version

Summary of OsREG659 (All List)

OrganismOryza sativa  
IDOsREG659  
SequenceTGGCCCAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1937  

Entry Sequences (1937 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683AAAAGCCCATTAGTGGCCCAATANONE 
AK100613AAAAGCCCATTAGTGGCCCAATASimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
Os01g0132700J065063N10GTGGCCCAAGSurfeit locus 5 family protein. 
J065164N24GTGGCCCAAGNONE 
J065167H04GTGGCCCAAGNONE 
J065187N12GTGGCCCAAGNONE 
Os01g0132800AK068422CTGGCCCAAATPeptidyl-tRNA hydrolase family protein. 
Os01g0134200AK102394TTGGCCCAAGCAAGCCCAACAConserved hypothetical protein. 
Os01g0158000AK058679AGTTGGGCCACACGNONE 
AK103127AGTTGGGCCACACGImportin alpha-2 subunit. 
D78504AGTTGGGCCACACGNONE 
Os01g0196600AK101742CTTGGGCCAANONE 
U25430CTTGGGCCAASimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0235500AK121404GTGGCCCAAAConserved hypothetical protein. 
J023043C04GTGGCCCAAANONE 
J023059J21GTGGCCCAAANONE 
J023110N17GTGGCCCAAANONE 
J023132B02GTGGCCCAAANONE 
J023134M19GTGGCCCAAANONE 
Os01g0270100006-096-H09ATGGCCCAATANONE 
009-009-C10ATGGCCCAATANONE 
009-054-E06ATGGCCCAATANONE 
014-085-F09ATGGCCCAATANONE 
AK073275ATGGCCCAATANONE 
AK104155ATGGCCCAATANONE 
AK119511ATGGCCCAATASimilar to Cysteine protease inhibitor. 
J033025K21ATGGCCCAATANONE 
J075065H10ATGGCCCAATANONE 
J075143G10ATGGCCCAATANONE 
J100059J02ATGGCCCAATANONE 
Os01g0299400AK107814GGTTGGGCCAATTTTGGGCCGTASterile alpha motif homology domain containing protein. 
J065112H10GGTTGGGCCAATTTTGGGCCGTANONE 
Os01g0301100AK105556ATGGCCCAATConserved hypothetical protein. 
Os01g0327600AK120216TCTGGCCCAATNONE 
AK121799TCTGGCCCAATConserved hypothetical protein. 
J065081I07TCTGGCCCAATNONE 
J065082D04TCTGGCCCAATNONE 
J065082G10TCTGGCCCAATNONE 
J065085G24TCTGGCCCAATNONE 
J065105J24TCTGGCCCAATNONE 
J065128D18TCTGGCCCAATNONE 
J065155D13TCTGGCCCAATNONE 
J065200C11TCTGGCCCAATNONE 
Os01g0331900013-026-D04GTTTGGGCCAANONE 
013-026-D04TGTTGGGCCAGNONE 
AK064784GTTTGGGCCAANONE 
AK064784TGTTGGGCCAGNONE 
AK121761GTTTGGGCCAAProtein of unknown function DUF846, eukaryotic family protein. 
AK121761TGTTGGGCCAGProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTTTGGGCCAANONE 
J013000B15TGTTGGGCCAGNONE 
J033090D07GTTTGGGCCAANONE 
J033090D07TGTTGGGCCAGNONE 
J090006L21GTTTGGGCCAANONE 
J090006L21TGTTGGGCCAGNONE 
Os01g0391100AK108533TCTGGCCCAAANONE 
AK121200TCTGGCCCAAASimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
J023042H11TCTGGCCCAAANONE 
J023087I02TCTGGCCCAAANONE 
J065099C01TCTGGCCCAAANONE 
Os01g0591300AK101427AATTGGGCCAASimilar to Cytosolic aldehyde dehydrogenase RF2D. 
Os01g0618500011-019-D03ATTGGGCCAGGTTGGGCCATNONE 
AK067476ATTGGGCCAGGTTGGGCCATSimilar to RNA helicase (Fragment). 
J013020E19ATTGGGCCAGGTTGGGCCATNONE 
J033046J12ATTGGGCCAGGTTGGGCCATNONE 
J033055D06ATTGGGCCAGGTTGGGCCATNONE 
Os01g0621600AK100122ATTTGGGCCAGProtein of unknown function DUF1221 domain containing protein. 
Os01g0623500AK066142TTTTGGGCCAAAAA ATPase domain containing protein. 
J013055O07TTTTGGGCCAANONE 
J053069D06TTTTGGGCCAANONE 
J053095J11TTTTGGGCCAANONE 
J065106D24TTTTGGGCCAANONE 
J065134H18TTTTGGGCCAANONE 
J075066D09TTTTGGGCCAANONE 
J090004M17TTTTGGGCCAANONE 
J100039L05TTTTGGGCCAANONE 
J100042E15TTTTGGGCCAANONE 
J100043B18TTTTGGGCCAANONE 
J100057L11TTTTGGGCCAANONE 
J100067C24TTTTGGGCCAANONE 
J100073H01TTTTGGGCCAANONE 
J100081J21TTTTGGGCCAANONE 
Os01g0649000AK073564TCTGGCCCAATWD40-like domain containing protein. 
Os01g0678500AB071014TTGGCCCAACNONE 
AB100696TTGGCCCAACSimilar to Two-pore calcium channel. 
AK067839TTGGCCCAACNONE 
AK100998TTGGCCCAACNONE 
J013089O09TTGGCCCAACNONE 
J013126J24TTGGCCCAACNONE 
J013146L16TTGGCCCAACNONE 
J013160D06TTGGCCCAACNONE 
J090067N19TTGGCCCAACNONE 
J090070E11TTGGCCCAACNONE 
Os01g0692100J043022J20GTGGCCCAATGlutathione S-transferase, N-terminal domain containing protein. 
J100032K22GTGGCCCAATNONE 
Os01g0707300AK059962ATTTGGGCCATNONE 
AK104463ATTTGGGCCATSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0710000AK111794TTGGCCCAATASimilar to WD-repeat protein RBAP1. 
J023006D22TTGGCCCAATANONE 
J065106P04TTGGCCCAATANONE 
J100036G13TTGGCCCAATANONE 
Os01g0748100AK071261AATTGGGCCATHypothetical protein. 
AK071261GTGGCCCAAGCTGGGCCTAHypothetical protein. 
J023084C08AATTGGGCCATNONE 
J023084C08GTGGCCCAAGCTGGGCCTANONE 
J065058A07AATTGGGCCATNONE 
J065058A07GTGGCCCAAGCTGGGCCTANONE 
Os01g0760600011-038-B09CTTGGGCCACNONE 
AB110193CTTGGGCCACNONE 
AK103133CTTGGGCCACNONE 
AK104829CTTGGGCCACNONE 
D14673CTTGGGCCACNONE 
J023110C16CTTGGGCCACNONE 
J033028M22CTTGGGCCACNONE 
J033038A21CTTGGGCCACNONE 
J033044D24CTTGGGCCACNONE 
J033095C16CTTGGGCCACNONE 
J090003F07CTTGGGCCACNONE 
J090009P10CTTGGGCCACNONE 
J090023K01CTTGGGCCACNONE 
J090033G02CTTGGGCCACNONE 
J090037I22CTTGGGCCACNONE 
J090038A17CTTGGGCCACNONE 
J090048K09CTTGGGCCACNONE 
J090069N01CTTGGGCCACNONE 
J090078C19CTTGGGCCACNONE 
J090089P15CTTGGGCCACNONE 
J090093D07CTTGGGCCACNONE 
J090095H01CTTGGGCCACNONE 
J100057J03CTTGGGCCACNONE 
Os01g0773700003-115-A05TTGGCCCAACTNONE 
009-016-C08TTGGCCCAACTNONE 
009-027-A08TTGGCCCAACTNONE 
009-038-C02TTGGCCCAACTNONE 
009-087-D04TTGGCCCAACTNONE 
009-119-A01TTGGCCCAACTNONE 
009-125-D06TTGGCCCAACTNONE 
009-129-B06TTGGCCCAACTNONE 
009-136-G07TTGGCCCAACTNONE 
009-141-D09TTGGCCCAACTNONE 
009-149-C06TTGGCCCAACTNONE 
009-149-G03TTGGCCCAACTNONE 
009-149-H06TTGGCCCAACTNONE 
009-151-C05TTGGCCCAACTNONE 
009-153-D08TTGGCCCAACTNONE 
009-154-H12TTGGCCCAACTNONE 
009-181-C03TTGGCCCAACTNONE 
009-181-C06TTGGCCCAACTNONE 
009-181-G02TTGGCCCAACTNONE 
009-183-B06TTGGCCCAACTNONE 
009-187-D09TTGGCCCAACTNONE 
009-194-C07TTGGCCCAACTNONE 
009-194-C10TTGGCCCAACTNONE 
009-195-F10TTGGCCCAACTNONE 
009-199-G07TTGGCCCAACTNONE 
AK060438TTGGCCCAACTNONE 
AK060476TTGGCCCAACTNONE 
AK119161TTGGCCCAACTSimilar to Photosystem II reaction center W protein (PSII 6.1 kDa protein) (Fragment). 
J013132H23TTGGCCCAACTNONE 
J013158C16TTGGCCCAACTNONE 
J023008K22TTGGCCCAACTNONE 
J023012B02TTGGCCCAACTNONE 
J065045L04TTGGCCCAACTNONE 
J065046O07TTGGCCCAACTNONE 
J065048G02TTGGCCCAACTNONE 
J065060H11TTGGCCCAACTNONE 
J065101B04TTGGCCCAACTNONE 
J065148G21TTGGCCCAACTNONE 
J065158L13TTGGCCCAACTNONE 
J065180I22TTGGCCCAACTNONE 
J075007F14TTGGCCCAACTNONE 
J075047L09TTGGCCCAACTNONE 
J075122H09TTGGCCCAACTNONE 
J075175B12TTGGCCCAACTNONE 
J075193A01TTGGCCCAACTNONE 
J080303H08TTGGCCCAACTNONE 
J080305O21TTGGCCCAACTNONE 
J080306M22TTGGCCCAACTNONE 
Os01g0782300AK109175AGCCCACCTGGCCCAACAConserved hypothetical protein. 
Os01g0800300006-097-C12ATGGCCCAACCNONE 
014-070-C12ATGGCCCAACCNONE 
AK072549ATGGCCCAACCNONE 
AK100942ATGGCCCAACCNONE 
AK100951ATGGCCCAACCConserved hypothetical protein. 
AK106023ATGGCCCAACCNONE 
J023138D05ATGGCCCAACCNONE 
J075097P16ATGGCCCAACCNONE 
J075099F23ATGGCCCAACCNONE 
Os01g0805000009-045-H11TTGGCCCAAGNONE 
009-196-H08TTGGCCCAAGNONE 
J013094D22TTGGCCCAAGRibosomal protein L34 family protein. 
J013119F23TTGGCCCAAGNONE 
J065128B11TTGGCCCAAGNONE 
Os01g0810100AK071916GTTGGGCCACACGRibonuclease III domain containing protein. 
AK099056GTTGGGCCACACGNONE 
AK104320GTTGGGCCACACGNONE 
Os01g0821800015-005-A04ATTGGGCCATTGGCCCATTNONE 
AK073951ATTGGGCCATTGGCCCATTNONE 
AK103171ATTGGGCCATTGGCCCATTNONE 
AK119168ATTGGGCCATTGGCCCATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22ATTGGGCCATTGGCCCATTNONE 
J033098N09ATTGGGCCATTGGCCCATTNONE 
J033121G11ATTGGGCCATTGGCCCATTNONE 
J090030L03ATTGGGCCATTGGCCCATTNONE 
Os01g0825500AK060613CTTGGGCCATNONE 
AK072321CTTGGGCCATNONE 
AK103941CTTGGGCCATNodulin-like domain containing protein. 
J075053A14CTTGGGCCATNONE 
J075151J22CTTGGGCCATNONE 
J075174K14CTTGGGCCATNONE 
Os01g0842200003-126-E01TCTGGCCCAAGNONE 
AK102593TCTGGCCCAAGNONE 
AK119896TCTGGCCCAAGSimilar to Scarecrow-like 9 (Fragment). 
J013151G12TCTGGCCCAAGNONE 
J033098G15TCTGGCCCAAGNONE 
J090041L03TCTGGCCCAAGNONE 
J090069J20TCTGGCCCAAGNONE 
Os01g0891400J065077E24TTGGCCCAAAAConserved hypothetical protein. 
J065206I07TTGGCCCAAAANONE 
Os01g0911100AK062123ATGGCCCAATTNONE 
J013000B12ATGGCCCAATTNONE 
J013071L21ATGGCCCAATTNONE 
J013072J22ATGGCCCAATTNONE 
J065152F12ATGGCCCAATTNONE 
J065191K04ATGGCCCAATTNONE 
J100034F15ATGGCCCAATTNONE 
J100035A02ATGGCCCAATTNONE 
J100040O20ATGGCCCAATTNONE 
J100045D02ATGGCCCAATTNONE 
J100070A17ATGGCCCAATTNONE 
J100089B06ATGGCCCAATTNONE 
Os01g0916700Os01g0916700ATTGGGCCATTGGGCCACConserved hypothetical protein. 
Os01g0919900006-027-D02ATTGGGCCAGANONE 
009-156-F01ATTGGGCCAGANONE 
AK060087ATTGGGCCAGANONE 
Os01g0949700AK069037ATGGCCCAAGNONE 
J023004F17ATGGCCCAAGNONE 
J065063D04ATGGCCCAAGNONE 
J065196H02ATGGCCCAAGNONE 
J075198A05ATGGCCCAAGNONE 
Os01g0954000009-097-H04CTTGGGCCATNONE 
AK062729CTTGGGCCATNADPH-dependent FMN reductase family protein. 
Os01g0959900AK058375TTGGCCCAAAAConserved hypothetical protein. 
AK066497TTGGCCCAAAANONE 
Os01g0965400006-063-H08TTGGCCCAAAANONE 
011-037-A03TTGGCCCAAAANONE 
AK069647TTGGCCCAAAASimilar to Uridylate kinase (EC 2.7.4.-) (UK) (Uridine monophosphate kinase) (UMP kinase). 
AK104789TTGGCCCAAAANONE 
J013072N21TTGGCCCAAAANONE 
J023027E20TTGGCCCAAAANONE 
J023075O12TTGGCCCAAAANONE 
J033111H12TTGGCCCAAAANONE 
J080001F12TTGGCCCAAAANONE 
J080004J12TTGGCCCAAAANONE 
J080005N15TTGGCCCAAAANONE 
J080008D06TTGGCCCAAAANONE 
J080010I10TTGGCCCAAAANONE 
J080011D19TTGGCCCAAAANONE 
J080015G04TTGGCCCAAAANONE 
J080018O05TTGGCCCAAAANONE 
J080024K13TTGGCCCAAAANONE 
J080026M08TTGGCCCAAAANONE 
J080027H22TTGGCCCAAAANONE 
J080027L18TTGGCCCAAAANONE 
J080029C13TTGGCCCAAAANONE 
J080030A02TTGGCCCAAAANONE 
J080031C10TTGGCCCAAAANONE 
J080038L14TTGGCCCAAAANONE 
J080039B17TTGGCCCAAAANONE 
J080041C13TTGGCCCAAAANONE 
J080042A06TTGGCCCAAAANONE 
J080043L15TTGGCCCAAAANONE 
J080047C08TTGGCCCAAAANONE 
J080049C07TTGGCCCAAAANONE 
J080051M10TTGGCCCAAAANONE 
J080053F03TTGGCCCAAAANONE 
J080054B13TTGGCCCAAAANONE 
J080063K02TTGGCCCAAAANONE 
J080064L04TTGGCCCAAAANONE 
J080071B19TTGGCCCAAAANONE 
J080071M13TTGGCCCAAAANONE 
J080083P09TTGGCCCAAAANONE 
J080088G09TTGGCCCAAAANONE 
J080089I16TTGGCCCAAAANONE 
J080092E23TTGGCCCAAAANONE 
J080093B19TTGGCCCAAAANONE 
J080097H14TTGGCCCAAAANONE 
Os01g0976600AK072971GTGGCCCAATSimilar to Methlytransferase, UbiE/COQ5 family. 
J023148G18GTGGCCCAATNONE 
J075095H03GTGGCCCAATNONE 
J090089M19GTGGCCCAATNONE 
Os01g0978100005-013-E01GTGGCCCAAGNONE 
011-026-E02GTGGCCCAAGNONE 
011-064-C01GTGGCCCAAGNONE 
AK065007GTGGCCCAAGNONE 
AK065652GTGGCCCAAGSimilar to Cysteine synthase, mitochondrial precursor (EC 2.5.1.47) (O- acetylserine sulfhydrylase) (O-acetylserine (Thiol)-lyase) (CSase C) (CS-C) (OAS-TL C) (AtCS-C). 
AK099217GTGGCCCAAGNONE 
AK104704GTGGCCCAAGNONE 
J013001E19GTGGCCCAAGNONE 
J013034J22GTGGCCCAAGNONE 
J013037A05GTGGCCCAAGNONE 
J013038D12GTGGCCCAAGNONE 
J013043A14GTGGCCCAAGNONE 
J013044E11GTGGCCCAAGNONE 
J013058F11GTGGCCCAAGNONE 
J013059C10GTGGCCCAAGNONE 
J013059E23GTGGCCCAAGNONE 
J013071O13GTGGCCCAAGNONE 
J013072D12GTGGCCCAAGNONE 
J013096G01GTGGCCCAAGNONE 
J013110E17GTGGCCCAAGNONE 
J013130A19GTGGCCCAAGNONE 
J013158G08GTGGCCCAAGNONE 
J023037H20GTGGCCCAAGNONE 
J023038G11GTGGCCCAAGNONE 
J023042A17GTGGCCCAAGNONE 
J023045C21GTGGCCCAAGNONE 
J023052H13GTGGCCCAAGNONE 
J023055O19GTGGCCCAAGNONE 
J023065I12GTGGCCCAAGNONE 
J023087I12GTGGCCCAAGNONE 
J023114D12GTGGCCCAAGNONE 
J023126P03GTGGCCCAAGNONE 
J023132E20GTGGCCCAAGNONE 
J023133N04GTGGCCCAAGNONE 
J023134C14GTGGCCCAAGNONE 
J033039O20GTGGCCCAAGNONE 
J033067L02GTGGCCCAAGNONE 
J033094O10GTGGCCCAAGNONE 
J043017P11GTGGCCCAAGNONE 
J043036C15GTGGCCCAAGNONE 
J053090I03GTGGCCCAAGNONE 
J065013F14GTGGCCCAAGNONE 
J065019J10GTGGCCCAAGNONE 
J065036E05GTGGCCCAAGNONE 
J065040L23GTGGCCCAAGNONE 
J065050A13GTGGCCCAAGNONE 
J065089D03GTGGCCCAAGNONE 
J065193N04GTGGCCCAAGNONE 
J080011O20GTGGCCCAAGNONE 
J080015K08GTGGCCCAAGNONE 
J080022G05GTGGCCCAAGNONE 
J080027N24GTGGCCCAAGNONE 
J080032G19GTGGCCCAAGNONE 
J080046A18GTGGCCCAAGNONE 
J080046B08GTGGCCCAAGNONE 
J080051L24GTGGCCCAAGNONE 
J080053C23GTGGCCCAAGNONE 
J080054I20GTGGCCCAAGNONE 
J080074J03GTGGCCCAAGNONE 
J080080M04GTGGCCCAAGNONE 
J080080P15GTGGCCCAAGNONE 
J080086L08GTGGCCCAAGNONE 
J090019O07GTGGCCCAAGNONE 
J090033L11GTGGCCCAAGNONE 
J090036M14GTGGCCCAAGNONE 
J100054D04GTGGCCCAAGNONE 
J100064M06GTGGCCCAAGNONE 
Os02g0116400AK072347CTGGCCCAAATOligopeptide transporter OPT superfamily protein. 
Os02g0119700AK108777TCTGGCCCAACCProtein prenyltransferase domain containing protein. 
AK108777TTGGCCCAAATACGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0146700AK105609TTTTGGGCCACSimilar to PSMD2 subunit (Fragment). 
AK119490TTTTGGGCCACNONE 
AK121963TTTTGGGCCACNONE 
Os02g0235600009-009-H04ATTGGGCCATNONE 
009-165-G06ATTGGGCCATNONE 
AK120417ATTGGGCCATSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14ATTGGGCCATNONE 
J023106P11ATTGGGCCATNONE 
J033080L09ATTGGGCCATNONE 
J033123O05ATTGGGCCATNONE 
J065197A18ATTGGGCCATNONE 
J065216P16ATTGGGCCATNONE 
J075017F02ATTGGGCCATNONE 
J075025L16ATTGGGCCATNONE 
J075027P04ATTGGGCCATNONE 
J075039N01ATTGGGCCATNONE 
J075101F24ATTGGGCCATNONE 
J075132J15ATTGGGCCATNONE 
J075164K16ATTGGGCCATNONE 
J075174E19ATTGGGCCATNONE 
J100043C23ATTGGGCCATNONE 
J100067B11ATTGGGCCATNONE 
Os02g0281200009-184-D06TTGGCCCAACANONE 
AK063172TTGGCCCAACANONE 
Os02g0289700009-196-H06GTGGCCCAATANONE 
009-196-H06GTGGCCCAATAGTGTGGGCNONE 
014-005-D09GTGGCCCAATANONE 
014-005-D09GTGGCCCAATAGTGTGGGCNONE 
AK063231GTGGCCCAATASimilar to Glyceraldehyde-3-phosphate dehydrogenase, testis-specific (EC 1.2.1.12) (Spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase-2) (GAPDH-2). 
AK063231GTGGCCCAATAGTGTGGGCSimilar to Glyceraldehyde-3-phosphate dehydrogenase, testis-specific (EC 1.2.1.12) (Spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase-2) (GAPDH-2). 
Os02g0525900003-101-C07CTGGCCCAAANONE 
AK060822CTGGCCCAAANONE 
J013038N07CTGGCCCAAANONE 
J013058P13CTGGCCCAAANONE 
J013070M20CTGGCCCAAANONE 
J013074B15CTGGCCCAAANONE 
J013123G17CTGGCCCAAANONE 
J013132H12CTGGCCCAAANONE 
J013160H21CTGGCCCAAANONE 
J023013O04CTGGCCCAAANONE 
J023066L21CTGGCCCAAANONE 
J023089C06CTGGCCCAAANONE 
J023091H21CTGGCCCAAANONE 
J023128K04CTGGCCCAAANONE 
J033027I17CTGGCCCAAANONE 
J033042N22CTGGCCCAAANONE 
J033055J03CTGGCCCAAANONE 
J033071C12CTGGCCCAAANONE 
J033074A19CTGGCCCAAANONE 
J033112A11CTGGCCCAAANONE 
J033118D15CTGGCCCAAANONE 
J033121K15CTGGCCCAAANONE 
J090010F18CTGGCCCAAANONE 
J090020A15CTGGCCCAAANONE 
J090033P12CTGGCCCAAANONE 
J090050E21CTGGCCCAAANONE 
J090070G22CTGGCCCAAANONE 
J090090E04CTGGCCCAAANONE 
J100026L11CTGGCCCAAANONE 
J100036N10CTGGCCCAAANONE 
J100041H24CTGGCCCAAANONE 
Os02g0543200AK100963GTGGCCCAAGCyclin-like F-box domain containing protein. 
Os02g0566000AK059295ATTGGGCCACGTGGCGConserved hypothetical protein. 
J065115K07ATTGGGCCACGTGGCGNONE 
Os02g0580900AK120486GTGGCCCAAAATGF-beta receptor, type I/II extracellular region family protein. 
J100082N03GTGGCCCAAAANONE 
Os02g0595400AK069935CTGGCCCAAATConserved hypothetical protein. 
AK099175CTGGCCCAAATNONE 
AK103993CTGGCCCAAATNONE 
J065021M23CTGGCCCAAATNONE 
J065021M24CTGGCCCAAATNONE 
J065205M09CTGGCCCAAATNONE 
J100082C06CTGGCCCAAATNONE 
Os02g0595700006-057-E01TCTGGCCCAAACNONE 
006-082-F10TCTGGCCCAAACNONE 
006-087-C10TCTGGCCCAAACNONE 
006-091-H03TCTGGCCCAAACNONE 
006-094-A11TCTGGCCCAAACNONE 
AF145053TCTGGCCCAAACNONE 
AK064937TCTGGCCCAAACNONE 
AK066858TCTGGCCCAAACNONE 
AK104785TCTGGCCCAAACNONE 
AK119587TCTGGCCCAAACChloroplast translational elongation factor Tu. 
J013000P03TCTGGCCCAAACNONE 
Os02g0638400AK060633AATTGGGCCAGABRO1 domain containing protein. 
J065083J17AATTGGGCCAGANONE 
Os02g0655300006-024-H05TCTGGCCCAACTNONE 
006-032-G04TCTGGCCCAACTNONE 
006-045-F03TCTGGCCCAACTNONE 
006-076-D04TCTGGCCCAACTNONE 
006-086-C09TCTGGCCCAACTNONE 
006-104-C07TCTGGCCCAACTNONE 
AK061544TCTGGCCCAACTNONE 
AK103778TCTGGCCCAACTNONE 
AK106107TCTGGCCCAACTNONE 
AK120006TCTGGCCCAACTNONE 
AY363174TCTGGCCCAACTSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21TCTGGCCCAACTNONE 
J065021C16TCTGGCCCAACTNONE 
J065182F01TCTGGCCCAACTNONE 
J075063I18TCTGGCCCAACTNONE 
J075151E01TCTGGCCCAACTNONE 
J075198K18TCTGGCCCAACTNONE 
J090026M06TCTGGCCCAACTNONE 
J090081H02TCTGGCCCAACTNONE 
J100061E20TCTGGCCCAACTNONE 
Os02g0655700AK101068AATTGGGCCATAmino acid/polyamine transporter I family protein. 
J013026C06AATTGGGCCATNONE 
J033023I17AATTGGGCCATNONE 
Os02g0658300AK073923CTTGGGCCAAConserved hypothetical protein. 
AK073923TCTGGCCCAACAConserved hypothetical protein. 
J065152M15CTTGGGCCAANONE 
J065152M15TCTGGCCCAACANONE 
Os02g0665400AK073914CTTGGGCCACNONE 
AK109787CTTGGGCCACNONE 
AK120141CTTGGGCCACSimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19CTTGGGCCACNONE 
J075165B08CTTGGGCCACNONE 
J075177B03CTTGGGCCACNONE 
J075191K02CTTGGGCCACNONE 
J090051I12CTTGGGCCACNONE 
J090057E21CTTGGGCCACNONE 
J090058E01CTTGGGCCACNONE 
J090087C06CTTGGGCCACNONE 
J100025K07CTTGGGCCACNONE 
J100026I21CTTGGGCCACNONE 
J100041E12CTTGGGCCACNONE 
J100083B01CTTGGGCCACNONE 
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein. 
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
Os02g0681100AK100584GTTTGGGCCATProtein of unknown function DUF604 family protein. 
J023106A15GTTTGGGCCATNONE 
Os02g0688900AK066093ATTTGGGCCATGPI transamidase subunit PIG-U family protein. 
J065007D18ATTTGGGCCATNONE 
J065040G21ATTTGGGCCATNONE 
J065103G03ATTTGGGCCATNONE 
J065175F18ATTTGGGCCATNONE 
J065202A07ATTTGGGCCATNONE 
J075006C01ATTTGGGCCATNONE 
J075178F24ATTTGGGCCATNONE 
Os02g0697200015-013-B10ATTGGGCCACNONE 
AK059475ATTGGGCCACNONE 
AK102993ATTGGGCCACConserved hypothetical protein. 
J033079I18ATTGGGCCACNONE 
J033082A14ATTGGGCCACNONE 
J065047H08ATTGGGCCACNONE 
J065131M14ATTGGGCCACNONE 
Os02g0732900AK065796TTTTGGGCCATProtein of unknown function DUF794, plant family protein. 
AK104342TTTTGGGCCATNONE 
Os02g0753700009-083-H09TTGGCCCAAAANONE 
AK062661TTGGCCCAAAANONE 
AK103542TTGGCCCAAAAVQ domain containing protein. 
J100025D08TTGGCCCAAAANONE 
J100035B22TTGGCCCAAAANONE 
Os02g0754700AK066904TTGGCCCAATASimilar to Histidyl-tRNA synthetase (EC 6.1.1.21). 
AK099136TTGGCCCAATANONE 
Os02g0755200AK070699AGTTGGGCCATSimilar to FLOWERING LOCUS D (Fragment). 
J023056I20AGTTGGGCCATNONE 
J065048B13AGTTGGGCCATNONE 
J065128H21AGTTGGGCCATNONE 
J065201E09AGTTGGGCCATNONE 
Os02g0778200AK065948ACCGGCCCAAGTTGGCCCAAGAminoacyl-tRNA synthetase, class I family protein. 
Os02g0791200AK120632TTTTGGGCCAAZinc finger, RING-type domain containing protein. 
J013153H21TTTTGGGCCAANONE 
J075179E08TTTTGGGCCAANONE 
J075181C07TTTTGGGCCAANONE 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0814300AK111376ATTTGGGCCACCytochrome c, monohaem domain containing protein. 
AK111376TTTTGGGCCAGCytochrome c, monohaem domain containing protein. 
J065063I24ATTTGGGCCACNONE 
J065063I24TTTTGGGCCAGNONE 
Os02g0815300AK061607TGTTGGGCCATConserved hypothetical protein. 
J075088I01TGTTGGGCCATNONE 
Os03g0123300003-131-G09ATGGCCCAAACNONE 
AK058595ATGGCCCAAACNONE 
AK070642ATGGCCCAAACSimilar to Cell cycle switch protein. 
J075056B01ATGGCCCAAACNONE 
Os03g0124300AK069148CTTGGGCCAAConserved hypothetical protein. 
AK106076CTTGGGCCAANONE 
J023003G19CTTGGGCCAANONE 
Os03g0142800015-062-B07CTGGCCCAAACNONE 
AK064325CTGGCCCAAACNONE 
Os03g0168200AK099530AGTTGGGCCAAConserved hypothetical protein. 
Os03g0198400AK059522CTGGCCCAACTTGGGCCCATCCNONE 
AK103101CTGGCCCAACTTGGGCCCATCCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19CTGGCCCAACTTGGGCCCATCCNONE 
J075036K08CTGGCCCAACTTGGGCCCATCCNONE 
J075040J23CTGGCCCAACTTGGGCCCATCCNONE 
J075041H18CTGGCCCAACTTGGGCCCATCCNONE 
J075053H18CTGGCCCAACTTGGGCCCATCCNONE 
J075055K15CTGGCCCAACTTGGGCCCATCCNONE 
J075111K03CTGGCCCAACTTGGGCCCATCCNONE 
J075125B22CTGGCCCAACTTGGGCCCATCCNONE 
J075195L10CTGGCCCAACTTGGGCCCATCCNONE 
Os03g0219200011-045-E01CTGGCCCAAAANONE 
AK073785CTGGCCCAAAASimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19CTGGCCCAAAANONE 
J043009H23CTGGCCCAAAANONE 
Os03g0227000AK068454CTGGCCCAACASimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP). 
AK068454GTTTGGGCCAASimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP). 
Os03g0232500AK110980TTTTGGGCCACGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TTTTGGGCCACNONE 
Os03g0257900009-150-G06TGTTGGGCCAANONE 
009-181-H05TGTTGGGCCAANONE 
AK063892TGTTGGGCCAANONE 
AK100114TGTTGGGCCAASimilar to Lectin-like receptor kinase 7;2. 
AK103486TGTTGGGCCAANONE 
J023006K11TGTTGGGCCAANONE 
J075005E15TGTTGGGCCAANONE 
J075007K24TGTTGGGCCAANONE 
J075034G06TGTTGGGCCAANONE 
J075051I19TGTTGGGCCAANONE 
J075076A08TGTTGGGCCAANONE 
J075096H04TGTTGGGCCAANONE 
J075115I09TGTTGGGCCAANONE 
J075132K23TGTTGGGCCAANONE 
J075147C17TGTTGGGCCAANONE 
J090059O20TGTTGGGCCAANONE 
Os03g0261500AK061995TTTGGGCCATNONE 
J013044K20TTTGGGCCATNONE 
J033113A11TTTGGGCCATNONE 
J100032O18TTTGGGCCATNONE 
J100037K21TTTGGGCCATNONE 
Os03g0277000AK100522TCTGGCCCAAAASimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0283300AK070169ATGGCCCAAGGGCCCATTTConserved hypothetical protein. 
Os03g0288400Os03g0288400GAGGCCCATTGGCCCAATAConserved hypothetical protein. 
Os03g0294600AK110762TCTGGCCCAAGSimilar to Importin-beta1. 
Os03g0297100006-113-D12CTGGCCCAACNONE 
AK059192CTGGCCCAACNONE 
AK061276CTGGCCCAACSimilar to 40S ribosomal protein S7. 
AK122143CTGGCCCAACNONE 
J023012D24CTGGCCCAACNONE 
J023041A08CTGGCCCAACNONE 
J033067H08CTGGCCCAACNONE 
J033119B03CTGGCCCAACNONE 
J033131K19CTGGCCCAACNONE 
J033136J20CTGGCCCAACNONE 
J053027D07CTGGCCCAACNONE 
J065191B01CTGGCCCAACNONE 
J065205G10CTGGCCCAACNONE 
J075112A12CTGGCCCAACNONE 
J075136D05CTGGCCCAACNONE 
J080069C17CTGGCCCAACNONE 
J090073P06CTGGCCCAACNONE 
J100026B16CTGGCCCAACNONE 
J100068P21CTGGCCCAACNONE 
J100069E15CTGGCCCAACNONE 
J100081D07CTGGCCCAACNONE 
J100088C15CTGGCCCAACNONE 
Os03g0302700006-099-F12ATTGGGCCACNONE 
AK112010ATTGGGCCACZinc finger, RING-type domain containing protein. 
AK121656ATTGGGCCACNONE 
J075090A19ATTGGGCCACNONE 
J075148M06ATTGGGCCACNONE 
Os03g0308000016-023-H09CTGGCCCAACNONE 
AK100355CTGGCCCAACUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CTGGCCCAACNONE 
J023043K04CTGGCCCAACNONE 
J023083I20CTGGCCCAACNONE 
J033068F22CTGGCCCAACNONE 
J033125P21CTGGCCCAACNONE 
J065207A22CTGGCCCAACNONE 
J100018D20CTGGCCCAACNONE 
J100026L17CTGGCCCAACNONE 
J100055D14CTGGCCCAACNONE 
J100060P03CTGGCCCAACNONE 
J100078A20CTGGCCCAACNONE 
Os03g0341100009-012-D06TTGGCCCAACCNONE 
AK121580TTGGCCCAACCSimilar to 60S ribosomal protein L18. 
J033037B18TTGGCCCAACCNONE 
J053090K21TTGGCCCAACCNONE 
J065040D12TTGGCCCAACCNONE 
J075106P15TTGGCCCAACCNONE 
J075117P13TTGGCCCAACCNONE 
J075128N02TTGGCCCAACCNONE 
J090031L12TTGGCCCAACCNONE 
J100023E19TTGGCCCAACCNONE 
J100033O21TTGGCCCAACCNONE 
J100070A12TTGGCCCAACCNONE 
J100087M20TTGGCCCAACCNONE 
Os03g0345100AK065579TATTGGGCCACRad9 family protein. 
J100033H02TATTGGGCCACNONE 
Os03g0405000AK070839GTGGCCCAATReticulon family protein. 
Os03g0405500AK069583ATGGCCCAAGSimilar to PDI-like protein. 
Os03g0646300AK069229TTGGCCCAAAASimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0701900AK068404CTGGCCCAAAAConserved hypothetical protein. 
Os03g0704400AK101297CTTGGGCCAGProtein kinase domain containing protein. 
J033033I19CTTGGGCCAGNONE 
J090009M06CTTGGGCCAGNONE 
Os03g0709000009-027-F11GTGGCCCAATANONE 
009-147-F02GTGGCCCAATANONE 
015-068-A04GTGGCCCAATANONE 
AK062406GTGGCCCAATAMembrane-associated proteins in eicosanoid and glutathione metabolism (MAPEG) family protein. 
Os03g0712200AK073205AACTGGGCCCGGTTGGGCCAGZinc finger, RanBP2-type domain containing protein. 
AK098968AACTGGGCCCGGTTGGGCCAGNONE 
Os03g0726900AK072553GGCCCGTTTGGGCCACConserved hypothetical protein. 
AK100280GGCCCGTTTGGGCCACNONE 
Os03g0727100AK068587ATTGGGCCAGAConserved hypothetical protein. 
J013153F04ATTGGGCCAGANONE 
J065165J09ATTGGGCCAGANONE 
Os03g0734400009-076-E05CTTGGGCCATNONE 
AK062628CTTGGGCCATRibosomal protein L7/L12 family protein. 
Os03g0740700011-093-H12TATTGGGCCAANONE 
AK102723TATTGGGCCAAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19TATTGGGCCAANONE 
J013126N16TATTGGGCCAANONE 
J033105J16TATTGGGCCAANONE 
J090059D19TATTGGGCCAANONE 
Os03g0741500AK110867ATGGCCCAATSimilar to Cytochrome P450 71A1 (EC 1.14.-.-) (CYPLXXIA1) (ARP-2). 
Os03g0758700AK106620GTGGCCCAACAWD40-like domain containing protein. 
Os03g0776900AK107941TATTGGGCCACATGGGCCTCSimilar to DNAJ protein-like. 
J053100E14TATTGGGCCACATGGGCCTCNONE 
J075111A12TATTGGGCCACATGGGCCTCNONE 
Os03g0792400AK064808AGTTGGGCCAGPeptidase M50 family protein. 
J013000D19AGTTGGGCCAGNONE 
J013106E22AGTTGGGCCAGNONE 
J075053A21AGTTGGGCCAGNONE 
Os03g0793100AK067897GTTTGGGCCACGlycosyl transferase, family 43 protein. 
J033125G24GTTTGGGCCACNONE 
J065132N21GTTTGGGCCACNONE 
Os03g0802300AK120564TGTTGGGCCAGConserved hypothetical protein. 
AK120687TGTTGGGCCAGNONE 
Os03g0820100011-030-A10ATGGCCCAATTNONE 
011-031-C01ATGGCCCAATTNONE 
AK111534ATGGCCCAATTSimilar to Auxin-resistance protein AXR1. 
J013033L14ATGGCCCAATTNONE 
J013034D14ATGGCCCAATTNONE 
J013065N20ATGGCCCAATTNONE 
J013127A04ATGGCCCAATTNONE 
J013146A11ATGGCCCAATTNONE 
J023025D19ATGGCCCAATTNONE 
J023083K15ATGGCCCAATTNONE 
J033037N01ATGGCCCAATTNONE 
J033041H02ATGGCCCAATTNONE 
J043009M22ATGGCCCAATTNONE 
J090039L03ATGGCCCAATTNONE 
J090050L08ATGGCCCAATTNONE 
J090053J21ATGGCCCAATTNONE 
J090088G07ATGGCCCAATTNONE 
Os03g0821900AK070847ATTTGGGCCATSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0855700AK070400ATGGCCCAAATNucleic acid-binding, OB-fold domain containing protein. 
Os04g0105700004-005-E05ATTGGGCCAGNONE 
006-037-C11ATTGGGCCAGNONE 
006-039-E07ATTGGGCCAGNONE 
006-049-A02ATTGGGCCAGNONE 
006-076-D05ATTGGGCCAGNONE 
006-089-E04ATTGGGCCAGNONE 
006-097-F12ATTGGGCCAGNONE 
AK060872ATTGGGCCAGNONE 
AK065082ATTGGGCCAGNONE 
AK104254ATTGGGCCAGConserved hypothetical protein. 
AK104546ATTGGGCCAGNONE 
AK104634ATTGGGCCAGNONE 
AY224557ATTGGGCCAGNONE 
J013001L09ATTGGGCCAGNONE 
J013151B18ATTGGGCCAGNONE 
J023054G18ATTGGGCCAGNONE 
Os04g0195100AK107201GGTTGGGCCATCyclin-like F-box domain containing protein. 
Os04g0208500015-079-C10GTTTGGGCCATNONE 
015-079-C10TTGGCCCAACCNONE 
AK106410GTTTGGGCCATCyclin-like F-box domain containing protein. 
AK106410TTGGCCCAACCCyclin-like F-box domain containing protein. 
Os04g0282400AK120187ATGGCCCAAGSimilar to FPF1 protein-like (RAA1). 
J013034O10ATGGCCCAAGNONE 
J013071G20ATGGCCCAAGNONE 
Os04g0496400011-042-H11CTGGCCCAATNONE 
AK111787CTGGCCCAATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY224465CTGGCCCAATNONE 
J033106N02CTGGCCCAATNONE 
J043026P11CTGGCCCAATNONE 
J065134J18CTGGCCCAATNONE 
Os04g0503800J065116G03TTTTGGGCCAGNONE 
Os04g0504200AK110863TGTTGGGCCAAConserved hypothetical protein. 
Os04g0509500AK107601TTGGCCCAAACSimilar to Ammonium transporter Amt1;1 (Fragment). 
Os04g0520900AK068793TGTTGGGCCAAProtein prenyltransferase domain containing protein. 
AK105606TGTTGGGCCAANONE 
Os04g0564700AK111806ATTGGGCCAGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os04g0585600006-117-A02TCTGGCCCAAAANONE 
AK106073TCTGGCCCAAAAConserved hypothetical protein. 
J053089I23TCTGGCCCAAAANONE 
J065112K06TCTGGCCCAAAANONE 
J065128D09TCTGGCCCAAAANONE 
J100038D09TCTGGCCCAAAANONE 
Os04g0595000AK106907TTGGCCCAAGPeptidase A1, pepsin family protein. 
Os04g0611300009-006-G08TATTGGGCTGGCCCAATTNONE 
009-011-C01TATTGGGCTGGCCCAATTNONE 
009-036-B09TATTGGGCTGGCCCAATTNONE 
009-116-G09TATTGGGCTGGCCCAATTNONE 
009-126-E09TATTGGGCTGGCCCAATTNONE 
009-132-F09TATTGGGCTGGCCCAATTNONE 
009-151-G07TATTGGGCTGGCCCAATTNONE 
009-155-C07TATTGGGCTGGCCCAATTNONE 
009-163-G01TATTGGGCTGGCCCAATTNONE 
009-169-G08TATTGGGCTGGCCCAATTNONE 
009-191-B02TATTGGGCTGGCCCAATTNONE 
009-196-A08TATTGGGCTGGCCCAATTNONE 
009-198-E07TATTGGGCTGGCCCAATTNONE 
014-015-F04TATTGGGCTGGCCCAATTNONE 
015-087-H04TATTGGGCTGGCCCAATTNONE 
AK062605TATTGGGCTGGCCCAATTNONE 
AK063022TATTGGGCTGGCCCAATTConserved hypothetical protein. 
AK066749TATTGGGCTGGCCCAATTNONE 
AK104924TATTGGGCTGGCCCAATTNONE 
J065002M20TATTGGGCTGGCCCAATTNONE 
J065045L23TATTGGGCTGGCCCAATTNONE 
J065101E05TATTGGGCTGGCCCAATTNONE 
J065140J23TATTGGGCTGGCCCAATTNONE 
J065179G11TATTGGGCTGGCCCAATTNONE 
J065191B18TATTGGGCTGGCCCAATTNONE 
J065192E03TATTGGGCTGGCCCAATTNONE 
J065199H21TATTGGGCTGGCCCAATTNONE 
J075067F01TATTGGGCTGGCCCAATTNONE 
J075089L01TATTGGGCTGGCCCAATTNONE 
J075147K22TATTGGGCTGGCCCAATTNONE 
J080069G23TATTGGGCTGGCCCAATTNONE 
J100053D10TATTGGGCTGGCCCAATTNONE 
J100078C10TATTGGGCTGGCCCAATTNONE 
Os04g0612600AB042115TTGGCCCAATNONE 
AK060707TTGGCCCAATSimilar to Coatomer-like protein, epsilon subunit. 
AK099008TTGGCCCAATNONE 
AK104427TTGGCCCAATNONE 
J023043H02TTGGCCCAATNONE 
J033033I23TTGGCCCAATNONE 
J033067P21TTGGCCCAATNONE 
J033088M21TTGGCCCAATNONE 
J033133M08TTGGCCCAATNONE 
J043030I16TTGGCCCAATNONE 
J075049H08TTGGCCCAATNONE 
Os04g0658300AK067399CTTGGGCCAGSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
AK067399GTTGGGCCATSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0663200006-074-D02CTGGCCCAAGNONE 
AK105958CTGGCCCAAGZinc finger, CCCH-type domain containing protein. 
AK111925CTGGCCCAAGNONE 
Os04g0665700013-084-D06GTGGCCCAAAGCCCAAGNONE 
AK121951GTGGCCCAAAGCCCAAGZinc finger, CCCH-type domain containing protein. 
J013020L20GTGGCCCAAAGCCCAAGNONE 
J033034K12GTGGCCCAAAGCCCAAGNONE 
J033107K04GTGGCCCAAAGCCCAAGNONE 
J065044C03GTGGCCCAAAGCCCAAGNONE 
J065103I10GTGGCCCAAAGCCCAAGNONE 
J065106P15GTGGCCCAAAGCCCAAGNONE 
J075061O20GTGGCCCAAAGCCCAAGNONE 
J075091P11GTGGCCCAAAGCCCAAGNONE 
J075095A18GTGGCCCAAAGCCCAAGNONE 
J075117C22GTGGCCCAAAGCCCAAGNONE 
J075166B22GTGGCCCAAAGCCCAAGNONE 
J075198L04GTGGCCCAAAGCCCAAGNONE 
J090032K13GTGGCCCAAAGCCCAAGNONE 
J090045E22GTGGCCCAAAGCCCAAGNONE 
Os04g0674350J065104O14CTGGCCCAATANONE 
J065118J19CTGGCCCAATANONE 
J065167I12CTGGCCCAATAHypothetical protein. 
Os04g0674400015-042-B08TATTGGGCCAGNONE 
AK102124TATTGGGCCAGSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22TATTGGGCCAGNONE 
J023022I24TATTGGGCCAGNONE 
J023120A15TATTGGGCCAGNONE 
J023123P20TATTGGGCCAGNONE 
J033068P09TATTGGGCCAGNONE 
J033107G22TATTGGGCCAGNONE 
J033116G12TATTGGGCCAGNONE 
J033133F03TATTGGGCCAGNONE 
J033143B20TATTGGGCCAGNONE 
J043006G12TATTGGGCCAGNONE 
J043027M18TATTGGGCCAGNONE 
J043034H17TATTGGGCCAGNONE 
J090091E20TATTGGGCCAGNONE 
J100035H09TATTGGGCCAGNONE 
J100037J04TATTGGGCCAGNONE 
J100047J24TATTGGGCCAGNONE 
J100059G06TATTGGGCCAGNONE 
J100066O12TATTGGGCCAGNONE 
J100074G23TATTGGGCCAGNONE 
J100077M12TATTGGGCCAGNONE 
Os04g0683900004-009-A11GTTGGGCCAANONE 
014-076-H12GTTGGGCCAANONE 
AK060880GTTGGGCCAANONE 
AK099749GTTGGGCCAAHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309GTTGGGCCAANONE 
J013050K21GTTGGGCCAANONE 
J013092E09GTTGGGCCAANONE 
J013095N06GTTGGGCCAANONE 
J013095P07GTTGGGCCAANONE 
J013130D22GTTGGGCCAANONE 
J013134O15GTTGGGCCAANONE 
J023022I06GTTGGGCCAANONE 
J023062L11GTTGGGCCAANONE 
J023078J11GTTGGGCCAANONE 
J023086J01GTTGGGCCAANONE 
J033125A20GTTGGGCCAANONE 
J065023K13GTTGGGCCAANONE 
J065045N02GTTGGGCCAANONE 
J065129F01GTTGGGCCAANONE 
J065164H14GTTGGGCCAANONE 
J065192H09GTTGGGCCAANONE 
J075064P15GTTGGGCCAANONE 
J075088G17GTTGGGCCAANONE 
J075199D20GTTGGGCCAANONE 
Os04g0685800AK070891GTGTGGGCCTGGCCCAACTSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GTGTGGGCCTGGCCCAACTNONE 
J023069G19GTGTGGGCCTGGCCCAACTNONE 
J023097E09GTGTGGGCCTGGCCCAACTNONE 
J065071A01GTGTGGGCCTGGCCCAACTNONE 
J065186F08GTGTGGGCCTGGCCCAACTNONE 
J075044B21GTGTGGGCCTGGCCCAACTNONE 
J075120N18GTGTGGGCCTGGCCCAACTNONE 
J075131B22GTGTGGGCCTGGCCCAACTNONE 
J100041H18GTGTGGGCCTGGCCCAACTNONE 
J100042P13GTGTGGGCCTGGCCCAACTNONE 
Os04g0686600AK068427CTTGGGCCAAProtein kinase domain containing protein. 
J013155F22CTTGGGCCAANONE 
J023020E07CTTGGGCCAANONE 
Os05g0103500AK060306ATGGCCCAAACHCH domain containing protein. 
AK102829ATGGCCCAAANONE 
J033109D16ATGGCCCAAANONE 
J043016E20ATGGCCCAAANONE 
J065001C14ATGGCCCAAANONE 
J065116L24ATGGCCCAAANONE 
J075018E04ATGGCCCAAANONE 
J075045E18ATGGCCCAAANONE 
J075093G20ATGGCCCAAANONE 
J075171A09ATGGCCCAAANONE 
J100029F18ATGGCCCAAANONE 
J100046I24ATGGCCCAAANONE 
Os05g0110100009-015-D08AATTGGGCCAANONE 
009-023-C09AATTGGGCCAANONE 
009-031-B11AATTGGGCCAANONE 
009-034-C02AATTGGGCCAANONE 
009-050-B08AATTGGGCCAANONE 
009-065-D12AATTGGGCCAANONE 
009-090-G08AATTGGGCCAANONE 
009-111-H07AATTGGGCCAANONE 
009-136-F12AATTGGGCCAANONE 
009-138-E06AATTGGGCCAANONE 
009-138-G12AATTGGGCCAANONE 
009-141-D08AATTGGGCCAANONE 
009-143-D01AATTGGGCCAANONE 
009-179-D09AATTGGGCCAANONE 
009-179-E03AATTGGGCCAANONE 
009-196-A09AATTGGGCCAANONE 
009-199-F04AATTGGGCCAANONE 
013-021-E05AATTGGGCCAANONE 
013-076-C04AATTGGGCCAANONE 
013-096-F06AATTGGGCCAANONE 
014-071-A05AATTGGGCCAANONE 
014-077-F09AATTGGGCCAANONE 
AK099779AATTGGGCCAANONE 
AK121142AATTGGGCCAAConserved hypothetical protein. 
J013095A16AATTGGGCCAANONE 
J013111A17AATTGGGCCAANONE 
J013132G04AATTGGGCCAANONE 
J023077M04AATTGGGCCAANONE 
J065001B11AATTGGGCCAANONE 
J065001E11AATTGGGCCAANONE 
J065057G10AATTGGGCCAANONE 
J065057L08AATTGGGCCAANONE 
J065080E07AATTGGGCCAANONE 
J065087K10AATTGGGCCAANONE 
J065091M15AATTGGGCCAANONE 
J065167A15AATTGGGCCAANONE 
J075018F02AATTGGGCCAANONE 
J075063F20AATTGGGCCAANONE 
J075064F18AATTGGGCCAANONE 
J075066N19AATTGGGCCAANONE 
J075073I02AATTGGGCCAANONE 
J075080P17AATTGGGCCAANONE 
J075081F11AATTGGGCCAANONE 
J075085E03AATTGGGCCAANONE 
J075101G18AATTGGGCCAANONE 
J075149N08AATTGGGCCAANONE 
J075158I21AATTGGGCCAANONE 
J075161M20AATTGGGCCAANONE 
J075190F12AATTGGGCCAANONE 
J075194K16AATTGGGCCAANONE 
J080001E08AATTGGGCCAANONE 
J080001F21AATTGGGCCAANONE 
J080001H19AATTGGGCCAANONE 
J080001O15AATTGGGCCAANONE 
J080005I22AATTGGGCCAANONE 
J080006K23AATTGGGCCAANONE 
J080014D20AATTGGGCCAANONE 
J080014I05AATTGGGCCAANONE 
J080014K21AATTGGGCCAANONE 
J080017I24AATTGGGCCAANONE 
J080017K11AATTGGGCCAANONE 
J080018F11AATTGGGCCAANONE 
J080022L18AATTGGGCCAANONE 
J080024N23AATTGGGCCAANONE 
J080027J23AATTGGGCCAANONE 
J080029B14AATTGGGCCAANONE 
J080032F14AATTGGGCCAANONE 
J080032K19AATTGGGCCAANONE 
J080032O21AATTGGGCCAANONE 
J080033P17AATTGGGCCAANONE 
J080034I06AATTGGGCCAANONE 
J080039F24AATTGGGCCAANONE 
J080040O13AATTGGGCCAANONE 
J080042B02AATTGGGCCAANONE 
J080043E12AATTGGGCCAANONE 
J080043J15AATTGGGCCAANONE 
J080043N09AATTGGGCCAANONE 
J080052J08AATTGGGCCAANONE 
J080053K01AATTGGGCCAANONE 
J080053K19AATTGGGCCAANONE 
J080055J09AATTGGGCCAANONE 
J080058D07AATTGGGCCAANONE 
J080062F11AATTGGGCCAANONE 
J080063J24AATTGGGCCAANONE 
J080066H04AATTGGGCCAANONE 
J080066I09AATTGGGCCAANONE 
J080067B02AATTGGGCCAANONE 
J080067N09AATTGGGCCAANONE 
J080068D22AATTGGGCCAANONE 
J080068K13AATTGGGCCAANONE 
J080069N19AATTGGGCCAANONE 
J080070D07AATTGGGCCAANONE 
J080070E05AATTGGGCCAANONE 
J080071G04AATTGGGCCAANONE 
J080077G05AATTGGGCCAANONE 
J080077O06AATTGGGCCAANONE 
J080085F05AATTGGGCCAANONE 
J080086E07AATTGGGCCAANONE 
J080089G16AATTGGGCCAANONE 
J080092K15AATTGGGCCAANONE 
J080094A08AATTGGGCCAANONE 
J080097A09AATTGGGCCAANONE 
J080097J07AATTGGGCCAANONE 
J090027N01AATTGGGCCAANONE 
J090081J05AATTGGGCCAANONE 
Os05g0118000AK110694CTGGCCCAACASRR1 domain containing protein. 
Os05g0121500006-117-B10GGTTGGGCCATNONE 
009-059-D04GGTTGGGCCATNONE 
J065066C12GGTTGGGCCATConserved hypothetical protein. 
J075013I12GGTTGGGCCATNONE 
J090046D18GGTTGGGCCATNONE 
Os05g0122700J065185N19GCCACGTGGCCCAACTNONE 
J065188N05GCCACGTGGCCCAACTNONE 
J065198E09GCCACGTGGCCCAACTNONE 
J065215H08GCCACGTGGCCCAACTSimilar to Low-temperature induced protein lt101.2. 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0144800AK099724TATTGGGCCATSimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
Os05g0152400Os05g0152400AGTTGGGCCAAGlycosyl transferase, family 14 protein. 
Os05g0168400006-039-A06AATTGGGCCAANONE 
AK069800AATTGGGCCAANONE 
AK106195AATTGGGCCAAConserved hypothetical protein. 
J065086N09AATTGGGCCAANONE 
J065137B10AATTGGGCCAANONE 
J075062B04AATTGGGCCAANONE 
J075193I07AATTGGGCCAANONE 
J075193K24AATTGGGCCAANONE 
J075194D10AATTGGGCCAANONE 
J100037F01AATTGGGCCAANONE 
J100071E09AATTGGGCCAANONE 
Os05g0182800AK121273TAATGGGCCAAGTGGCCCAATGlutamyl-tRNA synthetase, class Ic family protein. 
Os05g0193800AK058865TATTGGGCCAGCCCATGNONE 
AK067940TATTGGGCCAGCCCATGConserved hypothetical protein. 
J065043K19TATTGGGCCAGCCCATGNONE 
J065095O10TATTGGGCCAGCCCATGNONE 
J065095O12TATTGGGCCAGCCCATGNONE 
J080002K02TATTGGGCCAGCCCATGNONE 
J080012L17TATTGGGCCAGCCCATGNONE 
J080013J02TATTGGGCCAGCCCATGNONE 
J080013O11TATTGGGCCAGCCCATGNONE 
J080020A17TATTGGGCCAGCCCATGNONE 
J080028E18TATTGGGCCAGCCCATGNONE 
J080036P11TATTGGGCCAGCCCATGNONE 
J080042E10TATTGGGCCAGCCCATGNONE 
J080042L10TATTGGGCCAGCCCATGNONE 
J080047B11TATTGGGCCAGCCCATGNONE 
J080048N05TATTGGGCCAGCCCATGNONE 
J080057E20TATTGGGCCAGCCCATGNONE 
J080057K13TATTGGGCCAGCCCATGNONE 
J080058L03TATTGGGCCAGCCCATGNONE 
J080063H07TATTGGGCCAGCCCATGNONE 
J080066L23TATTGGGCCAGCCCATGNONE 
J080069G22TATTGGGCCAGCCCATGNONE 
J080072E12TATTGGGCCAGCCCATGNONE 
J080076D06TATTGGGCCAGCCCATGNONE 
J080077A22TATTGGGCCAGCCCATGNONE 
J080081A01TATTGGGCCAGCCCATGNONE 
J080090M13TATTGGGCCAGCCCATGNONE 
J080093G07TATTGGGCCAGCCCATGNONE 
J080094O20TATTGGGCCAGCCCATGNONE 
J080097F13TATTGGGCCAGCCCATGNONE 
Os05g0198700Os05g0198700TTTGGGCCACREX1 DNA Repair family protein. 
Os05g0215500AK070424ATTTGGGCCATHypothetical protein. 
J023050J01ATTTGGGCCATNONE 
Os05g0256000AK104927TATTGGGCCAGGACGGCCCAACASimilar to TGF-beta receptor-interacting protein 1. 
AK111524TATTGGGCCAGGACGGCCCAACANONE 
J023025D23TATTGGGCCAGGACGGCCCAACANONE 
J033086I23TATTGGGCCAGGACGGCCCAACANONE 
J033087F17TATTGGGCCAGGACGGCCCAACANONE 
J033091C01TATTGGGCCAGGACGGCCCAACANONE 
J090048L01TATTGGGCCAGGACGGCCCAACANONE 
J090087G08TATTGGGCCAGGACGGCCCAACANONE 
J100040G23TATTGGGCCAGGACGGCCCAACANONE 
Os05g0298500Os05g0298500ATGGCCCAATConserved hypothetical protein. 
Os05g0365500AK072352CTGGCCCAACTProtein prenyltransferase domain containing protein. 
J043027P13CTGGCCCAACTNONE 
Os05g0375400003-125-H02GTTGGGCCAGNONE 
003-128-D02GTTGGGCCAGNONE 
003-128-F08GTTGGGCCAGNONE 
004-007-B08GTTGGGCCAGNONE 
006-026-D11GTTGGGCCAGNONE 
006-027-A12GTTGGGCCAGNONE 
006-029-G06GTTGGGCCAGNONE 
006-047-B10GTTGGGCCAGNONE 
006-053-D08GTTGGGCCAGNONE 
006-070-H11GTTGGGCCAGNONE 
006-078-C06GTTGGGCCAGNONE 
006-079-A04GTTGGGCCAGNONE 
006-084-C10GTTGGGCCAGNONE 
006-099-G02GTTGGGCCAGNONE 
006-112-F07GTTGGGCCAGNONE 
006-118-A02GTTGGGCCAGNONE 
006-119-G04GTTGGGCCAGNONE 
009-039-D09GTTGGGCCAGNONE 
009-053-C11GTTGGGCCAGNONE 
009-178-E07GTTGGGCCAGNONE 
011-004-H01GTTGGGCCAGNONE 
011-010-A04GTTGGGCCAGNONE 
011-010-H04GTTGGGCCAGNONE 
011-018-A04GTTGGGCCAGNONE 
011-023-H04GTTGGGCCAGNONE 
011-025-H01GTTGGGCCAGNONE 
011-044-B04GTTGGGCCAGNONE 
011-044-H08GTTGGGCCAGNONE 
011-049-F01GTTGGGCCAGNONE 
011-056-C03GTTGGGCCAGNONE 
011-064-H01GTTGGGCCAGNONE 
011-070-D07GTTGGGCCAGNONE 
011-081-H09GTTGGGCCAGNONE 
011-087-D03GTTGGGCCAGNONE 
011-090-E01GTTGGGCCAGNONE 
011-094-F08GTTGGGCCAGNONE 
011-097-E08GTTGGGCCAGNONE 
011-099-C03GTTGGGCCAGNONE 
012-027-H12GTTGGGCCAGNONE 
012-031-H01GTTGGGCCAGNONE 
012-040-G01GTTGGGCCAGNONE 
012-047-A03GTTGGGCCAGNONE 
012-055-E06GTTGGGCCAGNONE 
012-076-H11GTTGGGCCAGNONE 
012-086-B03GTTGGGCCAGNONE 
012-091-A05GTTGGGCCAGNONE 
012-096-C03GTTGGGCCAGNONE 
013-001-F09GTTGGGCCAGNONE 
013-003-D02GTTGGGCCAGNONE 
013-006-C08GTTGGGCCAGNONE 
013-006-G04GTTGGGCCAGNONE 
013-007-D08GTTGGGCCAGNONE 
013-008-B10GTTGGGCCAGNONE 
013-008-C12GTTGGGCCAGNONE 
013-011-A10GTTGGGCCAGNONE 
013-011-D04GTTGGGCCAGNONE 
013-014-B10GTTGGGCCAGNONE 
013-015-F02GTTGGGCCAGNONE 
013-018-F08GTTGGGCCAGNONE 
013-021-D03GTTGGGCCAGNONE 
013-021-E12GTTGGGCCAGNONE 
013-026-A06GTTGGGCCAGNONE 
013-026-E12GTTGGGCCAGNONE 
013-028-F08GTTGGGCCAGNONE 
013-032-B01GTTGGGCCAGNONE 
013-032-H07GTTGGGCCAGNONE 
013-037-B09GTTGGGCCAGNONE 
013-038-F11GTTGGGCCAGNONE 
013-039-C04GTTGGGCCAGNONE 
013-040-E11GTTGGGCCAGNONE 
013-050-E12GTTGGGCCAGNONE 
013-050-G09GTTGGGCCAGNONE 
013-053-G07GTTGGGCCAGNONE 
013-055-D04GTTGGGCCAGNONE 
013-056-E10GTTGGGCCAGNONE 
013-056-F04GTTGGGCCAGNONE 
013-060-G06GTTGGGCCAGNONE 
013-066-E12GTTGGGCCAGNONE 
013-068-A09GTTGGGCCAGNONE 
013-068-G07GTTGGGCCAGNONE 
013-072-B02GTTGGGCCAGNONE 
013-073-F07GTTGGGCCAGNONE 
013-075-G07GTTGGGCCAGNONE 
013-082-E04GTTGGGCCAGNONE 
013-083-B04GTTGGGCCAGNONE 
013-085-F08GTTGGGCCAGNONE 
013-087-D08GTTGGGCCAGNONE 
013-089-C08GTTGGGCCAGNONE 
013-090-A01GTTGGGCCAGNONE 
013-093-B03GTTGGGCCAGNONE 
013-099-A07GTTGGGCCAGNONE 
013-099-E03GTTGGGCCAGNONE 
014-024-E04GTTGGGCCAGNONE 
014-049-C09GTTGGGCCAGNONE 
014-078-E06GTTGGGCCAGNONE 
015-038-A11GTTGGGCCAGNONE 
015-070-G03GTTGGGCCAGNONE 
015-074-D01GTTGGGCCAGNONE 
015-082-G04GTTGGGCCAGNONE 
016-006-E05GTTGGGCCAGNONE 
016-011-E07GTTGGGCCAGNONE 
016-040-F10GTTGGGCCAGNONE 
016-042-F10GTTGGGCCAGNONE 
016-052-B11GTTGGGCCAGNONE 
016-069-B04GTTGGGCCAGNONE 
016-079-C01GTTGGGCCAGNONE 
016-080-A10GTTGGGCCAGNONE 
016-085-C09GTTGGGCCAGNONE 
016-093-D08GTTGGGCCAGNONE 
AF323610GTTGGGCCAGNONE 
AK060867GTTGGGCCAGNONE 
AK121825GTTGGGCCAGBeta-glucanase precursor. 
AY768944GTTGGGCCAGNONE 
J013099L04GTTGGGCCAGNONE 
J013153K08GTTGGGCCAGNONE 
J033099G01GTTGGGCCAGNONE 
J065176D10GTTGGGCCAGNONE 
J065176G02GTTGGGCCAGNONE 
J075138B12GTTGGGCCAGNONE 
J075170I16GTTGGGCCAGNONE 
J075194A22GTTGGGCCAGNONE 
J100036M10GTTGGGCCAGNONE 
J100037E23GTTGGGCCAGNONE 
J100037I10GTTGGGCCAGNONE 
J100041D24GTTGGGCCAGNONE 
J100053D13GTTGGGCCAGNONE 
J100054F07GTTGGGCCAGNONE 
J100087M21GTTGGGCCAGNONE 
J100090H22GTTGGGCCAGNONE 
Os05g0412800AF402803ATGGCCCAACASimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0417200AK071955ATTTGGGCCACAATGGGCCTTGCGGGCCThioredoxin-like fold domain containing protein. 
Os05g0443800AK106590CTTGGGCCAGSimilar to Plastid division protein ftsZ1 precursor. 
Os05g0456000AK058420GCGTGGGCGTGTGGCCCAAAAMitochondrial glycoprotein family protein. 
AK102036GCGTGGGCGTGTGGCCCAAAANONE 
J065066F02GCGTGGGCGTGTGGCCCAAAANONE 
Os05g0496500011-012-D10ATTGGGCCACNONE 
AK073261ATTGGGCCACSimilar to Latex-abundant protein. 
AY224533ATTGGGCCACNONE 
Os05g0521700AK070182ATTGGGCCACGTGGCGConserved hypothetical protein. 
J013170O04ATTGGGCCACGTGGCGNONE 
J023045H17ATTGGGCCACGTGGCGNONE 
Os05g0559900AK067197GGGCCTGGCCCAAGtRNA-binding arm domain containing protein. 
J013074C15GGGCCTGGCCCAAGNONE 
J013098O16GGGCCTGGCCCAAGNONE 
J033030M01GGGCCTGGCCCAAGNONE 
J090058H12GGGCCTGGCCCAAGNONE 
J090075M06GGGCCTGGCCCAAGNONE 
Os05g0564400006-023-A05GTGGCCCAACCNONE 
AK073075GTGGCCCAACCSimilar to GTP-binding protein. 
AK109344GTGGCCCAACCNONE 
Os05g0567300013-039-F11TTTTGGGCCAGCCCAAGNONE 
AK112068TTTTGGGCCAGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0576600AK107732CTTGGGCCATConserved hypothetical protein. 
Os05g0578600AK108477TTGGCCCAATASimilar to Polygalacturonase PG2. 
Os06g0103200011-003-H09TGTTGGGCCACCAACNONE 
011-017-H05TGTTGGGCCACCAACNONE 
011-027-G08TGTTGGGCCACCAACNONE 
011-059-F08TGTTGGGCCACCAACNONE 
AK103757TGTTGGGCCACCAACTransferase family protein. 
J033143E17TGTTGGGCCACCAACNONE 
Os06g0114600015-077-E06ATGGCCCAAANONE 
AK067972ATGGCCCAAAConserved hypothetical protein. 
Os06g0124900009-128-B12GGTTGGGCCAGNONE 
009-186-H09GGTTGGGCCAGNONE 
AK062901GGTTGGGCCAGConserved hypothetical protein. 
J013056D13GGTTGGGCCAGNONE 
J013056D17GGTTGGGCCAGNONE 
J013066A13GGTTGGGCCAGNONE 
J013066C03GGTTGGGCCAGNONE 
J013066F01GGTTGGGCCAGNONE 
J023078D03GGTTGGGCCAGNONE 
J033113N02GGTTGGGCCAGNONE 
J065019F09GGTTGGGCCAGNONE 
J065048C21GGTTGGGCCAGNONE 
J065077L13GGTTGGGCCAGNONE 
J065082J09GGTTGGGCCAGNONE 
J065113H16GGTTGGGCCAGNONE 
J065147A20GGTTGGGCCAGNONE 
J065180A13GGTTGGGCCAGNONE 
J065198M18GGTTGGGCCAGNONE 
J065207K19GGTTGGGCCAGNONE 
J075109H13GGTTGGGCCAGNONE 
Os06g0134900AK103205GGATGGGCTGTGTTGGGCCAAGCCCAGConserved hypothetical protein. 
J033122E01GGATGGGCTGTGTTGGGCCAAGCCCAGNONE 
Os06g0135000J075008J15CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075166F23CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075185F03CTGGGCTTGGCCCAACACAGCCCATCCNONE 
Os06g0140900AK058823ATTGGGCCAGSigma factor, regions 3 and 4 domain containing protein. 
J065159C22ATTGGGCCAGNONE 
J090061D18ATTGGGCCAGNONE 
J100066L20ATTGGGCCAGNONE 
J100085F19ATTGGGCCAGNONE 
J100088E11ATTGGGCCAGNONE 
Os06g0147200013-026-F09CTGGCCCAACNONE 
AK064042CTGGCCCAACConserved hypothetical protein. 
AK070059CTGGCCCAACNONE 
J023042A02CTGGCCCAACNONE 
J100047A15CTGGCCCAACNONE 
J100070B03CTGGCCCAACNONE 
Os06g0291100J043017O10TTGGCCCAATHypothetical protein. 
Os06g0320500004-013-F05GATCCGACGTGGCCCAATNONE 
006-021-B06GATCCGACGTGGCCCAATNONE 
006-021-D12GATCCGACGTGGCCCAATNONE 
006-022-A12GATCCGACGTGGCCCAATNONE 
006-024-B10GATCCGACGTGGCCCAATNONE 
006-029-F07GATCCGACGTGGCCCAATNONE 
006-029-H12GATCCGACGTGGCCCAATNONE 
006-031-A05GATCCGACGTGGCCCAATNONE 
006-033-C03GATCCGACGTGGCCCAATNONE 
006-036-B12GATCCGACGTGGCCCAATNONE 
006-048-C08GATCCGACGTGGCCCAATNONE 
006-050-F03GATCCGACGTGGCCCAATNONE 
006-051-C12GATCCGACGTGGCCCAATNONE 
006-054-C03GATCCGACGTGGCCCAATNONE 
006-057-D12GATCCGACGTGGCCCAATNONE 
006-067-F01GATCCGACGTGGCCCAATNONE 
006-071-G12GATCCGACGTGGCCCAATNONE 
006-072-G11GATCCGACGTGGCCCAATNONE 
006-072-H01GATCCGACGTGGCCCAATNONE 
006-081-E02GATCCGACGTGGCCCAATNONE 
006-082-A11GATCCGACGTGGCCCAATNONE 
006-084-A04GATCCGACGTGGCCCAATNONE 
006-085-C08GATCCGACGTGGCCCAATNONE 
006-086-D03GATCCGACGTGGCCCAATNONE 
006-088-B05GATCCGACGTGGCCCAATNONE 
006-088-G02GATCCGACGTGGCCCAATNONE 
006-092-G10GATCCGACGTGGCCCAATNONE 
006-094-D11GATCCGACGTGGCCCAATNONE 
006-094-E04GATCCGACGTGGCCCAATNONE 
006-103-G12GATCCGACGTGGCCCAATNONE 
006-106-G08GATCCGACGTGGCCCAATNONE 
006-111-E06GATCCGACGTGGCCCAATNONE 
006-114-C07GATCCGACGTGGCCCAATNONE 
006-115-A04GATCCGACGTGGCCCAATNONE 
006-117-G11GATCCGACGTGGCCCAATNONE 
006-118-G09GATCCGACGTGGCCCAATNONE 
009-010-F03GATCCGACGTGGCCCAATNONE 
009-076-G01GATCCGACGTGGCCCAATNONE 
009-134-E10GATCCGACGTGGCCCAATNONE 
009-193-D07GATCCGACGTGGCCCAATNONE 
AF094776GATCCGACGTGGCCCAATNONE 
AK060904GATCCGACGTGGCCCAATSimilar to Light-harvesting complex I (Fragment). 
AK098864GATCCGACGTGGCCCAATNONE 
J013001A03GATCCGACGTGGCCCAATNONE 
J013098P14GATCCGACGTGGCCCAATNONE 
J013127B16GATCCGACGTGGCCCAATNONE 
J013169J24GATCCGACGTGGCCCAATNONE 
J023084H23GATCCGACGTGGCCCAATNONE 
J023093F05GATCCGACGTGGCCCAATNONE 
J033041I05GATCCGACGTGGCCCAATNONE 
J065196G15GATCCGACGTGGCCCAATNONE 
J075019K01GATCCGACGTGGCCCAATNONE 
J075053H16GATCCGACGTGGCCCAATNONE 
J075055M09GATCCGACGTGGCCCAATNONE 
J075099G10GATCCGACGTGGCCCAATNONE 
J075099L23GATCCGACGTGGCCCAATNONE 
J075127I09GATCCGACGTGGCCCAATNONE 
J080001C14GATCCGACGTGGCCCAATNONE 
J080016B11GATCCGACGTGGCCCAATNONE 
J080029C14GATCCGACGTGGCCCAATNONE 
J080029I17GATCCGACGTGGCCCAATNONE 
J080034F13GATCCGACGTGGCCCAATNONE 
J080039E02GATCCGACGTGGCCCAATNONE 
J080040N05GATCCGACGTGGCCCAATNONE 
J080042O17GATCCGACGTGGCCCAATNONE 
J080043N15GATCCGACGTGGCCCAATNONE 
J080056K02GATCCGACGTGGCCCAATNONE 
J080063N15GATCCGACGTGGCCCAATNONE 
J080069H05GATCCGACGTGGCCCAATNONE 
J080070N15GATCCGACGTGGCCCAATNONE 
J080075J22GATCCGACGTGGCCCAATNONE 
J080076F12GATCCGACGTGGCCCAATNONE 
J080086G05GATCCGACGTGGCCCAATNONE 
J090046G07GATCCGACGTGGCCCAATNONE 
J090059H01GATCCGACGTGGCCCAATNONE 
J090099C09GATCCGACGTGGCCCAATNONE 
J100028E12GATCCGACGTGGCCCAATNONE 
J100048J04GATCCGACGTGGCCCAATNONE 
J100054O05GATCCGACGTGGCCCAATNONE 
J100062C09GATCCGACGTGGCCCAATNONE 
J100075C17GATCCGACGTGGCCCAATNONE 
J100075C23GATCCGACGTGGCCCAATNONE 
J100075I23GATCCGACGTGGCCCAATNONE 
Os06g0482200AK119703TTGGCCCAATAThioredoxin fold domain containing protein. 
J065014B11TTGGCCCAATANONE 
J065055E22TTGGCCCAATANONE 
J065092L13TTGGCCCAATANONE 
J065113E21TTGGCCCAATANONE 
J065191D11TTGGCCCAATANONE 
J065214F18TTGGCCCAATANONE 
J075104E18TTGGCCCAATANONE 
J075149O19TTGGCCCAATANONE 
J075170I11TTGGCCCAATANONE 
Os06g0484600009-122-D10ATGGCCCAAGCCCAAGNONE 
AK062871ATGGCCCAAGCCCAAGSimilar to Pherophorin-S precursor. 
J075017F14ATGGCCCAAGCCCAAGNONE 
J075021E06ATGGCCCAAGCCCAAGNONE 
J075054C10ATGGCCCAAGCCCAAGNONE 
Os06g0498900AK065724GCCACGTGGCCCAATGTP-binding protein, HSR1-related domain containing protein. 
Os06g0539066J065210J16CTTGGGCCAAConserved hypothetical protein. 
J065210J16GTGGCCCAAAConserved hypothetical protein. 
Os06g0547900AK100950ATTGGGCCATSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665ATTGGGCCATNONE 
J023139I22ATTGGGCCATNONE 
J090066J10ATTGGGCCATNONE 
Y13437ATTGGGCCATNONE 
Os06g0549600AK073505ATTGGGCCAAFAD linked oxidase, N-terminal domain containing protein. 
J033046H14ATTGGGCCAANONE 
Os06g0590301J033139K16TTGGCCCAAGCCCAAGNONE 
J065011M13TTGGCCCAAGCCCAAGNONE 
J065027D20TTGGCCCAAGCCCAAGNONE 
J065039O05TTGGCCCAAGCCCAAGGlucose/ribitol dehydrogenase family protein. 
J065051O10TTGGCCCAAGCCCAAGNONE 
J065128I21TTGGCCCAAGCCCAAGNONE 
J065163P10TTGGCCCAAGCCCAAGNONE 
J065169H02TTGGCCCAAGCCCAAGNONE 
Os06g0602600AK121619AGTTGGGCCAGAAlba, DNA/RNA-binding protein family protein. 
J033044O03AGTTGGGCCAGANONE 
J043036G04AGTTGGGCCAGANONE 
J075107E08AGTTGGGCCAGANONE 
J090060N14AGTTGGGCCAGANONE 
J090094K04AGTTGGGCCAGANONE 
Os06g0622700AK107021TCTGGCCCAAAAGGCCCACAEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTGGCCCAAAAGGCCCACANONE 
J065100L18TCTGGCCCAAAAGGCCCACANONE 
J065129N15TCTGGCCCAAAAGGCCCACANONE 
J065152M08TCTGGCCCAAAAGGCCCACANONE 
J065198M12TCTGGCCCAAAAGGCCCACANONE 
J090077J22TCTGGCCCAAAAGGCCCACANONE 
J100024G23TCTGGCCCAAAAGGCCCACANONE 
J100027L01TCTGGCCCAAAAGGCCCACANONE 
J100047C06TCTGGCCCAAAAGGCCCACANONE 
J100055D01TCTGGCCCAAAAGGCCCACANONE 
J100067M05TCTGGCCCAAAAGGCCCACANONE 
J100077M16TCTGGCCCAAAAGGCCCACANONE 
J100078M22TCTGGCCCAAAAGGCCCACANONE 
Os06g0650100009-016-C02ATTGGGCCATNONE 
AK062354ATTGGGCCATSimilar to Polyubiquitin gene (Fragment). 
Os06g0688100AK063450TTGGCCCAACTNONE 
AK101144TTGGCCCAACTRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0710300AK121344ATGGCCCAATAUncharacterized protein UPF0114 family protein. 
J043016B12ATGGCCCAATANONE 
J065104H21ATGGCCCAATANONE 
Os06g0714100AK121079TTGGCCCAACTComplex 1 LYR protein family protein. 
J023062M13TTGGCCCAACTNONE 
J043020D18TTGGCCCAACTNONE 
J065073A17TTGGCCCAACTNONE 
J065158D09TTGGCCCAACTNONE 
J065195H04TTGGCCCAACTNONE 
J065214P13TTGGCCCAACTNONE 
J080079I22TTGGCCCAACTNONE 
J100031M06TTGGCCCAACTNONE 
J100036I12TTGGCCCAACTNONE 
Os06g0714500AK100047ATGGCCCAAGAAA ATPase domain containing protein. 
AK119628ATGGCCCAAGNONE 
J013120N13ATGGCCCAAGNONE 
J013154C19ATGGCCCAAGNONE 
J023031A09ATGGCCCAAGNONE 
J023073G20ATGGCCCAAGNONE 
J023086A06ATGGCCCAAGNONE 
J023086L11ATGGCCCAAGNONE 
J033045N11ATGGCCCAAGNONE 
J065124D11ATGGCCCAAGNONE 
J065135A15ATGGCCCAAGNONE 
J065146E06ATGGCCCAAGNONE 
J065175E12ATGGCCCAAGNONE 
J075004A21ATGGCCCAAGNONE 
J075072C20ATGGCCCAAGNONE 
J075078O21ATGGCCCAAGNONE 
J075145E13ATGGCCCAAGNONE 
J075196K08ATGGCCCAAGNONE 
J090095L18ATGGCCCAAGNONE 
Os06g0726400AF136268TTGGCCCAAANONE 
AK065121TTGGCCCAAANONE 
AK119436TTGGCCCAAABranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK120332TTGGCCCAAANONE 
AY302112TTGGCCCAAANONE 
D10752TTGGCCCAAANONE 
D11082TTGGCCCAAANONE 
J013031L12TTGGCCCAAANONE 
J013042M09TTGGCCCAAANONE 
J013058E01TTGGCCCAAANONE 
J013058O09TTGGCCCAAANONE 
J013063J17TTGGCCCAAANONE 
J013066I24TTGGCCCAAANONE 
J013069F17TTGGCCCAAANONE 
J013106E01TTGGCCCAAANONE 
J013118D19TTGGCCCAAANONE 
J013162M11TTGGCCCAAANONE 
J023028B19TTGGCCCAAANONE 
J023031A13TTGGCCCAAANONE 
J023047H18TTGGCCCAAANONE 
J023059N10TTGGCCCAAANONE 
J023104N22TTGGCCCAAANONE 
J033025J03TTGGCCCAAANONE 
J033045B05TTGGCCCAAANONE 
J033067M08TTGGCCCAAANONE 
J033113D04TTGGCCCAAANONE 
J043003D11TTGGCCCAAANONE 
J043009O20TTGGCCCAAANONE 
J043016P06TTGGCCCAAANONE 
J043017C21TTGGCCCAAANONE 
J043017J20TTGGCCCAAANONE 
J043021P15TTGGCCCAAANONE 
J043026I22TTGGCCCAAANONE 
J043032L15TTGGCCCAAANONE 
J043034G14TTGGCCCAAANONE 
J043039L16TTGGCCCAAANONE 
J075003D02TTGGCCCAAANONE 
J075003O22TTGGCCCAAANONE 
J075005I24TTGGCCCAAANONE 
J075006N09TTGGCCCAAANONE 
J075011A22TTGGCCCAAANONE 
J075012K24TTGGCCCAAANONE 
J075017D01TTGGCCCAAANONE 
J075017I23TTGGCCCAAANONE 
J075023D17TTGGCCCAAANONE 
J075024B03TTGGCCCAAANONE 
J075025H05TTGGCCCAAANONE 
J075031D19TTGGCCCAAANONE 
J075034B02TTGGCCCAAANONE 
J075035C02TTGGCCCAAANONE 
J075037J12TTGGCCCAAANONE 
J075038M11TTGGCCCAAANONE 
J075039J17TTGGCCCAAANONE 
J075042P10TTGGCCCAAANONE 
J075046J20TTGGCCCAAANONE 
J075047F21TTGGCCCAAANONE 
J075053E05TTGGCCCAAANONE 
J075054D11TTGGCCCAAANONE 
J075054K06TTGGCCCAAANONE 
J075059E15TTGGCCCAAANONE 
J075061O04TTGGCCCAAANONE 
J075062I20TTGGCCCAAANONE 
J075066I12TTGGCCCAAANONE 
J075066L06TTGGCCCAAANONE 
J075071H12TTGGCCCAAANONE 
J075071N19TTGGCCCAAANONE 
J075074K01TTGGCCCAAANONE 
J075077H22TTGGCCCAAANONE 
J075083H18TTGGCCCAAANONE 
J075085F04TTGGCCCAAANONE 
J075085K09TTGGCCCAAANONE 
J075086C06TTGGCCCAAANONE 
J075086E06TTGGCCCAAANONE 
J075087A15TTGGCCCAAANONE 
J075090N02TTGGCCCAAANONE 
J075090N22TTGGCCCAAANONE 
J075091C04TTGGCCCAAANONE 
J075091G16TTGGCCCAAANONE 
J075097E04TTGGCCCAAANONE 
J075099E04TTGGCCCAAANONE 
J075102P22TTGGCCCAAANONE 
J075109B08TTGGCCCAAANONE 
J075109J02TTGGCCCAAANONE 
J075115I12TTGGCCCAAANONE 
J075117E17TTGGCCCAAANONE 
J075123C07TTGGCCCAAANONE 
J075124N05TTGGCCCAAANONE 
J075125E12TTGGCCCAAANONE 
J075126B11TTGGCCCAAANONE 
J075129E14TTGGCCCAAANONE 
J075130N15TTGGCCCAAANONE 
J075131I07TTGGCCCAAANONE 
J075141B13TTGGCCCAAANONE 
J075141B20TTGGCCCAAANONE 
J075144D23TTGGCCCAAANONE 
J075144N01TTGGCCCAAANONE 
J075147M24TTGGCCCAAANONE 
J075148L16TTGGCCCAAANONE 
J075151A22TTGGCCCAAANONE 
J075151D03TTGGCCCAAANONE 
J075151D04TTGGCCCAAANONE 
J075153E23TTGGCCCAAANONE 
J075156D02TTGGCCCAAANONE 
J075156P05TTGGCCCAAANONE 
J075162E23TTGGCCCAAANONE 
J075165J22TTGGCCCAAANONE 
J075166A06TTGGCCCAAANONE 
J075168H13TTGGCCCAAANONE 
J075170D04TTGGCCCAAANONE 
J075171C19TTGGCCCAAANONE 
J075173B12TTGGCCCAAANONE 
J075173M23TTGGCCCAAANONE 
J075174C03TTGGCCCAAANONE 
J075185O11TTGGCCCAAANONE 
J075186G21TTGGCCCAAANONE 
J075187D06TTGGCCCAAANONE 
J075195G21TTGGCCCAAANONE 
J090003D18TTGGCCCAAANONE 
J090005I12TTGGCCCAAANONE 
J090007D15TTGGCCCAAANONE 
J090007G20TTGGCCCAAANONE 
J090014G13TTGGCCCAAANONE 
J090014L08TTGGCCCAAANONE 
J090016J03TTGGCCCAAANONE 
J090023P22TTGGCCCAAANONE 
J090025C19TTGGCCCAAANONE 
J090028F11TTGGCCCAAANONE 
J090028G01TTGGCCCAAANONE 
J090028H02TTGGCCCAAANONE 
J090037I11TTGGCCCAAANONE 
J090040F21TTGGCCCAAANONE 
J090040N24TTGGCCCAAANONE 
J090044M12TTGGCCCAAANONE 
J090045B13TTGGCCCAAANONE 
J090045M22TTGGCCCAAANONE 
J090048C10TTGGCCCAAANONE 
J090051J02TTGGCCCAAANONE 
J090058O15TTGGCCCAAANONE 
J090062F11TTGGCCCAAANONE 
J090067D23TTGGCCCAAANONE 
J090069G15TTGGCCCAAANONE 
J090072I06TTGGCCCAAANONE 
J090073H18TTGGCCCAAANONE 
J090073L01TTGGCCCAAANONE 
J090075O21TTGGCCCAAANONE 
J090084K24TTGGCCCAAANONE 
J090087P11TTGGCCCAAANONE 
J090092B17TTGGCCCAAANONE 
J100042H08TTGGCCCAAANONE 
Os07g0123000AK070836ATGGCCCAAAACyclin-like F-box domain containing protein. 
Os07g0124500012-092-F01TTGGCCCAACANONE 
AK070529TTGGCCCAACASimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000TTGGCCCAACANONE 
J090007O11TTGGCCCAACANONE 
J090010E02TTGGCCCAACANONE 
J090078C04TTGGCCCAACANONE 
Os07g0127500009-139-F12ATTTGGGCCACGTGNONE 
AK062949ATTTGGGCCACGTGSimilar to PR-1a pathogenesis related protein (Hv-1a) precursor. 
J100077L01ATTTGGGCCACGTGNONE 
Os07g0142600009-115-C09TATTGGGCCACNONE 
AK062842TATTGGGCCACConserved hypothetical protein. 
Os07g0205000009-018-A12GTGGCCCAAACNONE 
AK103963GTGGCCCAAACNONE 
AK121368GTGGCCCAAACNONE 
J023001M20GTGGCCCAAACNONE 
J023125I03GTGGCCCAAACNONE 
J053034L22GTGGCCCAAACNONE 
J065078A21GTGGCCCAAACNONE 
J065089G24GTGGCCCAAACNONE 
J065096G23GTGGCCCAAACNONE 
J065103N06GTGGCCCAAACNONE 
J065146J22GTGGCCCAAACNONE 
J065159K18GTGGCCCAAACNONE 
J065204L04GTGGCCCAAACNONE 
J065207N07GTGGCCCAAACNONE 
J065208E24GTGGCCCAAACNONE 
J075057F19GTGGCCCAAACNONE 
J075058K01GTGGCCCAAACNONE 
J075072H13GTGGCCCAAACNONE 
J080003D08GTGGCCCAAACNONE 
J080025F02GTGGCCCAAACNONE 
Os07g0242600AK065752TTGGCCCAAATCyclin-like F-box domain containing protein. 
J013037K22TTGGCCCAAATNONE 
Os07g0272800AK107279GTTTGGGCCAAGCCCACGAAHypothetical protein. 
J065124H15GTTTGGGCCAAGCCCACGAANONE 
Os07g0290800AK071498ATGGCCCAAAATic22-like family protein. 
J075099P10ATGGCCCAAAANONE 
Os07g0459200AK066819GCTGGGCTTGGGCCAACCGAGCCGNONE 
AK102099GCTGGGCTTGGGCCAACCGAGCCGSimilar to Possible kinase. 
Os07g0499900AK109745ACATGGGCCAAGTTGGGCCACCyclin-like F-box domain containing protein. 
Os07g0506700AK073959AGCCCATTGGGCCAAWD40-like domain containing protein. 
Os07g0543000AB110196TCTGGCCCAAANONE 
AK058889TCTGGCCCAAASimilar to Helix-loop-helix-like protein (Fragment). 
Os07g0565600AK071983CTGGCCCAAAASimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481CTGGCCCAAAANONE 
Os07g0572500AK108612TTGGCCCAAGConserved hypothetical protein. 
Os07g0573800AK072835ATTTGGGCCATPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
AK104154ATTTGGGCCATNONE 
AK104308ATTTGGGCCATNONE 
AK107962ATTTGGGCCATNONE 
J023134F17ATTTGGGCCATNONE 
J043027A09ATTTGGGCCATNONE 
Os07g0585800006-106-A05TTGGCCCAACANONE 
AK066419TTGGCCCAACANONE 
AK105064TTGGCCCAACASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TTGGCCCAACANONE 
J065085B08TTGGCCCAACANONE 
J065099I23TTGGCCCAACANONE 
J065169A01TTGGCCCAACANONE 
J065187N13TTGGCCCAACANONE 
J065191L18TTGGCCCAACANONE 
J065194D04TTGGCCCAACANONE 
J065211M09TTGGCCCAACANONE 
J065212I02TTGGCCCAACANONE 
J090003C10TTGGCCCAACANONE 
J090025O11TTGGCCCAACANONE 
J090092F10TTGGCCCAACANONE 
J100055A04TTGGCCCAACANONE 
J100064A01TTGGCCCAACANONE 
J100080L02TTGGCCCAACANONE 
Os07g0594400J065137M02ACGTGGGCTTGGGCCACGGGCCGAConserved hypothetical protein. 
J065218E03ACGTGGGCTTGGGCCACGGGCCGANONE 
Os07g0598900015-040-C12TTTTGGGCCATNONE 
AK102627TTTTGGGCCATCobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521TTTTGGGCCATNONE 
J033087C18TTTTGGGCCATNONE 
J033099K03TTTTGGGCCATNONE 
J065054E02TTTTGGGCCATNONE 
J090055O05TTTTGGGCCATNONE 
Os07g0602600AK065696CTTGGGCCATSimilar to RNA binding protein. 
J013035K23CTTGGGCCATNONE 
Os07g0611700AK109158GAAGCCCATACTGGCCCAATTPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800GAAGCCCATACTGGCCCAATTNONE 
Os07g0620200AK099859GTGGCCCAAATHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04GTGGCCCAAATNONE 
Os07g0623300AK070292GGCCGTGGCCCAATSimilar to Splicing factor SC35. 
J023050C05GGCCGTGGCCCAATNONE 
J090025O12GGCCGTGGCCCAATNONE 
Os07g0625500AK064628TCTGGCCCAACASimilar to Fimbriata-associated protein (Fragment). 
Os07g0633800AK103878TATTGGGCCACConserved hypothetical protein. 
J033025K08TATTGGGCCACNONE 
J033026N04TATTGGGCCACNONE 
J090062M09TATTGGGCCACNONE 
J090087F04TATTGGGCCACNONE 
Os07g0668200AK059051ATGGCCCAAATNONE 
AK101682ATGGCCCAAATConserved hypothetical protein. 
AK102839ATGGCCCAAATNONE 
Os07g0673000011-058-G06AATTGGGCCAANONE 
AK063364AATTGGGCCAAConserved hypothetical protein. 
Os07g0673700AK071934ATTGGGCCAACyclin-like F-box domain containing protein. 
AK107556ATTGGGCCAANONE 
Os07g0688300AK068325TATTGGGCCAASimilar to Importin alpha 1. 
AK068325TTGGCCCAAAASimilar to Importin alpha 1. 
AK099611TATTGGGCCAANONE 
AK099611TTGGCCCAAAANONE 
Os08g0112800009-113-D03ATTTGGGCCAANONE 
AK121176ATTTGGGCCAARickettsia 17 kDa surface antigen family protein. 
J023083C18ATTTGGGCCAANONE 
J033074M10ATTTGGGCCAANONE 
J033097G10ATTTGGGCCAANONE 
J065090F05ATTTGGGCCAANONE 
J090001J03ATTTGGGCCAANONE 
J090044F23ATTTGGGCCAANONE 
J090078H09ATTTGGGCCAANONE 
J100088G23ATTTGGGCCAANONE 
Os08g0178100AK101717AATTGGGCCACGGCCCATGAPep3/Vps18/deep orange domain containing protein. 
Os08g0243900011-052-H03TTTTGGGCCAGNONE 
AK102707TTTTGGGCCAGNONE 
AK121452TTTTGGGCCAGMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20TTTTGGGCCAGNONE 
J065168E04TTTTGGGCCAGNONE 
Os08g0316900013-024-A06GTGGCCCAACCNONE 
J033112J20GTGGCCCAACCNONE 
J065025M22GTGGCCCAACCNONE 
J065026E15GTGGCCCAACCNONE 
Os08g0319900AK108030GTGGCCCAACPutative cyclase family protein. 
Os08g0411500J013050J08ATGGCCCAACANONE 
Os08g0412100AK072641TTGGCCCAAAADisease resistance protein family protein. 
Os08g0412200006-028-H07CTTGGGCCATNONE 
AJ575234CTTGGGCCATNONE 
AK059631CTTGGGCCATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099367CTTGGGCCATNONE 
AK104578CTTGGGCCATNONE 
J033071L08CTTGGGCCATNONE 
J065197K18CTTGGGCCATNONE 
Os08g0452200AK100150GTTGGGCCAAConserved hypothetical protein. 
Os08g0455800006-050-A09TCTGGCCCAAACNONE 
AK061573TCTGGCCCAAACProtein of unknown function DUF985 family protein. 
AK099156TCTGGCCCAAACNONE 
J023067L05TCTGGCCCAAACNONE 
J065101A05TCTGGCCCAAACNONE 
J065171H09TCTGGCCCAAACNONE 
J100022D08TCTGGCCCAAACNONE 
J100029K04TCTGGCCCAAACNONE 
J100029O10TCTGGCCCAAACNONE 
Os08g0460800015-094-E01TTGGCCCAAGGCCCAGTTCyclin-like F-box domain containing protein. 
Os08g0474750J075009C13TCTGGCCCAAATNONE 
J075122O14TCTGGCCCAAATHypothetical protein. 
Os08g0474800Os08g0474800TCTGGCCCAAATEsterase/lipase/thioesterase domain containing protein. 
Os08g0492100AK060178AAATGGGCTGTATTTGGGCCAANONE 
AK071053AAATGGGCTGTATTTGGGCCAAParaneoplastic encephalomyelitis antigen family protein. 
AK100101AAATGGGCTGTATTTGGGCCAANONE 
J023004I20AAATGGGCTGTATTTGGGCCAANONE 
J023067D13AAATGGGCTGTATTTGGGCCAANONE 
J033028G05AAATGGGCTGTATTTGGGCCAANONE 
J033060L15AAATGGGCTGTATTTGGGCCAANONE 
J033103N12AAATGGGCTGTATTTGGGCCAANONE 
J033125B19AAATGGGCTGTATTTGGGCCAANONE 
J065132A12AAATGGGCTGTATTTGGGCCAANONE 
J065161F02AAATGGGCTGTATTTGGGCCAANONE 
J065162L05AAATGGGCTGTATTTGGGCCAANONE 
J090093I18AAATGGGCTGTATTTGGGCCAANONE 
J100061I05AAATGGGCTGTATTTGGGCCAANONE 
J100081G13AAATGGGCTGTATTTGGGCCAANONE 
Os08g0526500016-063-D04TTTTGGGCCAGANONE 
AK073431TTTTGGGCCAGASimilar to SOX-1 protein. 
J033042D10TTTTGGGCCAGANONE 
J065019E02TTTTGGGCCAGANONE 
Os08g0535600AK121683ATGGCCCAATAZinc finger, Tim10/DDP-type family protein. 
J065077E05ATGGCCCAATANONE 
J075088M24ATGGCCCAATANONE 
J075140B03ATGGCCCAATANONE 
J090014B14ATGGCCCAATANONE 
Os09g0101800AK102345GTGGCCCAATWD40-like domain containing protein. 
J090030C23GTGGCCCAATNONE 
Os09g0109500AK067482GTATGGGCTGGCCCAATTUNC-50 family protein. 
J013107E18GTATGGGCTGGCCCAATTNONE 
J023138C21GTATGGGCTGGCCCAATTNONE 
J065117D01GTATGGGCTGGCCCAATTNONE 
J065179F23GTATGGGCTGGCCCAATTNONE 
J100029N14GTATGGGCTGGCCCAATTNONE 
Os09g0120033AK069069CTTGGGCCAGCCCAGCConserved hypothetical protein. 
Os09g0122000J075038D18TGTTGGGCCAANONE 
J075080K22TGTTGGGCCAANONE 
J075153J04TGTTGGGCCAANONE 
J075161K18TGTTGGGCCAANONE 
J075163H20TGTTGGGCCAANONE 
J075174C07TGTTGGGCCAAConserved hypothetical protein. 
Os09g0321300AK122141TATTGGGCCAGATTGGGCCATNONE 
Os09g0325100J080009O19ATGGCCCAATNONE 
J080011H14ATGGCCCAATConserved hypothetical protein. 
J080014F14ATGGCCCAATNONE 
J080014M09ATGGCCCAATNONE 
J080014N20ATGGCCCAATNONE 
J080018K13ATGGCCCAATNONE 
J080023C08ATGGCCCAATNONE 
J080023C09ATGGCCCAATNONE 
J080023K14ATGGCCCAATNONE 
J080025I09ATGGCCCAATNONE 
J080030J04ATGGCCCAATNONE 
J080039D08ATGGCCCAATNONE 
J080039L17ATGGCCCAATNONE 
J080041B13ATGGCCCAATNONE 
J080041P21ATGGCCCAATNONE 
J080042J21ATGGCCCAATNONE 
J080042L19ATGGCCCAATNONE 
J080045F07ATGGCCCAATNONE 
J080047B10ATGGCCCAATNONE 
J080051F23ATGGCCCAATNONE 
J080053D15ATGGCCCAATNONE 
J080053K02ATGGCCCAATNONE 
J080058K18ATGGCCCAATNONE 
J080061M13ATGGCCCAATNONE 
J080064M24ATGGCCCAATNONE 
J080067H07ATGGCCCAATNONE 
J080080B21ATGGCCCAATNONE 
J080080D18ATGGCCCAATNONE 
J080082G07ATGGCCCAATNONE 
J080088B01ATGGCCCAATNONE 
J080088E09ATGGCCCAATNONE 
J080093L01ATGGCCCAATNONE 
Os09g0325300011-005-H08CTGGCCCAACGCGGAGAGNONE 
AK068435CTGGCCCAACGCGGAGAGConserved hypothetical protein. 
AK073998CTGGCCCAACGCGGAGAGNONE 
J033071H21CTGGCCCAACGCGGAGAGNONE 
J065214H05CTGGCCCAACGCGGAGAGNONE 
Os09g0327300AK059603GTGGCCCAAAASimilar to Plastid 5,10-methylene-tetrahydrofolate dehydrogenase (Fragment). 
J100073E06GTGGCCCAAAANONE 
Os09g0395400AK109221ATGGCCCATGTGGCCCAAGConserved hypothetical protein. 
J075009I06ATGGCCCATGTGGCCCAAGNONE 
Os09g0401200AK063980CTGGCCCAAATAGGCCCAAGGCCCATTTSimilar to HSP associated protein like. 
Os09g0437900AK107833CTGGCCCAATASimilar to Adrenodoxin. 
Os09g0467700AK061600ATGGCCCAATConserved hypothetical protein. 
Os09g0485800AK108749ATTTGGGCCAGAConserved hypothetical protein. 
J065137H03ATTTGGGCCAGANONE 
Os09g0495200AK102989CTTGGGCCAAGTGGGCTTTConserved hypothetical protein. 
J075062H18CTTGGGCCAAGTGGGCTTTNONE 
J075098G06CTTGGGCCAAGTGGGCTTTNONE 
Os09g0509200AK069525GGCTGGGCCTTTGGGCCAASimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0528100009-173-A08TATTGGGCCAANONE 
009-190-G12TATTGGGCCAANONE 
AK059096TATTGGGCCAASimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0532600J013002F02TTTGGGCCAAGCCCATGTNONE 
Os09g0532800J065167K16TGTTGGGCCAAProtein prenyltransferase domain containing protein. 
Os09g0534000AK100026TATTGGGCCAGGCCCAAAAConserved hypothetical protein. 
Os09g0535300AK071211GTGGCCCAACTXAP5 protein family protein. 
Os09g0554000J065123C23ATGGCCCAACTSimilar to Mitochondrial phosphate transporter. 
Os11g0148000AK108267CTTGGGCCAASodium/calcium exchanger membrane region domain containing protein. 
J065051O11CTTGGGCCAANONE 
J065110G12CTTGGGCCAANONE 
Os11g0150400006-104-E01CTGGCCCAATNONE 
009-067-G02CTGGCCCAATNONE 
AK058243CTGGCCCAATDimeric alpha-beta barrel domain containing protein. 
AK061232CTGGCCCAATNONE 
AK099186CTGGCCCAATNONE 
Os11g0156401J100027N11ATGGCCCAACCProtein of unknown function DUF623, plant domain containing protein. 
J100042A10ATGGCCCAACCNONE 
J100063F10ATGGCCCAACCNONE 
Os11g0171700AK099115ATTGGGCCAASMAD/FHA domain containing protein. 
Os11g0182400016-077-B04TGTCAGTGTAATGGGCCATTGGGCCAGANONE 
AK112089TGTCAGTGTAATGGGCCATTGGGCCAGACyclin-like F-box domain containing protein. 
Os11g0202600AK102530CTGGCCCAAAAHypothetical protein. 
J090084P12CTGGCCCAAAANONE 
Os11g0593100AK070035GTGGCCCAAAProtein of unknown function DUF295 family protein. 
J023038E14GTGGCCCAAANONE 
J100062C21GTGGCCCAAANONE 
Os11g0606300J075039E08CTGGCCCAACGGCCCACGANONE 
J075044E18CTGGCCCAACGGCCCACGANONE 
J075053G16CTGGCCCAACGGCCCACGAConserved hypothetical protein. 
Os11g0617800009-105-D10CACGGCCCATTCTGGCCCAACANONE 
AK062778CACGGCCCATTCTGGCCCAACAConserved hypothetical protein. 
Os11g0642100AK107010TTGGCCCAACCyclin-like F-box domain containing protein. 
Os11g0645300003-107-E03ATTTGGGCCAGCCCAACCNONE 
006-108-C01ATTTGGGCCAGCCCAACCNONE 
009-015-H10ATTTGGGCCAGCCCAACCNONE 
009-020-G11ATTTGGGCCAGCCCAACCNONE 
009-047-F04ATTTGGGCCAGCCCAACCNONE 
009-053-A12ATTTGGGCCAGCCCAACCNONE 
009-059-B03ATTTGGGCCAGCCCAACCNONE 
009-067-A06ATTTGGGCCAGCCCAACCNONE 
009-084-C03ATTTGGGCCAGCCCAACCNONE 
009-108-G09ATTTGGGCCAGCCCAACCNONE 
009-122-G05ATTTGGGCCAGCCCAACCNONE 
009-124-D08ATTTGGGCCAGCCCAACCNONE 
009-136-C07ATTTGGGCCAGCCCAACCNONE 
013-049-E07ATTTGGGCCAGCCCAACCNONE 
014-056-G04ATTTGGGCCAGCCCAACCNONE 
AK062126ATTTGGGCCAGCCCAACCNONE 
AK120284ATTTGGGCCAGCCCAACCPlant disease resistance response protein family protein. 
J013043F05ATTTGGGCCAGCCCAACCNONE 
J013049N05ATTTGGGCCAGCCCAACCNONE 
J013050H05ATTTGGGCCAGCCCAACCNONE 
J065053N22ATTTGGGCCAGCCCAACCNONE 
J065218J04ATTTGGGCCAGCCCAACCNONE 
J075064K03ATTTGGGCCAGCCCAACCNONE 
J075073L24ATTTGGGCCAGCCCAACCNONE 
J075108C10ATTTGGGCCAGCCCAACCNONE 
Os12g0120000011-024-E09GTGGCCCAAANONE 
AK105399GTGGCCCAAAProtein of unknown function DUF936, plant family protein. 
Os12g0223700J075049J03CTTGGGCCAAAAGCCCAAGHypothetical protein. 
J075101F23CTTGGGCCAAAAGCCCAAGNONE 
Os12g0236900AK068145CTGGCCCAATNuclear protein SET domain containing protein. 
Os12g0257000AK064874TTGGCCCAAACSerine carboxypeptidase I precursor (EC 3.4.16.5) (Carboxypeptidase C). 
Os12g0554400AK072345TTGGCCCAAATetratricopeptide-like helical domain containing protein. 
Os12g0575000009-057-B12ATTGGGCCATNONE 
009-113-B05ATTGGGCCATNONE 
009-170-F09ATTGGGCCATNONE 
009-191-D05ATTGGGCCATNONE 
AK059885ATTGGGCCATNONE 
AK104945ATTGGGCCATProtein of unknown function DUF1118 family protein. 
J013124C09ATTGGGCCATNONE 
J013156G23ATTGGGCCATNONE 
J023033G18ATTGGGCCATNONE 
J065055H05ATTGGGCCATNONE 
J065129P17ATTGGGCCATNONE 
J065188E10ATTGGGCCATNONE 
J065195J24ATTGGGCCATNONE 
J075027I24ATTGGGCCATNONE 
J075028H07ATTGGGCCATNONE 
J075032A03ATTGGGCCATNONE 
J075057M10ATTGGGCCATNONE 
J075093K11ATTGGGCCATNONE 
J075098D20ATTGGGCCATNONE 
J075126N24ATTGGGCCATNONE 
J075140M14ATTGGGCCATNONE 
J075140M21ATTGGGCCATNONE 
J075147P07ATTGGGCCATNONE 
J075153F12ATTGGGCCATNONE 
J075157C13ATTGGGCCATNONE 
J075174K01ATTGGGCCATNONE 
J075194B17ATTGGGCCATNONE 
J075195E11ATTGGGCCATNONE 
Os12g0605400009-005-G05CTGGCCCAATNONE 
016-024-B01CTGGCCCAATNONE 
016-043-A11CTGGCCCAATNONE 
AK068060CTGGCCCAATSimilar to CROC-1-like protein (Fragment). 
J013130B07CTGGCCCAATNONE 
J023141C14CTGGCCCAATNONE 
J033037O04CTGGCCCAATNONE 
J033081L17CTGGCCCAATNONE 
J033108C03CTGGCCCAATNONE 
J065079G22CTGGCCCAATNONE 
J065082D03CTGGCCCAATNONE 
J065207O15CTGGCCCAATNONE 
J075027C23CTGGCCCAATNONE 
J075037A17CTGGCCCAATNONE 
J075056D17CTGGCCCAATNONE 
J075064O21CTGGCCCAATNONE 
J075096E08CTGGCCCAATNONE 
J090036I15CTGGCCCAATNONE 
J100018P15CTGGCCCAATNONE 
J100074O06CTGGCCCAATNONE 
Os12g0624800AK103828AGTTGGGCCATHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.