642AGTGGGCCGASimilar to Adenosine deaminase acting on tRNA 1. 
AK106642TGGTGGGCCGAASimilar to Adenosine deaminase acting on tRNA 1. 
J023095A13AGTGGGCCGANONE 
J023095A13TGGTGGGCCGAANONE 
J023099G11AGTGGGCCGANONE 
J023099G11TGGTGGGCCGAANONE 
J075125A03AGTGGGCCGANONE 
J075125A03TGGTGGGCCGAANONE 
Os04g0684500AK066014GGATGGGCCGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os05g0120300AK109108CATGGGCCGAHypothetical protein. 
Os05g0121500006-117-B10TTTCGGCCCACTNONE 
009-059-D04TTTCGGCCCACTNONE 
J065066C12TTTCGGCCCACTConserved hypothetical protein. 
J075013I12TTTCGGCCCACTNONE 
J090046D18TTTCGGCCCACTNONE 
Os05g0125900009-168-E11TCGGCCCAGATGCCCACCTNONE 
AK063078TCGGCCCAGATGCCCACCTConserved hypothetical protein. 
AK119230TCGGCCCAGATGCCCACCTNONE 
Os05g0129900AK060436ATCTCGGCCCATGAAAAGCCCTetratricopeptide-like helical domain containing protein. 
AK102515ATCTCGGCCCATGAAAAGCCCNONE 
Os05g0155300AK069217CCATGGGCCGACCACGGCCSimilar to HIRA interacting protein 5. 
Os05g0158200AK060561TTCGGCCCACCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK101218TTCGGCCCACCACNONE 
J065061E13TTCGGCCCACCACNONE 
J090089F18TTCGGCCCACCACNONE 
Os05g0169400AK073439AAATGGGCCGAAProtein of unknown function DUF1421 family protein. 
AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein. 
J013110E15AAATGGGCCGAANONE 
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
J033044H02AAATGGGCCGAANONE 
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
Os05g0176600009-151-A09TTATGGGCCGAANONE 
AK071760TTATGGGCCGAAConserved hypothetical protein. 
J023110C14TTATGGGCCGAANONE 
J065116G18TTATGGGCCGAANONE 
J065131I04TTATGGGCCGAANONE 
J065163H12TTATGGGCCGAANONE 
J075088L08TTATGGGCCGAANONE 
J075165F17TTATGGGCCGAANONE 
Os05g0182700003-102-E07TTGTGGGCCGAGATNONE 
011-019-D04TTGTGGGCCGAGATNONE 
013-068-D09TTGTGGGCCGAGATNONE 
014-032-G03TTGTGGGCCGAGATNONE 
AK065911TTGTGGGCCGAGATProtein of unknown function DUF1664 family protein. 
AK104343TTGTGGGCCGAGATNONE 
J013045E01TTGTGGGCCGAGATNONE 
J013156L15TTGTGGGCCGAGATNONE 
J023029P17TTGTGGGCCGAGATNONE 
J023134I24TTGTGGGCCGAGATNONE 
J033099A10TTGTGGGCCGAGATNONE 
J033115L16TTGTGGGCCGAGATNONE 
J090007M24TTGTGGGCCGAGATNONE 
J090019F02TTGTGGGCCGAGATNONE 
Os05g0194600AK102487AATGGGCTATTGGGCCGAPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01AATGGGCTATTGGGCCGANONE 
J100041A08AATGGGCTATTGGGCCGANONE 
Os05g0304200009-059-H05CTCGGCCCATAANONE 
AK099372CTCGGCCCATAANONE 
AK112073CTCGGCCCATAAPAP fibrillin family protein. 
Os05g0327000014-005-A12CATGGGCCGANONE 
AK064059CATGGGCCGACyclin-like domain containing protein. 
AK101588CATGGGCCGANONE 
J033051A05CATGGGCCGANONE 
J065106E02CATGGGCCGANONE 
J065183D01CATGGGCCGANONE 
Os05g0378900AK103841TCGGCCCATTTConserved hypothetical protein. 
J033148I18TCGGCCCATTTNONE 
J065085F12TCGGCCCATTTNONE 
J075041H24TCGGCCCATTTNONE 
J075180P06TCGGCCCATTTNONE 
Os05g0379300AK109293TTTCGGCCCATCAConserved hypothetical protein. 
Os05g0393800AK069074TCGGCCCAACProtein of unknown function DUF221 domain containing protein. 
Os05g0417200AK071955CTCGGCCCATGAThioredoxin-like fold domain containing protein. 
Os05g0437800015-045-B10ATATGGGCCGAGNONE 
AK106328ATATGGGCCGAGConserved hypothetical protein. 
Os05g0440100015-006-F06CTCGGCCCACTNONE 
015-076-D04CTCGGCCCACTNONE 
AK073094CTCGGCCCACTNONE 
AK102786CTCGGCCCACTHistone deacetylase superfamily protein. 
J033107M16CTCGGCCCACTNONE 
Os05g0469900AK109700AGGTGGGCCGAGConserved hypothetical protein. 
Os05g0481000AK059369TGATGGGCCGAGCN5-related N-acetyltransferase domain containing protein. 
AK068619TGATGGGCCGANONE 
Os05g0490900AK111382TTCGGCCCAGCCCAAAConserved hypothetical protein. 
Os05g0503000AK068335TCATGGGCCGAAASimilar to Secretory carrier membrane protein. 
AK104049TCATGGGCCGAAANONE 
J013149D04TCATGGGCCGAAANONE 
J075085A06TCATGGGCCGAAANONE 
Os05g0506900AK106697AATTGGGCCGAGBrix domain containing protein. 
Os05g0509200AK061566TATTGGGCCGANADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007TATTGGGCCGANONE 
AK100226TATTGGGCCGANONE 
J013114B12TATTGGGCCGANONE 
J023048D09TATTGGGCCGANONE 
Os05g0518300003-113-E09CTCGGCCCAATNONE 
006-088-A08CTCGGCCCAATNONE 
011-046-H04CTCGGCCCAATNONE 
013-059-A09CTCGGCCCAATNONE 
014-094-H08CTCGGCCCAATNONE 
015-008-B01CTCGGCCCAATNONE 
015-062-H06CTCGGCCCAATNONE 
016-057-H02CTCGGCCCAATNONE 
AK061147CTCGGCCCAATLipolytic enzyme, G-D-S-L family protein. 
J065171N11CTCGGCCCAATNONE 
J065186B12CTCGGCCCAATNONE 
Os05g0535200AK070696TCTCGGCCCACGGCGTGGACyclin-like F-box domain containing protein. 
J023057L12TCTCGGCCCACGGCGTGGANONE 
Os05g0540100AB021666AATTGGGCCGAAANONE 
AK060623AATTGGGCCGAAANONE 
AK103819AATTGGGCCGAAAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0542900AK102925TGATGGGCCGAVirulence factor, pectin lyase fold family protein. 
Os05g0547850009-102-F03AGATGGGCCTTGGGCCGAAANONE 
013-076-H08AGATGGGCCTTGGGCCGAAANONE 
AK058330AGATGGGCCTTGGGCCGAAANONE 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
AY626826AGATGGGCCTTGGGCCGAAANONE 
J043012O19AGATGGGCCTTGGGCCGAAANONE 
J043038O15AGATGGGCCTTGGGCCGAAANONE 
J053094L06AGATGGGCCTTGGGCCGAAANONE 
Os05g0548100AK060333CTCGGCCCAAGConserved hypothetical protein. 
AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
AK100682CTCGGCCCAAGNONE 
AK100682TTTCGGCCCAAGGCCCATATNONE 
J013151E01CTCGGCCCAAGNONE 
J013151E01TTTCGGCCCAAGGCCCATATNONE 
J023113L22CTCGGCCCAAGNONE 
J023113L22TTTCGGCCCAAGGCCCATATNONE 
J043027A19CTCGGCCCAAGNONE 
J043027A19TTTCGGCCCAAGGCCCATATNONE 
J075093E06CTCGGCCCAAGNONE 
J075093E06TTTCGGCCCAAGGCCCATATNONE 
J090060D15CTCGGCCCAAGNONE 
J090060D15TTTCGGCCCAAGGCCCATATNONE 
J090082J03CTCGGCCCAAGNONE 
J090082J03TTTCGGCCCAAGGCCCATATNONE 
J100050E01CTCGGCCCAAGNONE 
J100050E01TTTCGGCCCAAGGCCCATATNONE 
Os05g0553700006-100-D08TCGGCCCATTNONE 
AK099747TCGGCCCATTNONE 
AK101606TCGGCCCATTNONE 
AK103396TCGGCCCATTSimilar to Syntaxin 71 (AtSYP71). 
J033022M23TCGGCCCATTNONE 
J090086G01TCGGCCCATTNONE 
Os05g0557200AK062090CTTGGGCTCGGCCCAACANONE 
AK102111CTTGGGCTCGGCCCAACAArmadillo-like helical domain containing protein. 
J013047E13CTTGGGCTCGGCCCAACANONE 
J013089P04CTTGGGCTCGGCCCAACANONE 
J013130H17CTTGGGCTCGGCCCAACANONE 
J013132C20CTTGGGCTCGGCCCAACANONE 
J023001E06CTTGGGCTCGGCCCAACANONE 
J023108C09CTTGGGCTCGGCCCAACANONE 
J023125C12CTTGGGCTCGGCCCAACANONE 
J033023O10CTTGGGCTCGGCCCAACANONE 
J033033K16CTTGGGCTCGGCCCAACANONE 
J033064C11CTTGGGCTCGGCCCAACANONE 
J033071P07CTTGGGCTCGGCCCAACANONE 
J033072H14CTTGGGCTCGGCCCAACANONE 
J033084F06CTTGGGCTCGGCCCAACANONE 
J033084H11CTTGGGCTCGGCCCAACANONE 
J033097C05CTTGGGCTCGGCCCAACANONE 
J043009E20CTTGGGCTCGGCCCAACANONE 
J053035M10CTTGGGCTCGGCCCAACANONE 
J053043J22CTTGGGCTCGGCCCAACANONE 
J053082K10CTTGGGCTCGGCCCAACANONE 
J053094N13CTTGGGCTCGGCCCAACANONE 
Os05g0558900AK101679TTTCGGCCCATTSimilar to Frsb-prov protein. 
J013028M08TTTCGGCCCATTNONE 
J013074E16TTTCGGCCCATTNONE 
J013096L01TTTCGGCCCATTNONE 
J023085M19TTTCGGCCCATTNONE 
J033058I10TTTCGGCCCATTNONE 
J033091D18TTTCGGCCCATTNONE 
J033111H13TTTCGGCCCATTNONE 
J033114C18TTTCGGCCCATTNONE 
Os05g0566300AK099641GGCTGGGCCGA16S rRNA processing protein RimM family protein. 
Os05g0571400009-019-B04TTATGGGCCGANONE 
009-043-H02TTATGGGCCGANONE 
AK062369TTATGGGCCGAConserved hypothetical protein. 
Os05g0571600Os05g0571600TTTCGGCCCAACCConserved hypothetical protein. 
Os05g0574500006-021-A08ATCTCGGCCCATTAGGCCCATATNONE 
006-049-A11ATCTCGGCCCATTAGGCCCATATNONE 
006-086-F03ATCTCGGCCCATTAGGCCCATATNONE 
009-051-F06ATCTCGGCCCATTAGGCCCATATNONE 
AB015287ATCTCGGCCCATTAGGCCCATATNONE 
AB015972ATCTCGGCCCATTAGGCCCATATNONE 
AK061714ATCTCGGCCCATTAGGCCCATATNONE 
AK098889ATCTCGGCCCATTAGGCCCATATNONE 
AK121699ATCTCGGCCCATTAGGCCCATATSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCTCGGCCCATTAGGCCCATATNONE 
J013072D17ATCTCGGCCCATTAGGCCCATATNONE 
J023028M04ATCTCGGCCCATTAGGCCCATATNONE 
J023031F01ATCTCGGCCCATTAGGCCCATATNONE 
J023114L22ATCTCGGCCCATTAGGCCCATATNONE 
J033058L12ATCTCGGCCCATTAGGCCCATATNONE 
J033073D17ATCTCGGCCCATTAGGCCCATATNONE 
J043031D08ATCTCGGCCCATTAGGCCCATATNONE 
J043036G01ATCTCGGCCCATTAGGCCCATATNONE 
J065144O04ATCTCGGCCCATTAGGCCCATATNONE 
J065181O08ATCTCGGCCCATTAGGCCCATATNONE 
J080066B20ATCTCGGCCCATTAGGCCCATATNONE 
Os05g0592300AK068520TTCGGCCCACAProtein of unknown function DUF1637 family protein. 
Os05g0593100AK061855TTCGGCCCATTANONE 
AK100119TTCGGCCCATTASimilar to Vacuolar ATP synthase subunit C (EC 3.6.3.14) (V-ATPase C subunit) (Vacuolar proton pump C subunit). 
AY224442TTCGGCCCATTANONE 
Os06g0113600016-067-E03TGTGGGCCGAAANONE 
AK062095TGTGGGCCGAAANONE 
AK101235TGTGGGCCGAAACyclin-like F-box domain containing protein. 
AK122025TGTGGGCCGAAANONE 
J013022O19TGTGGGCCGAAANONE 
J023045P05TGTGGGCCGAAANONE 
J033031K01TGTGGGCCGAAANONE 
J033034I09TGTGGGCCGAAANONE 
J033041O04TGTGGGCCGAAANONE 
J033071K03TGTGGGCCGAAANONE 
J033075K16TGTGGGCCGAAANONE 
J033097M01TGTGGGCCGAAANONE 
J033099M22TGTGGGCCGAAANONE 
J033108N15TGTGGGCCGAAANONE 
J033121D18TGTGGGCCGAAANONE 
J033125O06TGTGGGCCGAAANONE 
J033139M16TGTGGGCCGAAANONE 
J033145P18TGTGGGCCGAAANONE 
J033149D05TGTGGGCCGAAANONE 
Os06g0116400006-082-G06ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK058327ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK105979ACATGGGCTCGGCCCAAGCCACGTCHigh-affinity nickel-transporter family protein. 
J065083I24ACATGGGCTCGGCCCAAGCCACGTCNONE 
J100072O18ACATGGGCTCGGCCCAAGCCACGTCNONE 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0136700AK065081TCGGCCCACTSteroid nuclear receptor, ligand-binding domain containing protein. 
AK065081TTTCGGCCCAATSteroid nuclear receptor, ligand-binding domain containing protein. 
J013001L08TCGGCCCACTNONE 
J013001L08TTTCGGCCCAATNONE 
J013039I03TCGGCCCACTNONE 
J013039I03TTTCGGCCCAATNONE 
Os06g0157800AK121504TATTGGGCCGATTTGGGCTGTSimilar to CG7224 (Fragment). 
J033022L20TATTGGGCCGATTTGGGCTGTNONE 
J075033D09TATTGGGCCGATTTGGGCTGTNONE 
Os06g0192500AK067746TTTCGGCCCATACAGCCCATCAATP-dependent helicase, DEAH-box family protein. 
J065023K06TTTCGGCCCATACAGCCCATCANONE 
J100063P08TTTCGGCCCATACAGCCCATCANONE 
J100065N03TTTCGGCCCATACAGCCCATCANONE 
Os06g0226600006-083-D04AGATGGGCCGAGANONE 
AK061806AGATGGGCCGAGANONE 
AK102752AGATGGGCCGAGATB2/DP1 and HVA22 related protein family protein. 
J013089J11AGATGGGCCGAGANONE 
J033106M05AGATGGGCCGAGANONE 
J100044M21AGATGGGCCGAGANONE 
J100056E06AGATGGGCCGAGANONE 
J100059F06AGATGGGCCGAGANONE 
Os06g0246500AK105105TTCGGCCCACTSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
AK105105TTTCGGCCCATASimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0247800AK102187CCACCAACTCGGCCCATCCSimilar to Dynamin-like protein (Fragment). 
AY224491CCACCAACTCGGCCCATCCNONE 
Os06g0257200J053059P05TCGGCCCAAGNONE 
J075006K03TCGGCCCAAGNONE 
J075067F07TCGGCCCAAGNONE 
J075068F14TCGGCCCAAGNONE 
J075068H14TCGGCCCAAGNONE 
J075098N06TCGGCCCAAGNONE 
J075099F08TCGGCCCAAGNONE 
J075154G24TCGGCCCAAGNONE 
J075195H09TCGGCCCAAGNONE 
Os06g0264700J100028B14TATGGGCCGAAcylphosphatase domain containing protein. 
Os06g0320000009-030-C04CATGGGCCGAANONE 
009-135-F08CATGGGCCGAANONE 
J075103B05CATGGGCCGAAProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24CATGGGCCGAANONE 
Os06g0332600AK121615CTCGGCCCAATAConserved hypothetical protein. 
J033044B19CTCGGCCCAATANONE 
Os06g0338900016-067-B02TCTGGACCATGGGCCGANONE 
AK100837TCTGGACCATGGGCCGANucleotidyl transferase domain containing protein. 
J013058L01TCTGGACCATGGGCCGANONE 
J013135N01TCTGGACCATGGGCCGANONE 
J023123E15TCTGGACCATGGGCCGANONE 
J033051J01TCTGGACCATGGGCCGANONE 
J090002O21TCTGGACCATGGGCCGANONE 
J090013F06TCTGGACCATGGGCCGANONE 
J090056F16TCTGGACCATGGGCCGANONE 
J090081G13TCTGGACCATGGGCCGANONE 
J090090P21TCTGGACCATGGGCCGANONE 
J100039F05TCTGGACCATGGGCCGANONE 
J100059J03TCTGGACCATGGGCCGANONE 
Os06g0547900AK100950TTTCGGCCCATCTSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665TTTCGGCCCATCTNONE 
J023139I22TTTCGGCCCATCTNONE 
J090066J10TTTCGGCCCATCTNONE 
Y13437TTTCGGCCCATCTNONE 
Os06g0574900AK109218TGGGCCGAGConserved hypothetical protein. 
Os06g0590301J033139K16TTCGGCCCAACNONE 
J065011M13TTCGGCCCAACNONE 
J065027D20TTCGGCCCAACNONE 
J065039O05TTCGGCCCAACGlucose/ribitol dehydrogenase family protein. 
J065051O10TTCGGCCCAACNONE 
J065128I21TTCGGCCCAACNONE 
J065163P10TTCGGCCCAACNONE 
J065169H02TTCGGCCCAACNONE 
Os06g0622700AK107021TCTCGGCCCAATTEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTCGGCCCAATTNONE 
J065100L18TCTCGGCCCAATTNONE 
J065129N15TCTCGGCCCAATTNONE 
J065152M08TCTCGGCCCAATTNONE 
J065198M12TCTCGGCCCAATTNONE 
J090077J22TCTCGGCCCAATTNONE 
J100024G23TCTCGGCCCAATTNONE 
J100027L01TCTCGGCCCAATTNONE 
J100047C06TCTCGGCCCAATTNONE 
J100055D01TCTCGGCCCAATTNONE 
J100067M05TCTCGGCCCAATTNONE 
J100077M16TCTCGGCCCAATTNONE 
J100078M22TCTCGGCCCAATTNONE 
Os06g0634600011-029-F10TTTCGGCCCAAATNONE 
011-057-B11TTTCGGCCCAAATNONE 
AK122074TTTCGGCCCAAATProtein of unknown function FAF1 domain containing protein. 
J033118C24TTTCGGCCCAAATNONE 
J033132A01TTTCGGCCCAAATNONE 
J065059I05TTTCGGCCCAAATNONE 
J100069I04TTTCGGCCCAAATNONE 
Os06g0648200009-150-E06TGGATGGGCCGAGNONE 
014-034-H10TGGATGGGCCGAGNONE 
015-035-E11TGGATGGGCCGAGNONE 
AK063001TGGATGGGCCGAGNONE 
AK063675TGGATGGGCCGAGNONE 
AK106303TGGATGGGCCGAGConserved hypothetical protein. 
Os06g0649500AK072591CTCGGCCCACAWD40-like domain containing protein. 
Os06g0663600AK100787AGATGGGCCGAGATEndonuclease V family protein. 
Os06g0683800AK110639CGGCTCGGCCCAAATConserved hypothetical protein. 
Os06g0694500AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein. 
AK103983GCCGGCCCATCTCGGCCCATGANONE 
Os06g0704300AK107008TCGTGGGCCGAAZinc finger, CCCH-type domain containing protein. 
J065038I12TCGTGGGCCGAANONE 
J065079E03TCGTGGGCCGAANONE 
J075035B15TCGTGGGCCGAANONE 
J090072D21TCGTGGGCCGAANONE 
Os06g0708900AK100402AAATGGGCCGAConserved hypothetical protein. 
AK100402TCGGCCCATCAConserved hypothetical protein. 
Os06g0709100006-057-D06TTCGGCCCATGANONE 
011-040-A08TTCGGCCCATGANONE 
016-044-A01TTCGGCCCATGANONE 
AK059732TTCGGCCCATGANONE 
AK070881TTCGGCCCATGACyclin-like F-box domain containing protein. 
AK103683TTCGGCCCATGANONE 
J065026P10TTCGGCCCATGANONE 
J090017L13TTCGGCCCATGANONE 
Os06g0710300AK121344CTTGGGCCGAAUncharacterized protein UPF0114 family protein. 
J043016B12CTTGGGCCGAANONE 
J065104H21CTTGGGCCGAANONE 
Os06g0712900AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
J075055M19TCATGGGCCGAAAAGGCCCATATNONE 
J075122I03TCATGGGCCGAAAAGGCCCATATNONE 
Os06g0715000AK107114TTCGGCCCAATTConserved hypothetical protein. 
Os06g0731800012-049-D10AAATGGGCCGAANONE 
AK069288AAATGGGCCGAAClathrin light chain family protein. 
J023014P04AAATGGGCCGAANONE 
J023058N12AAATGGGCCGAANONE 
J053035L13AAATGGGCCGAANONE 
J065097L21AAATGGGCCGAANONE 
J065099F07AAATGGGCCGAANONE 
J065144L02AAATGGGCCGAANONE 
J065161J11AAATGGGCCGAANONE 
J065181N05AAATGGGCCGAANONE 
J075087D09AAATGGGCCGAANONE 
J075088H19AAATGGGCCGAANONE 
J075116E21AAATGGGCCGAANONE 
J075147K03AAATGGGCCGAANONE 
J090083H22AAATGGGCCGAANONE 
J100079M09AAATGGGCCGAANONE 
Os07g0105300AK107419TCGGCCCAAACConserved hypothetical protein. 
AK109521TCGGCCCAAACNONE 
Os07g0110100009-059-D11GCTGGGCCGAGNONE 
AK071499GCTGGGCCGAGConserved hypothetical protein. 
J065064P17GCTGGGCCGAGNONE 
J065111B09GCTGGGCCGAGNONE 
J075099A14GCTGGGCCGAGNONE 
J075139C23GCTGGGCCGAGNONE 
Os07g0136300AK064609GCTGGGCCGAAConserved hypothetical protein. 
AK064609GTCGCGCGTGGGCCGAGAConserved hypothetical protein. 
Os07g0150200009-152-C07CTCGGCCCATCANONE 
AK058680CTCGGCCCATCANONE 
AK121635CTCGGCCCATCASimilar to 40S ribosomal protein S12-1. 
J033051C16CTCGGCCCATCANONE 
J033123H15CTCGGCCCATCANONE 
J065093I01CTCGGCCCATCANONE 
J065197C05CTCGGCCCATCANONE 
J075037B11CTCGGCCCATCANONE 
J075114B08CTCGGCCCATCANONE 
J075123N01CTCGGCCCATCANONE 
J075129O04CTCGGCCCATCANONE 
J075160H17CTCGGCCCATCANONE 
J075166H17CTCGGCCCATCANONE 
J080310F11CTCGGCCCATCANONE 
J080315P11CTCGGCCCATCANONE 
J090025A22CTCGGCCCATCANONE 
Os07g0164500J013094M18CTCGGCCCAAATNONE 
J013153L05CTCGGCCCAAATNONE 
J023011J18CTCGGCCCAAATNONE 
J023106H21CTCGGCCCAAATNONE 
J033105F10CTCGGCCCAAATNONE 
J065210M20CTCGGCCCAAATSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05CTCGGCCCAAATNONE 
J090061C13CTCGGCCCAAATNONE 
J090074K15CTCGGCCCAAATNONE 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0185700012-040-A11CCTGGGCCGANONE 
AK070572CCTGGGCCGAConserved hypothetical protein. 
J065116D10CCTGGGCCGANONE 
J065122F20CCTGGGCCGANONE 
Os07g0190900012-063-F11TCTGGGCCGTTTGGGCCGAANONE 
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein. 
J013110O09TCTGGGCCGTTTGGGCCGAANONE 
J033041I12TCTGGGCCGTTTGGGCCGAANONE 
J033046D05TCTGGGCCGTTTGGGCCGAANONE 
J033101K24TCTGGGCCGTTTGGGCCGAANONE 
J090009F10TCTGGGCCGTTTGGGCCGAANONE 
J090095B17TCTGGGCCGTTTGGGCCGAANONE 
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein. 
AK103440TTCGGCCCAAACGGCCCAGANONE 
Os07g0205000009-018-A12AGATGGGCCGGCCCATCGGCCCATCANONE 
AK103963AGATGGGCCGGCCCATCGGCCCATCANONE 
AK121368AGATGGGCCGGCCCATCGGCCCATCANONE 
J023001M20AGATGGGCCGGCCCATCGGCCCATCANONE 
J023125I03AGATGGGCCGGCCCATCGGCCCATCANONE 
J053034L22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065078A21AGATGGGCCGGCCCATCGGCCCATCANONE 
J065089G24AGATGGGCCGGCCCATCGGCCCATCANONE 
J065096G23AGATGGGCCGGCCCATCGGCCCATCANONE 
J065103N06AGATGGGCCGGCCCATCGGCCCATCANONE 
J065146J22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065159K18AGATGGGCCGGCCCATCGGCCCATCANONE 
J065204L04AGATGGGCCGGCCCATCGGCCCATCANONE 
J065207N07AGATGGGCCGGCCCATCGGCCCATCANONE 
J065208E24AGATGGGCCGGCCCATCGGCCCATCANONE 
J075057F19AGATGGGCCGGCCCATCGGCCCATCANONE 
J075058K01AGATGGGCCGGCCCATCGGCCCATCANONE 
J075072H13AGATGGGCCGGCCCATCGGCCCATCANONE 
J080003D08AGATGGGCCGGCCCATCGGCCCATCANONE 
J080025F02AGATGGGCCGGCCCATCGGCCCATCANONE 
Os07g0243200AK121036CCCACTCTTCTCGGCCCATCGSimilar to ADP-glucose pyrophosphorylase large subunit 2 (EC 2.7.7.27) (Fragment). 
D21272CCCACTCTTCTCGGCCCATCGNONE 
Os07g0274700J065002G18TCTCGGCCCACCCGNONE 
J065092L19TCTCGGCCCACCCGNONE 
J065099K11TCTCGGCCCACCCGNONE 
J065103L08TCTCGGCCCACCCGNONE 
J065185I19TCTCGGCCCACCCGNONE 
J075004L22TCTCGGCCCACCCGNONE 
J075007G03TCTCGGCCCACCCGNONE 
J075020E09TCTCGGCCCACCCGNONE 
J075046B02TCTCGGCCCACCCGNONE 
J075070D08TCTCGGCCCACCCGNONE 
J075118L24TCTCGGCCCACCCGNONE 
J075140C15TCTCGGCCCACCCGNONE 
J075157A21TCTCGGCCCACCCGNONE 
J075165J01TCTCGGCCCACCCGNONE 
J075172J18TCTCGGCCCACCCGNONE 
J075177P10TCTCGGCCCACCCGNONE 
J100042D15TCTCGGCCCACCCGNONE 
J100053M21TCTCGGCCCACCCGNONE 
J100067M12TCTCGGCCCACCCGNONE 
Os07g0406300AK064867TCGGCCCAGCSimilar to Glucose-6-phosphate 1-dehydrogenase precursor (EC 1.1.1.49). 
AK099891TCGGCCCAGCNONE 
AY339367TCGGCCCAGCNONE 
Os07g0423000AK109714GGTGGGCCGAAMitochodrial transcription termination factor-related family protein. 
J065007I23GGTGGGCCGAANONE 
Os07g0435400AK111603TTTCGGCCCATCTSimilar to WD40. 
Os07g0450000009-033-A08ATTTGGGCCGANONE 
009-033-A08TTCGGCCCATANONE 
AK063789ATTTGGGCCGANONE 
AK063789TTCGGCCCATANONE 
AK121702ATTTGGGCCGASimilar to 60S ribosomal protein L44. 
AK121702TTCGGCCCATASimilar to 60S ribosomal protein L44. 
J033073H17ATTTGGGCCGANONE 
J033073H17TTCGGCCCATANONE 
J065006A02ATTTGGGCCGANONE 
J065006A02TTCGGCCCATANONE 
J065009C05ATTTGGGCCGANONE 
J065009C05TTCGGCCCATANONE 
J065028M04ATTTGGGCCGANONE 
J065028M04TTCGGCCCATANONE 
J065070D07ATTTGGGCCGANONE 
J065070D07TTCGGCCCATANONE 
J065072H17ATTTGGGCCGANONE 
J065072H17TTCGGCCCATANONE 
J065114J23ATTTGGGCCGANONE 
J065114J23TTCGGCCCATANONE 
J065127A02ATTTGGGCCGANONE 
J065127A02TTCGGCCCATANONE 
J065146L07ATTTGGGCCGANONE 
J065146L07TTCGGCCCATANONE 
J065213H17ATTTGGGCCGANONE 
J065213H17TTCGGCCCATANONE 
J065214B07ATTTGGGCCGANONE 
J065214B07TTCGGCCCATANONE 
J100045B16ATTTGGGCCGANONE 
J100045B16TTCGGCCCATANONE 
Os07g0479200005-017-H08TTCGGCCCAACACGTCACNONE 
AK058326TTCGGCCCAACACGTCACSimilar to SL15-like (Fragment). 
J013092A08TTCGGCCCAACACGTCACNONE 
J033139E04TTCGGCCCAACACGTCACNONE 
J043016M16TTCGGCCCAACACGTCACNONE 
J053050O18TTCGGCCCAACACGTCACNONE 
J053098B03TTCGGCCCAACACGTCACNONE 
J065068G10TTCGGCCCAACACGTCACNONE 
J065091I17TTCGGCCCAACACGTCACNONE 
J065109A03TTCGGCCCAACACGTCACNONE 
J065168B17TTCGGCCCAACACGTCACNONE 
J065177A05TTCGGCCCAACACGTCACNONE 
J065180J01TTCGGCCCAACACGTCACNONE 
J075006F13TTCGGCCCAACACGTCACNONE 
J075022J03TTCGGCCCAACACGTCACNONE 
J075024N09TTCGGCCCAACACGTCACNONE 
J075114B12TTCGGCCCAACACGTCACNONE 
J080023M06TTCGGCCCAACACGTCACNONE 
J080081N24TTCGGCCCAACACGTCACNONE 
J090060N07TTCGGCCCAACACGTCACNONE 
Os07g0498300009-045-C02TTTCGGCCCATGGGCTTTTNONE 
009-060-A09TTTCGGCCCATGGGCTTTTNONE 
009-121-C04TTTCGGCCCATGGGCTTTTNONE 
009-157-G09TTTCGGCCCATGGGCTTTTNONE 
009-197-B02TTTCGGCCCATGGGCTTTTNONE 
AK059124TTTCGGCCCATGGGCTTTTConserved hypothetical protein. 
AK119800TTTCGGCCCATGGGCTTTTNONE 
J065184M18TTTCGGCCCATGGGCTTTTNONE 
J075009G21TTTCGGCCCATGGGCTTTTNONE 
J075013O03TTTCGGCCCATGGGCTTTTNONE 
J075061C22TTTCGGCCCATGGGCTTTTNONE 
J075094E12TTTCGGCCCATGGGCTTTTNONE 
J075148C01TTTCGGCCCATGGGCTTTTNONE 
Os07g0531600015-098-E11ACATGGGCCGANONE 
AK067845ACATGGGCCGAPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01ACATGGGCCGANONE 
J065008E15ACATGGGCCGANONE 
J065052K14ACATGGGCCGANONE 
J065052L13ACATGGGCCGANONE 
J065058M02ACATGGGCCGANONE 
J065069M10ACATGGGCCGANONE 
J065135A14ACATGGGCCGANONE 
J065168O18ACATGGGCCGANONE 
J075070D14ACATGGGCCGANONE 
J075169B16ACATGGGCCGANONE 
Os07g0562700003-111-G08GCTGGGCCGAAANONE 
004-013-E07GCTGGGCCGAAANONE 
006-021-D03GCTGGGCCGAAANONE 
006-021-D07GCTGGGCCGAAANONE 
006-021-F09GCTGGGCCGAAANONE 
006-023-D01GCTGGGCCGAAANONE 
006-024-F04GCTGGGCCGAAANONE 
006-024-G09GCTGGGCCGAAANONE 
006-024-G11GCTGGGCCGAAANONE 
006-025-A10GCTGGGCCGAAANONE 
006-025-B08GCTGGGCCGAAANONE 
006-025-E10GCTGGGCCGAAANONE 
006-025-F10GCTGGGCCGAAANONE 
006-026-B04GCTGGGCCGAAANONE 
006-026-C08GCTGGGCCGAAANONE 
006-026-D03GCTGGGCCGAAANONE 
006-026-F03GCTGGGCCGAAANONE 
006-026-F08GCTGGGCCGAAANONE 
006-026-F12GCTGGGCCGAAANONE 
006-027-A10GCTGGGCCGAAANONE 
006-027-C03GCTGGGCCGAAANONE 
006-028-C03GCTGGGCCGAAANONE 
006-029-E02GCTGGGCCGAAANONE 
006-029-G05GCTGGGCCGAAANONE 
006-030-A10GCTGGGCCGAAANONE 
006-030-C06GCTGGGCCGAAANONE 
006-030-D03GCTGGGCCGAAANONE 
006-030-D06GCTGGGCCGAAANONE 
006-030-G05GCTGGGCCGAAANONE 
006-031-B10GCTGGGCCGAAANONE 
006-031-D04GCTGGGCCGAAANONE 
006-031-D11GCTGGGCCGAAANONE 
006-031-H09GCTGGGCCGAAANONE 
006-032-C09GCTGGGCCGAAANONE 
006-032-H09GCTGGGCCGAAANONE 
006-033-B02GCTGGGCCGAAANONE 
006-033-B09GCTGGGCCGAAANONE 
006-033-E01GCTGGGCCGAAANONE 
006-033-F06GCTGGGCCGAAANONE 
006-033-G03GCTGGGCCGAAANONE 
006-034-A08GCTGGGCCGAAANONE 
006-034-C09GCTGGGCCGAAANONE 
006-034-F06GCTGGGCCGAAANONE 
006-035-B12GCTGGGCCGAAANONE 
006-035-C12GCTGGGCCGAAANONE 
006-035-H04GCTGGGCCGAAANONE 
006-035-H12GCTGGGCCGAAANONE 
006-036-A05GCTGGGCCGAAANONE 
006-036-A09GCTGGGCCGAAANONE 
006-036-B10GCTGGGCCGAAANONE 
006-036-C03GCTGGGCCGAAANONE 
006-036-E06GCTGGGCCGAAANONE 
006-037-H11GCTGGGCCGAAANONE 
006-038-G01GCTGGGCCGAAANONE 
006-039-B01GCTGGGCCGAAANONE 
006-039-B12GCTGGGCCGAAANONE 
006-039-C02GCTGGGCCGAAANONE 
006-039-E06GCTGGGCCGAAANONE 
006-039-G12GCTGGGCCGAAANONE 
006-040-G07GCTGGGCCGAAANONE 
006-041-H04GCTGGGCCGAAANONE 
006-042-A11GCTGGGCCGAAANONE 
006-042-E07GCTGGGCCGAAANONE 
006-042-F12GCTGGGCCGAAANONE 
006-043-C01GCTGGGCCGAAANONE 
006-045-H12GCTGGGCCGAAANONE 
006-046-A12GCTGGGCCGAAANONE 
006-046-F03GCTGGGCCGAAANONE 
006-047-A07GCTGGGCCGAAANONE 
006-047-A09GCTGGGCCGAAANONE 
006-047-E10GCTGGGCCGAAANONE 
006-047-G12GCTGGGCCGAAANONE 
006-048-B04GCTGGGCCGAAANONE 
006-049-D01GCTGGGCCGAAANONE 
006-049-G02GCTGGGCCGAAANONE 
006-049-G10GCTGGGCCGAAANONE 
006-049-H04GCTGGGCCGAAANONE 
006-050-D05GCTGGGCCGAAANONE 
006-050-F05GCTGGGCCGAAANONE 
006-051-B05GCTGGGCCGAAANONE 
006-051-G12GCTGGGCCGAAANONE 
006-052-D12GCTGGGCCGAAANONE 
006-053-D06GCTGGGCCGAAANONE 
006-054-H02GCTGGGCCGAAANONE 
006-055-A03GCTGGGCCGAAANONE 
006-055-C01GCTGGGCCGAAANONE 
006-055-E07GCTGGGCCGAAANONE 
006-055-H06GCTGGGCCGAAANONE 
006-056-F06GCTGGGCCGAAANONE 
006-057-D03GCTGGGCCGAAANONE 
006-057-D05GCTGGGCCGAAANONE 
006-057-G01GCTGGGCCGAAANONE 
006-058-A03GCTGGGCCGAAANONE 
006-058-B06GCTGGGCCGAAANONE 
006-059-A09GCTGGGCCGAAANONE 
006-059-H11GCTGGGCCGAAANONE 
006-060-A04GCTGGGCCGAAANONE 
006-060-A09GCTGGGCCGAAANONE 
006-060-C11GCTGGGCCGAAANONE 
006-060-D08GCTGGGCCGAAANONE 
006-061-A04GCTGGGCCGAAANONE 
006-061-E01GCTGGGCCGAAANONE 
006-061-G10GCTGGGCCGAAANONE 
006-061-H12GCTGGGCCGAAANONE 
006-062-B07GCTGGGCCGAAANONE 
006-062-G03GCTGGGCCGAAANONE 
006-062-H12GCTGGGCCGAAANONE 
006-063-D05GCTGGGCCGAAANONE 
006-063-E04GCTGGGCCGAAANONE 
006-063-F05GCTGGGCCGAAANONE 
006-063-G05GCTGGGCCGAAANONE 
006-064-B07GCTGGGCCGAAANONE 
006-065-C11GCTGGGCCGAAANONE 
006-065-H02GCTGGGCCGAAANONE 
006-067-C12GCTGGGCCGAAANONE 
006-067-F10GCTGGGCCGAAANONE 
006-068-E02GCTGGGCCGAAANONE 
006-068-G04GCTGGGCCGAAANONE 
006-069-A02GCTGGGCCGAAANONE 
006-071-A07GCTGGGCCGAAANONE 
006-072-F11GCTGGGCCGAAANONE 
006-072-F12GCTGGGCCGAAANONE 
006-073-E12GCTGGGCCGAAANONE 
006-073-F08GCTGGGCCGAAANONE 
006-073-H07GCTGGGCCGAAANONE 
006-074-A07GCTGGGCCGAAANONE 
006-075-A12GCTGGGCCGAAANONE 
006-075-B01GCTGGGCCGAAANONE 
006-075-H10GCTGGGCCGAAANONE 
006-075-H12GCTGGGCCGAAANONE 
006-076-B06GCTGGGCCGAAANONE 
006-077-A09GCTGGGCCGAAANONE 
006-077-D05GCTGGGCCGAAANONE 
006-078-C11GCTGGGCCGAAANONE 
006-078-D12GCTGGGCCGAAANONE 
006-078-E02GCTGGGCCGAAANONE 
006-079-A01GCTGGGCCGAAANONE 
006-079-E02GCTGGGCCGAAANONE 
006-079-F03GCTGGGCCGAAANONE 
006-080-G11GCTGGGCCGAAANONE 
006-081-C02GCTGGGCCGAAANONE 
006-081-C08GCTGGGCCGAAANONE 
006-082-B06GCTGGGCCGAAANONE 
006-082-C11GCTGGGCCGAAANONE 
006-082-H04GCTGGGCCGAAANONE 
006-083-E04GCTGGGCCGAAANONE 
006-083-H12GCTGGGCCGAAANONE 
006-084-C08GCTGGGCCGAAANONE 
006-084-E07GCTGGGCCGAAANONE 
006-084-E10GCTGGGCCGAAANONE 
006-085-E06GCTGGGCCGAAANONE 
006-085-E10GCTGGGCCGAAANONE 
006-086-F06GCTGGGCCGAAANONE 
006-087-D08GCTGGGCCGAAANONE 
006-087-F03GCTGGGCCGAAANONE 
006-087-F10GCTGGGCCGAAANONE 
006-087-G07GCTGGGCCGAAANONE 
006-088-A02GCTGGGCCGAAANONE 
006-089-A04GCTGGGCCGAAANONE 
006-089-B12GCTGGGCCGAAANONE 
006-089-D06GCTGGGCCGAAANONE 
006-089-D10GCTGGGCCGAAANONE 
006-089-H05GCTGGGCCGAAANONE 
006-090-C06GCTGGGCCGAAANONE 
006-091-A03GCTGGGCCGAAANONE 
006-091-E04GCTGGGCCGAAANONE 
006-091-H12GCTGGGCCGAAANONE 
006-092-A08GCTGGGCCGAAANONE 
006-092-F01GCTGGGCCGAAANONE 
006-092-G08GCTGGGCCGAAANONE 
006-093-B12GCTGGGCCGAAANONE 
006-093-D04GCTGGGCCGAAANONE 
006-093-F01GCTGGGCCGAAANONE 
006-094-A08GCTGGGCCGAAANONE 
006-094-F01GCTGGGCCGAAANONE 
006-094-F03GCTGGGCCGAAANONE 
006-095-C12GCTGGGCCGAAANONE 
006-095-E10GCTGGGCCGAAANONE 
006-095-E12GCTGGGCCGAAANONE 
006-095-G06GCTGGGCCGAAANONE 
006-096-B12GCTGGGCCGAAANONE 
006-096-C12GCTGGGCCGAAANONE 
006-096-G02GCTGGGCCGAAANONE 
006-097-D01GCTGGGCCGAAANONE 
006-097-D07GCTGGGCCGAAANONE 
006-097-F04GCTGGGCCGAAANONE 
006-098-C07GCTGGGCCGAAANONE 
006-098-D04GCTGGGCCGAAANONE 
006-099-E06GCTGGGCCGAAANONE 
006-099-F02GCTGGGCCGAAANONE 
006-099-F10GCTGGGCCGAAANONE 
006-100-A07GCTGGGCCGAAANONE 
006-100-B10GCTGGGCCGAAANONE 
006-100-G01GCTGGGCCGAAANONE 
006-100-H06GCTGGGCCGAAANONE 
006-101-D01GCTGGGCCGAAANONE 
006-101-F03GCTGGGCCGAAANONE 
006-102-A12GCTGGGCCGAAANONE 
006-102-B11GCTGGGCCGAAANONE 
006-102-C03GCTGGGCCGAAANONE 
006-102-F11GCTGGGCCGAAANONE 
006-103-A08GCTGGGCCGAAANONE 
006-103-B06GCTGGGCCGAAANONE 
006-103-D01GCTGGGCCGAAANONE 
006-103-F02GCTGGGCCGAAANONE 
006-104-B02GCTGGGCCGAAANONE 
006-104-C01GCTGGGCCGAAANONE 
006-104-F09GCTGGGCCGAAANONE 
006-104-H11GCTGGGCCGAAANONE 
006-105-A03GCTGGGCCGAAANONE 
006-105-D09GCTGGGCCGAAANONE 
006-106-B10GCTGGGCCGAAANONE 
006-107-A06GCTGGGCCGAAANONE 
006-107-C04GCTGGGCCGAAANONE 
006-107-E03GCTGGGCCGAAANONE 
006-107-F05GCTGGGCCGAAANONE 
006-108-C09GCTGGGCCGAAANONE 
006-109-C09GCTGGGCCGAAANONE 
006-109-D10GCTGGGCCGAAANONE 
006-109-E06GCTGGGCCGAAANONE 
006-109-E10GCTGGGCCGAAANONE 
006-110-A06GCTGGGCCGAAANONE 
006-110-C11GCTGGGCCGAAANONE 
006-111-A02GCTGGGCCGAAANONE 
006-111-F02GCTGGGCCGAAANONE 
006-112-A08GCTGGGCCGAAANONE 
006-112-H06GCTGGGCCGAAANONE 
006-113-A08GCTGGGCCGAAANONE 
006-113-B01GCTGGGCCGAAANONE 
006-113-C05GCTGGGCCGAAANONE 
006-113-D01GCTGGGCCGAAANONE 
006-113-D04GCTGGGCCGAAANONE 
006-113-D06GCTGGGCCGAAANONE 
006-113-E09GCTGGGCCGAAANONE 
006-114-F06GCTGGGCCGAAANONE 
006-116-B02GCTGGGCCGAAANONE 
006-117-B07GCTGGGCCGAAANONE 
006-117-G04GCTGGGCCGAAANONE 
006-118-D01GCTGGGCCGAAANONE 
006-118-D12GCTGGGCCGAAANONE 
006-118-F12GCTGGGCCGAAANONE 
006-118-G12GCTGGGCCGAAANONE 
006-119-B08GCTGGGCCGAAANONE 
006-120-E09GCTGGGCCGAAANONE 
006-120-G05GCTGGGCCGAAANONE 
006-120-G10GCTGGGCCGAAANONE 
009-022-D12GCTGGGCCGAAANONE 
009-051-H08GCTGGGCCGAAANONE 
009-065-F05GCTGGGCCGAAANONE 
009-070-A06GCTGGGCCGAAANONE 
009-073-B07GCTGGGCCGAAANONE 
009-092-C10GCTGGGCCGAAANONE 
009-093-D03GCTGGGCCGAAANONE 
009-103-B04GCTGGGCCGAAANONE 
009-106-H08GCTGGGCCGAAANONE 
009-120-B05GCTGGGCCGAAANONE 
009-121-F05GCTGGGCCGAAANONE 
009-122-B04GCTGGGCCGAAANONE 
009-122-D08GCTGGGCCGAAANONE 
009-123-F07GCTGGGCCGAAANONE 
009-125-G02GCTGGGCCGAAANONE 
009-128-F02GCTGGGCCGAAANONE 
009-128-H07GCTGGGCCGAAANONE 
009-131-C06GCTGGGCCGAAANONE 
009-132-F08GCTGGGCCGAAANONE 
009-133-G08GCTGGGCCGAAANONE 
009-134-D09GCTGGGCCGAAANONE 
009-135-F01GCTGGGCCGAAANONE 
009-149-E11GCTGGGCCGAAANONE 
009-153-H04GCTGGGCCGAAANONE 
009-161-E04GCTGGGCCGAAANONE 
009-163-A09GCTGGGCCGAAANONE 
009-163-C05GCTGGGCCGAAANONE 
009-163-E10GCTGGGCCGAAANONE 
009-165-F04GCTGGGCCGAAANONE 
009-166-A07GCTGGGCCGAAANONE 
009-169-G12GCTGGGCCGAAANONE 
009-172-G08GCTGGGCCGAAANONE 
009-179-E06GCTGGGCCGAAANONE 
009-181-F09GCTGGGCCGAAANONE 
009-190-G07GCTGGGCCGAAANONE 
009-191-D01GCTGGGCCGAAANONE 
009-195-G02GCTGGGCCGAAANONE 
AF022738GCTGGGCCGAAANONE 
AK061512GCTGGGCCGAAANONE 
AK068972GCTGGGCCGAAANONE 
AK103926GCTGGGCCGAAANONE 
AK103999GCTGGGCCGAAANONE 
AK104224GCTGGGCCGAAANONE 
AK104465GCTGGGCCGAAANONE 
AK104495GCTGGGCCGAAANONE 
AK109399GCTGGGCCGAAASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GCTGGGCCGAAANONE 
AK119545GCTGGGCCGAAANONE 
J013043L10GCTGGGCCGAAANONE 
J013050A09GCTGGGCCGAAANONE 
J023001G03GCTGGGCCGAAANONE 
J023024D14GCTGGGCCGAAANONE 
J023072E11GCTGGGCCGAAANONE 
J023149E18GCTGGGCCGAAANONE 
J033029B16GCTGGGCCGAAANONE 
J065001O21GCTGGGCCGAAANONE 
J065035B04GCTGGGCCGAAANONE 
J065044D18GCTGGGCCGAAANONE 
J065057F12GCTGGGCCGAAANONE 
J065060A11GCTGGGCCGAAANONE 
J065062G15GCTGGGCCGAAANONE 
J065080F13GCTGGGCCGAAANONE 
J065084N12GCTGGGCCGAAANONE 
J065101D02GCTGGGCCGAAANONE 
J065107C07GCTGGGCCGAAANONE 
J065112N24GCTGGGCCGAAANONE 
J065141I16GCTGGGCCGAAANONE 
J065147D05GCTGGGCCGAAANONE 
J065167H02GCTGGGCCGAAANONE 
J065207K23GCTGGGCCGAAANONE 
J075008E16GCTGGGCCGAAANONE 
J075014F03GCTGGGCCGAAANONE 
J075015O17GCTGGGCCGAAANONE 
J075020H20GCTGGGCCGAAANONE 
J075021E22GCTGGGCCGAAANONE 
J075023N13GCTGGGCCGAAANONE 
J075028H10GCTGGGCCGAAANONE 
J075040F20GCTGGGCCGAAANONE 
J075051L23GCTGGGCCGAAANONE 
J075069G16GCTGGGCCGAAANONE 
J075084F24GCTGGGCCGAAANONE 
J075090H09GCTGGGCCGAAANONE 
J075092M21GCTGGGCCGAAANONE 
J075110C10GCTGGGCCGAAANONE 
J075111J12GCTGGGCCGAAANONE 
J075114L04GCTGGGCCGAAANONE 
J075139E02GCTGGGCCGAAANONE 
J075160M10GCTGGGCCGAAANONE 
J075176J03GCTGGGCCGAAANONE 
J075183I17GCTGGGCCGAAANONE 
J075191N10GCTGGGCCGAAANONE 
J075193D07GCTGGGCCGAAANONE 
J075194M16GCTGGGCCGAAANONE 
J075197K04GCTGGGCCGAAANONE 
J080032I11GCTGGGCCGAAANONE 
J080076M11GCTGGGCCGAAANONE 
J080311J08GCTGGGCCGAAANONE 
J080317E05GCTGGGCCGAAANONE 
J090034L08GCTGGGCCGAAANONE 
J100040D19GCTGGGCCGAAANONE 
J100074C11GCTGGGCCGAAANONE 
Os07g0564000AK069806AGTTGGGCCGAGAConserved hypothetical protein. 
Os07g0564400Os07g0564400CTCGGCCCAGANucleic acid-binding, OB-fold domain containing protein. 
Os07g0565000AK121056GTTTGGGCCTTCTTGGGCCGASimilar to 40S ribosomal protein S11. 
J023056G18GTTTGGGCCTTCTTGGGCCGANONE 
J065131K04GTTTGGGCCTTCTTGGGCCGANONE 
J065190L19GTTTGGGCCTTCTTGGGCCGANONE 
J065209B06GTTTGGGCCTTCTTGGGCCGANONE 
J065216P11GTTTGGGCCTTCTTGGGCCGANONE 
J090088F06GTTTGGGCCTTCTTGGGCCGANONE 
Os07g0568100AK099778AGCCCATGGGCCGASimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0569800AK108637GGTGGGCCGAGConcanavalin A-like lectin/glucanase domain containing protein. 
Os07g0570700AK065242TTCGGCCCAACTRibosome recycling factor family protein. 
J013002I12TTCGGCCCAACTNONE 
Os07g0585800006-106-A05ACTGGGCCGAGANONE 
AK066419ACTGGGCCGAGANONE 
AK105064ACTGGGCCGAGASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01ACTGGGCCGAGANONE 
J065085B08ACTGGGCCGAGANONE 
J065099I23ACTGGGCCGAGANONE 
J065169A01ACTGGGCCGAGANONE 
J065187N13ACTGGGCCGAGANONE 
J065191L18ACTGGGCCGAGANONE 
J065194D04ACTGGGCCGAGANONE 
J065211M09ACTGGGCCGAGANONE 
J065212I02ACTGGGCCGAGANONE 
J090003C10ACTGGGCCGAGANONE 
J090025O11ACTGGGCCGAGANONE 
J090092F10ACTGGGCCGAGANONE 
J100055A04ACTGGGCCGAGANONE 
J100064A01ACTGGGCCGAGANONE 
J100080L02ACTGGGCCGAGANONE 
Os07g0606500AK068811ATCTCGGCCCATTTNONE 
AK121873ATCTCGGCCCATTTNONE 
J013159C05ATCTCGGCCCATTTNONE 
J075158B14ATCTCGGCCCATTTNONE 
Os07g0607200AK065746CTCGGCCCAACAProtein of unknown function DUF751 family protein. 
AK065746TTCGGCCCAACAProtein of unknown function DUF751 family protein. 
J065037B15CTCGGCCCAACANONE 
J065037B15TTCGGCCCAACANONE 
J065042E20CTCGGCCCAACANONE 
J065042E20TTCGGCCCAACANONE 
J065161I08CTCGGCCCAACANONE 
J065161I08TTCGGCCCAACANONE 
Os07g0616900AK071047CTCGGCCCAAAAProtein of unknown function DUF500 family protein. 
J013106G03CTCGGCCCAAAANONE 
J013124C20CTCGGCCCAAAANONE 
J033096D16CTCGGCCCAAAANONE 
J043005E08CTCGGCCCAAAANONE 
J065197K12CTCGGCCCAAAANONE 
J065211I03CTCGGCCCAAAANONE 
Os07g0626300AK100052TCGGCCCAATTConserved hypothetical protein. 
Os07g0634300AK109879TTTCGGCCCAGCCCATConserved hypothetical protein. 
J100035O13TTTCGGCCCAGCCCATNONE 
J100039D07TTTCGGCCCAGCCCATNONE 
J100039F13TTTCGGCCCAGCCCATNONE 
Os07g0639800AK074012TTCGGCCCATTSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592TTCGGCCCATTNONE 
AK104739TTCGGCCCATTNONE 
Os07g0644300AK066726CTCGGCCCAATTSimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK066726TCGGCCCAACASimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483CTCGGCCCAATTNONE 
AK101483TCGGCCCAACANONE 
Os07g0673700AK071934TCGGCCCAGCCCACCCCyclin-like F-box domain containing protein. 
AK107556TCGGCCCAGCCCACCCNONE 
Os07g0680300009-195-E06TCGGCCCACTTAGGCCCATATNONE 
AK063800TCGGCCCACTTAGGCCCATATSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCGGCCCACTTAGGCCCATATNONE 
J075066A20TCGGCCCACTTAGGCCCATATNONE 
J075088I17TCGGCCCACTTAGGCCCATATNONE 
J075147M19TCGGCCCACTTAGGCCCATATNONE 
J075153L02TCGGCCCACTTAGGCCCATATNONE 
J080013A21TCGGCCCACTTAGGCCCATATNONE 
J080051B13TCGGCCCACTTAGGCCCATATNONE 
J080077I24TCGGCCCACTTAGGCCCATATNONE 
J080302B14TCGGCCCACTTAGGCCCATATNONE 
J080309D22TCGGCCCACTTAGGCCCATATNONE 
J100083B16TCGGCCCACTTAGGCCCATATNONE 
Os07g0681700AK103213TTTCGGCCCAGCGlycosyl transferase, family 8 protein. 
Os07g0687300AK073043TTTCGGCCCAACASimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os07g0688300AK068325GGATGGGCCGASimilar to Importin alpha 1. 
AK099611GGATGGGCCGANONE 
Os07g0691100AK071728TTATGGGCCGAASimilar to Pectin methylesterase 6 (Fragment). 
J023108P03TTATGGGCCGAANONE 
J023112F11TTATGGGCCGAANONE 
J023143A10TTATGGGCCGAANONE 
Os08g0113800J033069I12TCTCGGCCCAAACNONE 
J053050I07TCTCGGCCCAAACNONE 
J065006J11TCTCGGCCCAAACNONE 
J065013D02TCTCGGCCCAAACNONE 
J065055L24TCTCGGCCCAAACNONE 
J065071I11TCTCGGCCCAAACConserved hypothetical protein. 
J065093G12TCTCGGCCCAAACNONE 
J065101N03TCTCGGCCCAAACNONE 
Os08g0116800AK063695CTCGGCCCAGGExoribonuclease domain containing protein. 
AK063695TCTCGGCCCAGGExoribonuclease domain containing protein. 
Os08g0118900AK109749TCGGCCCATGTAdenylate kinase family protein. 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
Os08g0129200014-040-E08AGTGGGCCGAGATNONE 
014-040-E08TGATGGGCCGANONE 
AK070034AGTGGGCCGAGATNONE 
AK070034TGATGGGCCGANONE 
AK101577AGTGGGCCGAGATSimilar to Cold shock protein-1. 
AK101577TGATGGGCCGASimilar to Cold shock protein-1. 
J065137A09AGTGGGCCGAGATNONE 
J065137A09TGATGGGCCGANONE 
J100062K14AGTGGGCCGAGATNONE 
J100062K14TGATGGGCCGANONE 
Os08g0150800AK101530AAATGGGCTCGGCCCACASimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
AK101530CTTGGGCCGASimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0155000004-001-C12TTATGGGCTCGGCCCATATNONE 
014-030-C11TTATGGGCTCGGCCCATATNONE 
AK060859TTATGGGCTCGGCCCATATNONE 
AK099613TTATGGGCTCGGCCCATATBrix domain containing protein. 
J013154C17TTATGGGCTCGGCCCATATNONE 
J033039F14TTATGGGCTCGGCCCATATNONE 
J033126I18TTATGGGCTCGGCCCATATNONE 
J043005A17TTATGGGCTCGGCCCATATNONE 
J053027C13TTATGGGCTCGGCCCATATNONE 
J053033I07TTATGGGCTCGGCCCATATNONE 
J053054P04TTATGGGCTCGGCCCATATNONE 
J053060F22TTATGGGCTCGGCCCATATNONE 
J053061P10TTATGGGCTCGGCCCATATNONE 
J053065L13TTATGGGCTCGGCCCATATNONE 
J053099H19TTATGGGCTCGGCCCATATNONE 
J053101D09TTATGGGCTCGGCCCATATNONE 
J075062C16TTATGGGCTCGGCCCATATNONE 
J075129P09TTATGGGCTCGGCCCATATNONE 
J075135C02TTATGGGCTCGGCCCATATNONE 
J075147P13TTATGGGCTCGGCCCATATNONE 
J090007K03TTATGGGCTCGGCCCATATNONE 
J090050M06TTATGGGCTCGGCCCATATNONE 
J090057M20TTATGGGCTCGGCCCATATNONE 
J090070B06TTATGGGCTCGGCCCATATNONE 
J090080D11TTATGGGCTCGGCCCATATNONE 
J100021D15TTATGGGCTCGGCCCATATNONE 
Os08g0224200AK101331CTCGGCCCAGGSimilar to Ythdf2-prov protein. 
Os08g0224700AK121754AATGGGCCGAGSimilar to 26S proteasome subunit RPN2a. 
Os08g0233300AK067421AACTGGGCCGAANONE 
AK067421TACTGGGCCGAANONE 
AK120342AACTGGGCCGAAConserved hypothetical protein. 
AK120342TACTGGGCCGAAConserved hypothetical protein. 
J013061K19AACTGGGCCGAANONE 
J013061K19TACTGGGCCGAANONE 
J013106J20AACTGGGCCGAANONE 
J013106J20TACTGGGCCGAANONE 
J023022P16AACTGGGCCGAANONE 
J023022P16TACTGGGCCGAANONE 
J090015I03AACTGGGCCGAANONE 
J090015I03TACTGGGCCGAANONE 
Os08g0260600AK108529AGTTGGGCCGAGACD9/CD37/CD63 antigen family protein. 
Os08g0270200AK101221TTATGGGCCGAAAExosome-associated family protein. 
J090067H03TTATGGGCCGAAANONE 
Os08g0411200AK120890AGGTGGGCCGAASAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0433200013-023-E07TATGGGCCGAAANONE 
AK099471TATGGGCCGAAAConserved hypothetical protein. 
J013024A05TATGGGCCGAAANONE 
J013065N03TATGGGCCGAAANONE 
J023111A21TATGGGCCGAAANONE 
J065035F10TATGGGCCGAAANONE 
J065083H01TATGGGCCGAAANONE 
J065159E03TATGGGCCGAAANONE 
J065186A03TATGGGCCGAAANONE 
J075032B02TATGGGCCGAAANONE 
J075038L14TATGGGCCGAAANONE 
J075047N21TATGGGCCGAAANONE 
J075076H05TATGGGCCGAAANONE 
J075110C08TATGGGCCGAAANONE 
J090096K17TATGGGCCGAAANONE 
Os08g0440000006-056-A06TCTCGGCCCAGTTNONE 
AK060959TCTCGGCCCAGTTNONE 
AK102539TCTCGGCCCAGTTVesicle transport v-SNARE family protein. 
J065012O03TCTCGGCCCAGTTNONE 
Os08g0441400011-033-F01TTCGGCCCAGTANONE 
015-084-B04TTCGGCCCAGTANONE 
AK063317TTCGGCCCAGTANONE 
AK064141TTCGGCCCAGTAConserved hypothetical protein. 
J065060F06TTCGGCCCAGTANONE 
J075110A22TTCGGCCCAGTANONE 
J080307P11TTCGGCCCAGTANONE 
J090041E06TTCGGCCCAGTANONE 
Os08g0449850J075182C20TCTGGGCCGAConserved hypothetical protein. 
Os08g0461300AK065651TTCGGCCCACGGGCyclin-like F-box domain containing protein. 
Os08g0484700J065041E01TCGGCCCATCGHomeodomain-like containing protein. 
Os08g0485700AK068131TAATGGGCCGAGNONE 
AK068131TCGGCCCACGTNONE 
AK069097TAATGGGCCGAGMethyl-CpG binding domain containing protein. 
AK069097TCGGCCCACGTMethyl-CpG binding domain containing protein. 
J013130L03TAATGGGCCGAGNONE 
J013130L03TCGGCCCACGTNONE 
Os08g0487100AK107150CTCGGCCCAAATSimilar to BZIP transcription factor BZI-2. 
Os08g0496000011-009-D02AGCCCATTCGGCCCAAACNONE 
AK103187AGCCCATTCGGCCCAAACCytochrome oxidase assembly family protein. 
J033121L24AGCCCATTCGGCCCAAACNONE 
J033149A07AGCCCATTCGGCCCAAACNONE 
J065198L20AGCCCATTCGGCCCAAACNONE 
J090096F24AGCCCATTCGGCCCAAACNONE 
Os08g0504400014-015-C10CGGGTGGGCCGAGNONE 
014-015-C10TCATGGGCCGAANONE 
AK069190CGGGTGGGCCGAGSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK069190TCATGGGCCGAASimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CGGGTGGGCCGAGNONE 
AK072089TCATGGGCCGAANONE 
J023006O19CGGGTGGGCCGAGNONE 
J023006O19TCATGGGCCGAANONE 
J033041C11CGGGTGGGCCGAGNONE 
J033041C11TCATGGGCCGAANONE 
Os08g0515800006-067-C11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
009-131-F05AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
016-026-E03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
AK061787AGCCCATGGGCCTTATCTCGGCCCAAGMitochodrial transcription termination factor-related family protein. 
J013032E15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J013032E16AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J033140O22AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065058M21AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065090D03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065115G12AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065124N11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100021K19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100035P15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100043J19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
Os08g0544500AK071354CTCGGCCCACTSimilar to ARP2/3 regulatory protein subunit NAPP. 
Os08g0557000AK059917TCGGCCCACAANONE 
AK100496TCGGCCCACAASimilar to Protein-L-isoaspartate O-methyltransferase. 
Os09g0293900Os09g0293900TCGGCCCAGTAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0319800AK066759AGTGGGCCGATerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
Os09g0325300011-005-H08TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
011-005-H08TTTCGGCCCAATTNONE 
AK068435TCGGCCCAAACTTGGGCCGGCCCGTTConserved hypothetical protein. 
AK068435TTTCGGCCCAATTConserved hypothetical protein. 
AK073998TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
AK073998TTTCGGCCCAATTNONE 
J033071H21TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J033071H21TTTCGGCCCAATTNONE 
J065214H05TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J065214H05TTTCGGCCCAATTNONE 
Os09g0342000AK111440AGATGGGCCGACyclin-like F-box domain containing protein. 
Os09g0344700J080011F14CCTGGGCCGANONE 
J080011G13CCTGGGCCGANONE 
J080016C06CCTGGGCCGANONE 
J080034K13CCTGGGCCGANONE 
J080043N08CCTGGGCCGANONE 
J080068E01CCTGGGCCGAConserved hypothetical protein. 
J080068L12CCTGGGCCGANONE 
J080071N01CCTGGGCCGANONE 
J080075D11CCTGGGCCGANONE 
J080076D14CCTGGGCCGANONE 
J080093L23CCTGGGCCGANONE 
J080093N22CCTGGGCCGANONE 
Os09g0375700AK068295TTTGGGCTCGGCCCATTHypothetical protein. 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
Os09g0411700005-017-C05TTCGGCCCAAGNONE 
009-163-B01TTCGGCCCAAGNONE 
AK058290TTCGGCCCAAGPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919TTCGGCCCAAGNONE 
AK121091TTCGGCCCAAGNONE 
J013039D20TTCGGCCCAAGNONE 
J023066F16TTCGGCCCAAGNONE 
J023082H09TTCGGCCCAAGNONE 
J023088H05TTCGGCCCAAGNONE 
J065013G09TTCGGCCCAAGNONE 
J065065C12TTCGGCCCAAGNONE 
J065111I04TTCGGCCCAAGNONE 
J065179H22TTCGGCCCAAGNONE 
J075023N14TTCGGCCCAAGNONE 
J090041J17TTCGGCCCAAGNONE 
J100031J21TTCGGCCCAAGNONE 
J100057A18TTCGGCCCAAGNONE 
J100068P22TTCGGCCCAAGNONE 
Os09g0450901J065009G09GTTTGGGCCGAANONE 
J065015O13GTTTGGGCCGAANONE 
J065082C06GTTTGGGCCGAAConserved hypothetical protein. 
Os09g0453000AK120561TCTCGGCCCAGAProtein of unknown function UPF0220 family protein. 
AK121475TCTCGGCCCAGANONE 
J013132I06TCTCGGCCCAGANONE 
J023148P12TCTCGGCCCAGANONE 
J033147G24TCTCGGCCCAGANONE 
J053089L13TCTCGGCCCAGANONE 
J053097D02TCTCGGCCCAGANONE 
J065013M20TCTCGGCCCAGANONE 
J075148M10TCTCGGCCCAGANONE 
J075153M04TCTCGGCCCAGANONE 
J075197C14TCTCGGCCCAGANONE 
J080311M12TCTCGGCCCAGANONE 
J090022J07TCTCGGCCCAGANONE 
J090026D19TCTCGGCCCAGANONE 
J090033D10TCTCGGCCCAGANONE 
J090084N05TCTCGGCCCAGANONE 
J090087H04TCTCGGCCCAGANONE 
J100028I02TCTCGGCCCAGANONE 
J100088N15TCTCGGCCCAGANONE 
Os09g0458100AK109625GTTGGGCCGAGATXyloglucan fucosyltransferase family protein. 
Os09g0459800AK060764ACATGGGCCGAANONE 
AK100324ACATGGGCCGAASimilar to ARP protein. 
AK102736ACATGGGCCGAANONE 
Os09g0467100012-085-D01TTCGGCCCAAACNONE 
AK063444TTCGGCCCAAACSAICAR synthetase family protein. 
J065083E16TTCGGCCCAAACNONE 
Os09g0468900AK120990TCGGCCCATCAGGCCCACGTConserved hypothetical protein. 
J013123P13TCGGCCCATCAGGCCCACGTNONE 
J023013I09TCGGCCCATCAGGCCCACGTNONE 
J023023G08TCGGCCCATCAGGCCCACGTNONE 
J023043E08TCGGCCCATCAGGCCCACGTNONE 
J033124D24TCGGCCCATCAGGCCCACGTNONE 
J065047I07TCGGCCCATCAGGCCCACGTNONE 
J065093C16TCGGCCCATCAGGCCCACGTNONE 
J090088O03TCGGCCCATCAGGCCCACGTNONE 
J100032M21TCGGCCCATCAGGCCCACGTNONE 
Os09g0497400009-087-E03TCGGCCCAATNONE 
AK058354CTCGGCCCAATANONE 
AK058354TCGGCCCAATNONE 
AK068677CTCGGCCCAATAProtein of unknown function DUF850, transmembrane eukaryotic family protein. 
J013159B19CTCGGCCCAATANONE 
J013159B19TCGGCCCAATNONE 
J023011D22CTCGGCCCAATANONE 
J023011D22TCGGCCCAATNONE 
J023081K05CTCGGCCCAATANONE 
J023081K05TCGGCCCAATNONE 
J033060O14CTCGGCCCAATANONE 
J033060O14TCGGCCCAATNONE 
J075020I08CTCGGCCCAATANONE 
J075020I08TCGGCCCAATNONE 
J075034J03CTCGGCCCAATANONE 
J075034J03TCGGCCCAATNONE 
J075049M15CTCGGCCCAATANONE 
J075049M15TCGGCCCAATNONE 
J075065K02CTCGGCCCAATANONE 
J075065K02TCGGCCCAATNONE 
J075099L06CTCGGCCCAATANONE 
J075099L06TCGGCCCAATNONE 
Os09g0512900006-066-A10TTCGGCCCATCTNONE 
AK061814TTCGGCCCATCTConserved hypothetical protein. 
AK066925TTCGGCCCATCTNONE 
AK104595TTCGGCCCATCTNONE 
J013092F14TTCGGCCCATCTNONE 
J023148N20TTCGGCCCATCTNONE 
J033131F06TTCGGCCCATCTNONE 
J053025L20TTCGGCCCATCTNONE 
J075003B20TTCGGCCCATCTNONE 
J075019N18TTCGGCCCATCTNONE 
J075032D10TTCGGCCCATCTNONE 
J075037G14TTCGGCCCATCTNONE 
J075098D24TTCGGCCCATCTNONE 
J075106M13TTCGGCCCATCTNONE 
J075122N14TTCGGCCCATCTNONE 
J075146E22TTCGGCCCATCTNONE 
J075187E06TTCGGCCCATCTNONE 
J075198I17TTCGGCCCATCTNONE 
J090023O05TTCGGCCCATCTNONE 
J100040E10TTCGGCCCATCTNONE 
J100080P12TTCGGCCCATCTNONE 
J100088B06TTCGGCCCATCTNONE 
Os09g0528100009-173-A08ACTGGGCCGAGANONE 
009-190-G12ACTGGGCCGAGANONE 
AK059096ACTGGGCCGAGASimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0531900AK073015CCTCGCCCACAAATGGGCCGAAASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0535000AK058712CCGTGGGCCGASimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488CCGTGGGCCGANONE 
AK069832CCGTGGGCCGANONE 
J100065D20CCGTGGGCCGANONE 
Os09g0538200009-076-A07TCGGCCCATCCANONE 
AB032061TCGGCCCATCCAProteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
J065184D10TCGGCCCATCCANONE 
J075134I16TCGGCCCATCCANONE 
J100031G24TCGGCCCATCCANONE 
Os09g0547200016-021-H03AGTTGGGCCGAGCCGNONE 
AK073078AGTTGGGCCGAGCCGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984AGTTGGGCCGAGCCGNONE 
J065005L05AGTTGGGCCGAGCCGNONE 
J065039C06AGTTGGGCCGAGCCGNONE 
J065116H17AGTTGGGCCGAGCCGNONE 
J100046A17AGTTGGGCCGAGCCGNONE 
Os09g0549700J053039F06TAATGGGCTTTCGGCCCATGTNONE 
J065089F23TAATGGGCTTTCGGCCCATGTRibosomal protein L18P/L5E family protein. 
J065090G14TAATGGGCTTTCGGCCCATGTNONE 
J065093M17TAATGGGCTTTCGGCCCATGTNONE 
J065096L23TAATGGGCTTTCGGCCCATGTNONE 
J065152A18TAATGGGCTTTCGGCCCATGTNONE 
J065155H12TAATGGGCTTTCGGCCCATGTNONE 
Os09g0558100009-028-D03ACGTGTCGGCCCATACNONE 
014-011-A04ACGTGTCGGCCCATACNONE 
AB030211ACGTGTCGGCCCATACSimilar to Low-temperature induced protein lt101.2. 
AK062410ACGTGTCGGCCCATACNONE 
J065006B17ACGTGTCGGCCCATACNONE 
J065067M15ACGTGTCGGCCCATACNONE 
J065075E19ACGTGTCGGCCCATACNONE 
J075011G16ACGTGTCGGCCCATACNONE 
J075015L22ACGTGTCGGCCCATACNONE 
J075035O11ACGTGTCGGCCCATACNONE 
J075072E15ACGTGTCGGCCCATACNONE 
J075100O22ACGTGTCGGCCCATACNONE 
Os09g0559800AK071542TTATGGGCCGASimilar to Transporter-like protein. 
J013063N24TTATGGGCCGANONE 
Os09g0572900AK069270TCGTGGGCCTCTCGGCCCAAGSimilar to Dynamin-related protein 1E (Dynamin-like protein E) (Dynamin-like protein 4) (Dynamin-like protein DLP2). 
Os09g0573000AK073399CTTGGGCCGAGAGGCCCACGAProtein prenyltransferase domain containing protein. 
Os11g0115800AK106102CTCGGCCCATAAConserved hypothetical protein. 
J065057N13CTCGGCCCATAANONE 
Os11g0116400AK059833GCTGGGCCGATGGGCTTCSimilar to Elongation factor P (EF-P). 
Os11g0132700AK103286TCGGCCCAGTACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0139100009-099-H06TCTCGGCCCACTNONE 
AK121443TCTCGGCCCACTSimilar to 50S ribosomal protein L24. 
J023140O18TCTCGGCCCACTNONE 
J023143M23TCTCGGCCCACTNONE 
J033079G04TCTCGGCCCACTNONE 
J043004D20TCTCGGCCCACTNONE 
J065097F05TCTCGGCCCACTNONE 
Os11g0139500AK121845AAATGGGCCGAAANONE 
Os11g0148600AK100066AAATGGGCCGAGAConserved hypothetical protein. 
AK100066ACATGGGCCGAGConserved hypothetical protein. 
AK102442AAATGGGCCGAGANONE 
AK102442ACATGGGCCGAGNONE 
J065167F17AAATGGGCCGAGANONE 
J065167F17ACATGGGCCGAGNONE 
Os11g0182400016-077-B04AGTTGGGCCGAGNONE 
AK112089AGTTGGGCCGAGCyclin-like F-box domain containing protein. 
Os11g0199600AK101774TCGGCCCATTAACGGCCCACGTZinc finger, CCHC-type domain containing protein. 
AK120040TCGGCCCATTAACGGCCCACGTNONE 
J023047I06TCGGCCCATTAACGGCCCACGTNONE 
J033064L23TCGGCCCATTAACGGCCCACGTNONE 
J033117I01TCGGCCCATTAACGGCCCACGTNONE 
J033123I18TCGGCCCATTAACGGCCCACGTNONE 
J053026H17TCGGCCCATTAACGGCCCACGTNONE 
J053078G05TCGGCCCATTAACGGCCCACGTNONE 
J065102A09TCGGCCCATTAACGGCCCACGTNONE 
J065113G11TCGGCCCATTAACGGCCCACGTNONE 
J065207F20TCGGCCCATTAACGGCCCACGTNONE 
J075027K21TCGGCCCATTAACGGCCCACGTNONE 
Os11g0219400AK069850CTCGGCCCAGGAnkyrin repeat containing protein. 
AK099123CTCGGCCCAGGNONE 
J023143G18CTCGGCCCAGGNONE 
Os11g0414000012-012-F01TCGGCCCACANONE 
AK071277TCGGCCCACAeIF4-gamma/eIF5/eIF2-epsilon domain containing protein. 
J023082M08TCGGCCCACANONE 
J023083E17TCGGCCCACANONE 
J023128I07TCGGCCCACANONE 
J033098J04TCGGCCCACANONE 
J033135G10TCGGCCCACANONE 
J043007L23TCGGCCCACANONE 
J065011N07TCGGCCCACANONE 
J065016E01TCGGCCCACANONE 
J065162N12TCGGCCCACANONE 
J065164O22TCGGCCCACANONE 
J065173J06TCGGCCCACANONE 
J065200E24TCGGCCCACANONE 
J065203K20TCGGCCCACANONE 
J075033N16TCGGCCCACANONE 
J075047L06TCGGCCCACANONE 
J075064J24TCGGCCCACANONE 
J075100O07TCGGCCCACANONE 
J075121G11TCGGCCCACANONE 
J075134A13TCGGCCCACANONE 
J075190F20TCGGCCCACANONE 
J075190H08TCGGCCCACANONE 
J080033L04TCGGCCCACANONE 
J080045O09TCGGCCCACANONE 
J080064J07TCGGCCCACANONE 
J080066N22TCGGCCCACANONE 
J080075C09TCGGCCCACANONE 
J090002C08TCGGCCCACANONE 
J090058G21TCGGCCCACANONE 
J090074M07TCGGCCCACANONE 
J100090G06TCGGCCCACANONE 
Os11g0539000AK071015TTTCGGCCCATCAConserved hypothetical protein. 
J023081E02TTTCGGCCCATCANONE 
Os11g0544000AK066017GCCGGCCCAACTCGGCCCAAGConserved hypothetical protein. 
AK071393GCCGGCCCAACTCGGCCCAAGNONE 
J013050C10GCCGGCCCAACTCGGCCCAAGNONE 
J013118O12GCCGGCCCAACTCGGCCCAAGNONE 
Os11g0602600006-046-H02ATCTCGGCCCATTTNONE 
006-046-H02TAATGGGCCGAGANONE 
006-056-H08ATCTCGGCCCATTTNONE 
006-056-H08TAATGGGCCGAGANONE 
009-116-D05ATCTCGGCCCATTTNONE 
009-116-D05TAATGGGCCGAGANONE 
AK072671ATCTCGGCCCATTTSimilar to 40S ribosomal protein S9. 
AK072671TAATGGGCCGAGASimilar to 40S ribosomal protein S9. 
AK104660ATCTCGGCCCATTTNONE 
AK104660TAATGGGCCGAGANONE 
J023134P20ATCTCGGCCCATTTNONE 
J023134P20TAATGGGCCGAGANONE 
J023141O13ATCTCGGCCCATTTNONE 
J023141O13TAATGGGCCGAGANONE 
J033066I15ATCTCGGCCCATTTNONE 
J033066I15TAATGGGCCGAGANONE 
J033076A08ATCTCGGCCCATTTNONE 
J033076A08TAATGGGCCGAGANONE 
J033150J23ATCTCGGCCCATTTNONE 
J033150J23TAATGGGCCGAGANONE 
J065114P19ATCTCGGCCCATTTNONE 
J065114P19TAATGGGCCGAGANONE 
J065176B01ATCTCGGCCCATTTNONE 
J065176B01TAATGGGCCGAGANONE 
J065207H21ATCTCGGCCCATTTNONE 
J065207H21TAATGGGCCGAGANONE 
J080301L21ATCTCGGCCCATTTNONE 
J080301L21TAATGGGCCGAGANONE 
J080308A08ATCTCGGCCCATTTNONE 
J080308A08TAATGGGCCGAGANONE 
J080318K23ATCTCGGCCCATTTNONE 
J080318K23TAATGGGCCGAGANONE 
J080319F17ATCTCGGCCCATTTNONE 
J080319F17TAATGGGCCGAGANONE 
J080319I10ATCTCGGCCCATTTNONE 
J080319I10TAATGGGCCGAGANONE 
J090028C08ATCTCGGCCCATTTNONE 
J090028C08TAATGGGCCGAGANONE 
J090051I24ATCTCGGCCCATTTNONE 
J090051I24TAATGGGCCGAGANONE 
J090053L21ATCTCGGCCCATTTNONE 
J090053L21TAATGGGCCGAGANONE 
J090069C20ATCTCGGCCCATTTNONE 
J090069C20TAATGGGCCGAGANONE 
J100017G08ATCTCGGCCCATTTNONE 
J100017G08TAATGGGCCGAGANONE 
J100042B06ATCTCGGCCCATTTNONE 
J100042B06TAATGGGCCGAGANONE 
J100045G24ATCTCGGCCCATTTNONE 
J100045G24TAATGGGCCGAGANONE 
J100050J19ATCTCGGCCCATTTNONE 
J100050J19TAATGGGCCGAGANONE 
J100052D23ATCTCGGCCCATTTNONE 
J100052D23TAATGGGCCGAGANONE 
J100053M03ATCTCGGCCCATTTNONE 
J100053M03TAATGGGCCGAGANONE 
J100056D08ATCTCGGCCCATTTNONE 
J100056D08TAATGGGCCGAGANONE 
J100066B19ATCTCGGCCCATTTNONE 
J100066B19TAATGGGCCGAGANONE 
J100071N23ATCTCGGCCCATTTNONE 
J100071N23TAATGGGCCGAGANONE 
J100074H01ATCTCGGCCCATTTNONE 
J100074H01TAATGGGCCGAGANONE 
J100074H19ATCTCGGCCCATTTNONE 
J100074H19TAATGGGCCGAGANONE 
J100077C06ATCTCGGCCCATTTNONE 
J100077C06TAATGGGCCGAGANONE 
Os11g0616200AK069189ATATGGGCTTTCGGCCCAAATConserved hypothetical protein. 
AK069189ATTTGGGCCGAAAGCCCAAAAConserved hypothetical protein. 
J023004N19ATATGGGCTTTCGGCCCAAATNONE 
J023004N19ATTTGGGCCGAAAGCCCAAAANONE 
Os11g0640000Os11g0640000TCGGCCCAATANB-ARC domain containing protein. 
Os11g0657200AK059959TCTCGGCCCATT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AATGGGCCGAGANONE 
AK062752AATGGGCCGAGASimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0703900011-004-D05CTCGGCCCATGTNONE 
011-014-C03CTCGGCCCATGTNONE 
011-016-C01CTCGGCCCATGTNONE 
011-017-B04CTCGGCCCATGTNONE 
011-017-E09CTCGGCCCATGTNONE 
011-019-E12CTCGGCCCATGTNONE 
011-021-H12CTCGGCCCATGTNONE 
011-025-H02CTCGGCCCATGTNONE 
011-027-B09CTCGGCCCATGTNONE 
011-039-G07CTCGGCCCATGTNONE 
011-044-G07CTCGGCCCATGTNONE 
011-046-F11CTCGGCCCATGTNONE 
011-070-F02CTCGGCCCATGTNONE 
011-071-A07CTCGGCCCATGTNONE 
011-082-A03CTCGGCCCATGTNONE 
011-086-B09CTCGGCCCATGTNONE 
011-092-C04CTCGGCCCATGTNONE 
012-006-F02CTCGGCCCATGTNONE 
012-011-G08CTCGGCCCATGTNONE 
012-026-C06CTCGGCCCATGTNONE 
012-026-G06CTCGGCCCATGTNONE 
012-028-E05CTCGGCCCATGTNONE 
012-040-A05CTCGGCCCATGTNONE 
012-045-C01CTCGGCCCATGTNONE 
012-046-A10CTCGGCCCATGTNONE 
012-047-H09CTCGGCCCATGTNONE 
012-059-A12CTCGGCCCATGTNONE 
012-072-D06CTCGGCCCATGTNONE 
012-073-D05CTCGGCCCATGTNONE 
012-076-D08CTCGGCCCATGTNONE 
012-079-G05CTCGGCCCATGTNONE 
012-080-A04CTCGGCCCATGTNONE 
012-080-E01CTCGGCCCATGTNONE 
012-083-C03CTCGGCCCATGTNONE 
012-083-G06CTCGGCCCATGTNONE 
012-086-G02CTCGGCCCATGTNONE 
012-091-A07CTCGGCCCATGTNONE 
012-094-G10CTCGGCCCATGTNONE 
012-098-A07CTCGGCCCATGTNONE 
012-100-G04CTCGGCCCATGTNONE 
015-001-A11CTCGGCCCATGTNONE 
015-033-E01CTCGGCCCATGTNONE 
015-047-F12CTCGGCCCATGTNONE 
015-054-E05CTCGGCCCATGTNONE 
015-063-H02CTCGGCCCATGTNONE 
015-075-E10CTCGGCCCATGTNONE 
015-086-F05CTCGGCCCATGTNONE 
016-031-A08CTCGGCCCATGTNONE 
016-053-A03CTCGGCCCATGTNONE 
016-054-C09CTCGGCCCATGTNONE 
016-079-C08CTCGGCCCATGTNONE 
AK065431CTCGGCCCATGTHeat shock protein 70. 
AK119255CTCGGCCCATGTNONE 
J013021C12CTCGGCCCATGTNONE 
J013021C17CTCGGCCCATGTNONE 
J023027B08CTCGGCCCATGTNONE 
J023078A21CTCGGCCCATGTNONE 
J023097M06CTCGGCCCATGTNONE 
J023100O04CTCGGCCCATGTNONE 
J023107B17CTCGGCCCATGTNONE 
J023108L24CTCGGCCCATGTNONE 
J023109L05CTCGGCCCATGTNONE 
J033022M22CTCGGCCCATGTNONE 
J033023K21CTCGGCCCATGTNONE 
J033031L11CTCGGCCCATGTNONE 
J033034H10CTCGGCCCATGTNONE 
J033037B16CTCGGCCCATGTNONE 
J033037F16CTCGGCCCATGTNONE 
J033037H07CTCGGCCCATGTNONE 
J033046E22CTCGGCCCATGTNONE 
J033050N12CTCGGCCCATGTNONE 
J033064F10CTCGGCCCATGTNONE 
J033064N10CTCGGCCCATGTNONE 
J033066O09CTCGGCCCATGTNONE 
J033068H01CTCGGCCCATGTNONE 
J033068J07CTCGGCCCATGTNONE 
J033070B10CTCGGCCCATGTNONE 
J033070G13CTCGGCCCATGTNONE 
J033073O13CTCGGCCCATGTNONE 
J033075B07CTCGGCCCATGTNONE 
J033079L15CTCGGCCCATGTNONE 
J033081J06CTCGGCCCATGTNONE 
J033086G13CTCGGCCCATGTNONE 
J033086N07CTCGGCCCATGTNONE 
J033086O05CTCGGCCCATGTNONE 
J033091A15CTCGGCCCATGTNONE 
J033091D05CTCGGCCCATGTNONE 
J033094C12CTCGGCCCATGTNONE 
J033099P03CTCGGCCCATGTNONE 
J033107L09CTCGGCCCATGTNONE 
J033108D16CTCGGCCCATGTNONE 
J033109E12CTCGGCCCATGTNONE 
J033109K14CTCGGCCCATGTNONE 
J033112P22CTCGGCCCATGTNONE 
J033116F12CTCGGCCCATGTNONE 
J033116K01CTCGGCCCATGTNONE 
J033118F19CTCGGCCCATGTNONE 
J033121J10CTCGGCCCATGTNONE 
J033126H04CTCGGCCCATGTNONE 
J033131G17CTCGGCCCATGTNONE 
J033131L05CTCGGCCCATGTNONE 
J033136A08CTCGGCCCATGTNONE 
J033136H22CTCGGCCCATGTNONE 
J033143F01CTCGGCCCATGTNONE 
J065040M10CTCGGCCCATGTNONE 
J065046F17CTCGGCCCATGTNONE 
J065048G20CTCGGCCCATGTNONE 
J065071N06CTCGGCCCATGTNONE 
J065084I24CTCGGCCCATGTNONE 
J065171B01CTCGGCCCATGTNONE 
J065191J21CTCGGCCCATGTNONE 
J065199I20CTCGGCCCATGTNONE 
J075076C02CTCGGCCCATGTNONE 
J090002P12CTCGGCCCATGTNONE 
J090003A11CTCGGCCCATGTNONE 
J090003H11CTCGGCCCATGTNONE 
J090009M22CTCGGCCCATGTNONE 
J090009O11CTCGGCCCATGTNONE 
J090014N09CTCGGCCCATGTNONE 
J090015A18CTCGGCCCATGTNONE 
J090016E16CTCGGCCCATGTNONE 
J090016I07CTCGGCCCATGTNONE 
J090017O07CTCGGCCCATGTNONE 
J090019E10CTCGGCCCATGTNONE 
J090020D24CTCGGCCCATGTNONE 
J090021M16CTCGGCCCATGTNONE 
J090022F13CTCGGCCCATGTNONE 
J090023H03CTCGGCCCATGTNONE 
J090024E15CTCGGCCCATGTNONE 
J090024G19CTCGGCCCATGTNONE 
J090026J19CTCGGCCCATGTNONE 
J090030E20CTCGGCCCATGTNONE 
J090030I15CTCGGCCCATGTNONE 
J090032F04CTCGGCCCATGTNONE 
J090033N22CTCGGCCCATGTNONE 
J090033O19CTCGGCCCATGTNONE 
J090036F08CTCGGCCCATGTNONE 
J090039A13CTCGGCCCATGTNONE 
J090042N07CTCGGCCCATGTNONE 
J090043C15CTCGGCCCATGTNONE 
J090043N09CTCGGCCCATGTNONE 
J090053J10CTCGGCCCATGTNONE 
J090054F14CTCGGCCCATGTNONE 
J090057N12CTCGGCCCATGTNONE 
J090061P13CTCGGCCCATGTNONE 
J090062F17CTCGGCCCATGTNONE 
J090065H15CTCGGCCCATGTNONE 
J090067P11CTCGGCCCATGTNONE 
J090068M09CTCGGCCCATGTNONE 
J090069E24CTCGGCCCATGTNONE 
J090069K16CTCGGCCCATGTNONE 
J090070N07CTCGGCCCATGTNONE 
J090072M09CTCGGCCCATGTNONE 
J090075I24CTCGGCCCATGTNONE 
J090075M04CTCGGCCCATGTNONE 
J090077D24CTCGGCCCATGTNONE 
J090080M17CTCGGCCCATGTNONE 
J090080O14CTCGGCCCATGTNONE 
J090081C12CTCGGCCCATGTNONE 
J090084N21CTCGGCCCATGTNONE 
J090084O21CTCGGCCCATGTNONE 
J090087J18CTCGGCCCATGTNONE 
J090092L17CTCGGCCCATGTNONE 
J090097A08CTCGGCCCATGTNONE 
J100017E24CTCGGCCCATGTNONE 
J100018K11CTCGGCCCATGTNONE 
J100019A16CTCGGCCCATGTNONE 
J100023I23CTCGGCCCATGTNONE 
J100024D07CTCGGCCCATGTNONE 
J100025H12CTCGGCCCATGTNONE 
J100027K19CTCGGCCCATGTNONE 
J100028C23CTCGGCCCATGTNONE 
J100029A14CTCGGCCCATGTNONE 
J100029O19CTCGGCCCATGTNONE 
J100030I09CTCGGCCCATGTNONE 
J100030J16CTCGGCCCATGTNONE 
J100031C01CTCGGCCCATGTNONE 
J100031N06CTCGGCCCATGTNONE 
J100033H04CTCGGCCCATGTNONE 
J100034L20CTCGGCCCATGTNONE 
J100036K13CTCGGCCCATGTNONE 
J100039M02CTCGGCCCATGTNONE 
J100040J01CTCGGCCCATGTNONE 
J100042O21CTCGGCCCATGTNONE 
J100042P20CTCGGCCCATGTNONE 
J100047K22CTCGGCCCATGTNONE 
J100049B16CTCGGCCCATGTNONE 
J100052M10CTCGGCCCATGTNONE 
J100053B05CTCGGCCCATGTNONE 
J100053B20CTCGGCCCATGTNONE 
J100055I11CTCGGCCCATGTNONE 
J100056A13CTCGGCCCATGTNONE 
J100057C08CTCGGCCCATGTNONE 
J100057N11CTCGGCCCATGTNONE 
J100057P07CTCGGCCCATGTNONE 
J100059E16CTCGGCCCATGTNONE 
J100063N14CTCGGCCCATGTNONE 
J100069H01CTCGGCCCATGTNONE 
J100071C17CTCGGCCCATGTNONE 
J100071K09CTCGGCCCATGTNONE 
J100077D07CTCGGCCCATGTNONE 
J100078P22CTCGGCCCATGTNONE 
J100080F11CTCGGCCCATGTNONE 
J100081L07CTCGGCCCATGTNONE 
J100083B10CTCGGCCCATGTNONE 
J100083K17CTCGGCCCATGTNONE 
J100085B22CTCGGCCCATGTNONE 
J100085L21CTCGGCCCATGTNONE 
J100086B11CTCGGCCCATGTNONE 
J100087E06CTCGGCCCATGTNONE 
J100087P07CTCGGCCCATGTNONE 
J100089H24CTCGGCCCATGTNONE 
Os12g0109600AK107606TCTGGGCCGACGGCCCATGGCCCAGProtein of unknown function DUF1677, Oryza sativa family protein. 
J053026B13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053033C09TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053059G21TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053071A13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075007L19TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075071J20TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075110F18TCTGGGCCGACGGCCCATGGCCCAGNONE 
Os12g0120000011-024-E09ACATGGGCCGAAANONE 
AK105399ACATGGGCCGAAAProtein of unknown function DUF936, plant family protein. 
Os12g0124400AK071024ATATGGGCCGAAExostosin-like family protein. 
Os12g0125200J065062L18AGATGGGCCGAAConserved hypothetical protein. 
Os12g0131300J090086B06TCGGCCCAGTAHypothetical protein. 
Os12g0145700AK071391CGGCTCGGCCCACCACPyruvate kinase family protein. 
J023013N02CGGCTCGGCCCACCACNONE 
J033085D15CGGCTCGGCCCACCACNONE 
J043021I09CGGCTCGGCCCACCACNONE 
J100055L05CGGCTCGGCCCACCACNONE 
Os12g0146300J065162K17TGTTGGGCTTTACATGGGCCGAGHypothetical protein. 
Os12g0168700AK065708GTTTGGGCCGAGAMP-dependent synthetase and ligase domain containing protein. 
AK065718GTTTGGGCCGAGNONE 
Os12g0233500Os12g0233500TCATGGGCCGANONE 
Os12g0244000AK106408CTTGGGCTCGGCCCAAGHypothetical protein. 
Os12g0279600AK070295CTCGGCCCATTAExodeoxyribonuclease III xth family protein. 
Os12g0507600009-155-B05GGGTGGGCCCATCTCGGCCCATGANONE 
009-155-B05TCCGGCCCACTTGTCGGCCCATGANONE 
AK070613GGGTGGGCCCATCTCGGCCCATGAConserved hypothetical protein. 
AK070613TCCGGCCCACTTGTCGGCCCATGAConserved hypothetical protein. 
J023063G03GGGTGGGCCCATCTCGGCCCATGANONE 
J023063G03TCCGGCCCACTTGTCGGCCCATGANONE 
Os12g0556100J065083C21TTTCGGCCCATCADrought induced 19 family protein. 
J065124M18TTTCGGCCCATCANONE 
J100032P22TTTCGGCCCATCANONE 
J100048N01TTTCGGCCCATCANONE 
Os12g0557800AK121691TCGGCCCAAACProtein prenyltransferase domain containing protein. 
J013095M03TCGGCCCAAACNONE 
J033071H11TCGGCCCAAACNONE 
J065101B02TCGGCCCAAACNONE 
Os12g0605400009-005-G05CTCGGCCCAACCCAGCCCACCTNONE 
016-024-B01CTCGGCCCAACCCAGCCCACCTNONE 
016-043-A11CTCGGCCCAACCCAGCCCACCTNONE 
AK068060CTCGGCCCAACCCAGCCCACCTSimilar to CROC-1-like protein (Fragment). 
J013130B07CTCGGCCCAACCCAGCCCACCTNONE 
J023141C14CTCGGCCCAACCCAGCCCACCTNONE 
J033037O04CTCGGCCCAACCCAGCCCACCTNONE 
J033081L17CTCGGCCCAACCCAGCCCACCTNONE 
J033108C03CTCGGCCCAACCCAGCCCACCTNONE 
J065079G22CTCGGCCCAACCCAGCCCACCTNONE 
J065082D03CTCGGCCCAACCCAGCCCACCTNONE 
J065207O15CTCGGCCCAACCCAGCCCACCTNONE 
J075027C23CTCGGCCCAACCCAGCCCACCTNONE 
J075037A17CTCGGCCCAACCCAGCCCACCTNONE 
J075056D17CTCGGCCCAACCCAGCCCACCTNONE 
J075064O21CTCGGCCCAACCCAGCCCACCTNONE 
J075096E08CTCGGCCCAACCCAGCCCACCTNONE 
J090036I15CTCGGCCCAACCCAGCCCACCTNONE 
J100018P15CTCGGCCCAACCCAGCCCACCTNONE 
J100074O06CTCGGCCCAACCCAGCCCACCTNONE 
Os12g0611000AK111837TTCGGCCCAACCSimilar to Zinc-finger protein Lsd1. 
Os12g0616900AK063753TCGGCCCAAASimilar to Pyruvate dehydrogenase E1 beta subunit (Fragment). 
AK101464TCGGCCCAAANONE 
J033126J16TCGGCCCAAANONE 
J065140B05TCGGCCCAAANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.