version

Summary of OsREG660 (All List)

OrganismOryza sativa  
IDOsREG660  
SequenceTGGGCCAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2095  

Entry Sequences (2095 entries)

LocusGene modelSequenceDescription
Os01g0134200AK102394TTGGCCCAAGCAAGCCCAACAConserved hypothetical protein. 
Os01g0139600AK073130TTGGCCCAGATSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0196600AK101742CTTGGGCCAANONE 
U25430CTTGGGCCAASimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0229100006-113-G08CCAGGCCCATTTTGGCCCATACNONE 
011-075-E08CCAGGCCCATTTTGGCCCATACNONE 
AK061285CCAGGCCCATTTTGGCCCATACNONE 
AK070838CCAGGCCCATTTTGGCCCATACTetratricopeptide-like helical domain containing protein. 
J013059F08CCAGGCCCATTTTGGCCCATACNONE 
J013059G08CCAGGCCCATTTTGGCCCATACNONE 
J013059G09CCAGGCCCATTTTGGCCCATACNONE 
J013069M12CCAGGCCCATTTTGGCCCATACNONE 
J013105A19CCAGGCCCATTTTGGCCCATACNONE 
J013149F07CCAGGCCCATTTTGGCCCATACNONE 
J023073J07CCAGGCCCATTTTGGCCCATACNONE 
J023130F24CCAGGCCCATTTTGGCCCATACNONE 
J023147J08CCAGGCCCATTTTGGCCCATACNONE 
J033028F13CCAGGCCCATTTTGGCCCATACNONE 
J033115A16CCAGGCCCATTTTGGCCCATACNONE 
J033135F02CCAGGCCCATTTTGGCCCATACNONE 
J065031G16CCAGGCCCATTTTGGCCCATACNONE 
J065058A09CCAGGCCCATTTTGGCCCATACNONE 
J065089N15CCAGGCCCATTTTGGCCCATACNONE 
J065130I09CCAGGCCCATTTTGGCCCATACNONE 
J065191P09CCAGGCCCATTTTGGCCCATACNONE 
J065197P14CCAGGCCCATTTTGGCCCATACNONE 
J080306D15CCAGGCCCATTTTGGCCCATACNONE 
J080308M06CCAGGCCCATTTTGGCCCATACNONE 
J080315A03CCAGGCCCATTTTGGCCCATACNONE 
J080315N11CCAGGCCCATTTTGGCCCATACNONE 
J090046E14CCAGGCCCATTTTGGCCCATACNONE 
J090058G09CCAGGCCCATTTTGGCCCATACNONE 
J090077H05CCAGGCCCATTTTGGCCCATACNONE 
J090087O20CCAGGCCCATTTTGGCCCATACNONE 
Os01g0229200AK066024GTATGGGCCAAAATGGGCCTGGVHS domain containing protein. 
Os01g0272600015-046-G06TGGGCCAANONE 
AK067786TGGGCCAAConserved hypothetical protein. 
Os01g0273300Os01g0273300TTGGCCCAGATBSD domain containing protein. 
Os01g0298400J065186D02TTGGCCCAGCMyb, DNA-binding domain containing protein. 
Os01g0299400AK107814GGTTGGGCCAATTTTGGGCCGTASterile alpha motif homology domain containing protein. 
J065112H10GGTTGGGCCAATTTTGGGCCGTANONE 
Os01g0303100009-049-H10TTATGGGCCATATGGGCCAANONE 
AK062603TTATGGGCCATATGGGCCAASimilar to Chitinase precursor (EC 3.2.1.17). 
Os01g0331900013-026-D04GTTTGGGCCAANONE 
AK064784GTTTGGGCCAANONE 
AK121761GTTTGGGCCAAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTTTGGGCCAANONE 
J033090D07GTTTGGGCCAANONE 
J090006L21GTTTGGGCCAANONE 
Os01g0591300AK101427AATTGGGCCAASimilar to Cytosolic aldehyde dehydrogenase RF2D. 
Os01g0622300006-041-C10TTGGCCCACGANONE 
AK072290TTGGCCCACGANONE 
AK099135TTGGCCCACGANONE 
AK106203TTGGCCCACGASimilar to Plastid uroporphyrinogen decarboxylase (Fragment). 
J065102E05TTGGCCCACGANONE 
J080044C04TTGGCCCACGANONE 
J080046E10TTGGCCCACGANONE 
J080050J18TTGGCCCACGANONE 
J080067B13TTGGCCCACGANONE 
J080072C04TTGGCCCACGANONE 
J080072J09TTGGCCCACGANONE 
J080075A16TTGGCCCACGANONE 
J080093E02TTGGCCCACGANONE 
Os01g0623500AK066142TTTTGGGCCAAAAA ATPase domain containing protein. 
J013055O07TTTTGGGCCAANONE 
J053069D06TTTTGGGCCAANONE 
J053095J11TTTTGGGCCAANONE 
J065106D24TTTTGGGCCAANONE 
J065134H18TTTTGGGCCAANONE 
J075066D09TTTTGGGCCAANONE 
J090004M17TTTTGGGCCAANONE 
J100039L05TTTTGGGCCAANONE 
J100042E15TTTTGGGCCAANONE 
J100043B18TTTTGGGCCAANONE 
J100057L11TTTTGGGCCAANONE 
J100067C24TTTTGGGCCAANONE 
J100073H01TTTTGGGCCAANONE 
J100081J21TTTTGGGCCAANONE 
Os01g0633400AK108988TTGGCCCATCGTGGCCCAGTACBS domain containing protein. 
Os01g0678500AB071014TTGGCCCAACNONE 
AB100696TTGGCCCAACSimilar to Two-pore calcium channel. 
AK067839TTGGCCCAACNONE 
AK100998TTGGCCCAACNONE 
J013089O09TTGGCCCAACNONE 
J013126J24TTGGCCCAACNONE 
J013146L16TTGGCCCAACNONE 
J013160D06TTGGCCCAACNONE 
J090067N19TTGGCCCAACNONE 
J090070E11TTGGCCCAACNONE 
Os01g0692100J043022J20TTGGCCCAGCGlutathione S-transferase, N-terminal domain containing protein. 
J100032K22TTGGCCCAGCNONE 
Os01g0710000AK111794TTGGCCCAATASimilar to WD-repeat protein RBAP1. 
J023006D22TTGGCCCAATANONE 
J065106P04TTGGCCCAATANONE 
J100036G13TTGGCCCAATANONE 
Os01g0738600AK073479TTGGCCCATGGENTH/VHS domain containing protein. 
AK120616TTGGCCCATGGNONE 
J013046M12TTGGCCCATGGNONE 
J013152B11TTGGCCCATGGNONE 
J023007A09TTGGCCCATGGNONE 
J023007N03TTGGCCCATGGNONE 
J023042A01TTGGCCCATGGNONE 
J023059P06TTGGCCCATGGNONE 
J023113A05TTGGCCCATGGNONE 
J033044K11TTGGCCCATGGNONE 
J033082E04TTGGCCCATGGNONE 
J090033B13TTGGCCCATGGNONE 
J090062H08TTGGCCCATGGNONE 
J100086G23TTGGCCCATGGNONE 
Os01g0773700003-115-A05TTGGCCCAACTNONE 
009-016-C08TTGGCCCAACTNONE 
009-027-A08TTGGCCCAACTNONE 
009-038-C02TTGGCCCAACTNONE 
009-087-D04TTGGCCCAACTNONE 
009-119-A01TTGGCCCAACTNONE 
009-125-D06TTGGCCCAACTNONE 
009-129-B06TTGGCCCAACTNONE 
009-136-G07TTGGCCCAACTNONE 
009-141-D09TTGGCCCAACTNONE 
009-149-C06TTGGCCCAACTNONE 
009-149-G03TTGGCCCAACTNONE 
009-149-H06TTGGCCCAACTNONE 
009-151-C05TTGGCCCAACTNONE 
009-153-D08TTGGCCCAACTNONE 
009-154-H12TTGGCCCAACTNONE 
009-181-C03TTGGCCCAACTNONE 
009-181-C06TTGGCCCAACTNONE 
009-181-G02TTGGCCCAACTNONE 
009-183-B06TTGGCCCAACTNONE 
009-187-D09TTGGCCCAACTNONE 
009-194-C07TTGGCCCAACTNONE 
009-194-C10TTGGCCCAACTNONE 
009-195-F10TTGGCCCAACTNONE 
009-199-G07TTGGCCCAACTNONE 
AK060438TTGGCCCAACTNONE 
AK060476TTGGCCCAACTNONE 
AK119161TTGGCCCAACTSimilar to Photosystem II reaction center W protein (PSII 6.1 kDa protein) (Fragment). 
J013132H23TTGGCCCAACTNONE 
J013158C16TTGGCCCAACTNONE 
J023008K22TTGGCCCAACTNONE 
J023012B02TTGGCCCAACTNONE 
J065045L04TTGGCCCAACTNONE 
J065046O07TTGGCCCAACTNONE 
J065048G02TTGGCCCAACTNONE 
J065060H11TTGGCCCAACTNONE 
J065101B04TTGGCCCAACTNONE 
J065148G21TTGGCCCAACTNONE 
J065158L13TTGGCCCAACTNONE 
J065180I22TTGGCCCAACTNONE 
J075007F14TTGGCCCAACTNONE 
J075047L09TTGGCCCAACTNONE 
J075122H09TTGGCCCAACTNONE 
J075175B12TTGGCCCAACTNONE 
J075193A01TTGGCCCAACTNONE 
J080303H08TTGGCCCAACTNONE 
J080305O21TTGGCCCAACTNONE 
J080306M22TTGGCCCAACTNONE 
Os01g0784600AK067527TTGGCCCAGGConserved hypothetical protein. 
Os01g0785600AK111308TTGGCCCAGCCCAATAMethyltransferase type 11 domain containing protein. 
Os01g0785700AK100774TATTGGGCTGGGCCAANONE 
AK102081TATTGGGCTGGGCCAAProtein prenyltransferase domain containing protein. 
AY129829TATTGGGCTGGGCCAANONE 
J023120B17TATTGGGCTGGGCCAANONE 
J033082K10TATTGGGCTGGGCCAANONE 
Os01g0805000009-045-H11TTGGCCCAAGNONE 
009-196-H08TTGGCCCAAGNONE 
J013094D22TTGGCCCAAGRibosomal protein L34 family protein. 
J013119F23TTGGCCCAAGNONE 
J065128B11TTGGCCCAAGNONE 
Os01g0821800015-005-A04ATTGGGCCATTGGCCCATTNONE 
AK073951ATTGGGCCATTGGCCCATTNONE 
AK103171ATTGGGCCATTGGCCCATTNONE 
AK119168ATTGGGCCATTGGCCCATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22ATTGGGCCATTGGCCCATTNONE 
J033098N09ATTGGGCCATTGGCCCATTNONE 
J033121G11ATTGGGCCATTGGCCCATTNONE 
J090030L03ATTGGGCCATTGGCCCATTNONE 
Os01g0839300AK064685TTGGCCCACAASimilar to 50S ribosomal protein L17. 
J065060I21TTGGCCCACAANONE 
Os01g0851000AK065338TTGGCCCATATPfkB domain containing protein. 
Os01g0874800016-042-F01AAATGGGCTTTTGGCCCATAANONE 
016-042-F01TACTGGGCCAANONE 
AK065916AAATGGGCTTTTGGCCCATAANONE 
AK065916TACTGGGCCAANONE 
AK065991AAATGGGCTTTTGGCCCATAANONE 
AK065991TACTGGGCCAANONE 
AK103577AAATGGGCTTTTGGCCCATAANONE 
AK103577TACTGGGCCAANONE 
AK105063AAATGGGCTTTTGGCCCATAA5'-3' exonuclease domain containing protein. 
AK105063TACTGGGCCAA5'-3' exonuclease domain containing protein. 
AK119315AAATGGGCTTTTGGCCCATAANONE 
AK119315TACTGGGCCAANONE 
J023106C06AAATGGGCTTTTGGCCCATAANONE 
J023106C06TACTGGGCCAANONE 
J053023A11AAATGGGCTTTTGGCCCATAANONE 
J053023A11TACTGGGCCAANONE 
J053068H13AAATGGGCTTTTGGCCCATAANONE 
J053068H13TACTGGGCCAANONE 
J053071O13AAATGGGCTTTTGGCCCATAANONE 
J053071O13TACTGGGCCAANONE 
J053074M10AAATGGGCTTTTGGCCCATAANONE 
J053074M10TACTGGGCCAANONE 
Os01g0891400J065077E24TTGGCCCAAAAConserved hypothetical protein. 
J065206I07TTGGCCCAAAANONE 
Os01g0895100AK058611TTGGCCCACASimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK058611TTGGCCCATTSimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698TTGGCCCACANONE 
AK067698TTGGCCCATTNONE 
AK099166TTGGCCCACANONE 
AK099166TTGGCCCATTNONE 
J023065I03TTGGCCCACANONE 
J023065I03TTGGCCCATTNONE 
J023081J06TTGGCCCACANONE 
J023081J06TTGGCCCATTNONE 
J023126H17TTGGCCCACANONE 
J023126H17TTGGCCCATTNONE 
J023126O09TTGGCCCACANONE 
J023126O09TTGGCCCATTNONE 
J033035I06TTGGCCCACANONE 
J033035I06TTGGCCCATTNONE 
J090065C10TTGGCCCACANONE 
J090065C10TTGGCCCATTNONE 
J090095O16TTGGCCCACANONE 
J090095O16TTGGCCCATTNONE 
Os01g0924000004-020-C09GCTGGGCCAANONE 
005-014-A06GCTGGGCCAANONE 
009-085-G12GCTGGGCCAANONE 
009-123-A08GCTGGGCCAANONE 
009-134-A05GCTGGGCCAANONE 
009-137-F06GCTGGGCCAANONE 
016-016-B08GCTGGGCCAANONE 
AF050674GCTGGGCCAANONE 
AK061690GCTGGGCCAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797GCTGGGCCAANONE 
J013040A15GCTGGGCCAANONE 
J013104L20GCTGGGCCAANONE 
J013127E12GCTGGGCCAANONE 
J013158O05GCTGGGCCAANONE 
J023012E09GCTGGGCCAANONE 
J023126L23GCTGGGCCAANONE 
J023143B03GCTGGGCCAANONE 
J065005B16GCTGGGCCAANONE 
J065101J15GCTGGGCCAANONE 
J065105K16GCTGGGCCAANONE 
J065155K16GCTGGGCCAANONE 
J065171M17GCTGGGCCAANONE 
J065182F07GCTGGGCCAANONE 
J065187D10GCTGGGCCAANONE 
J065194I24GCTGGGCCAANONE 
J065207E24GCTGGGCCAANONE 
J075001C24GCTGGGCCAANONE 
J075090O10GCTGGGCCAANONE 
J075095H17GCTGGGCCAANONE 
J075109M24GCTGGGCCAANONE 
J075123C18GCTGGGCCAANONE 
J075148G22GCTGGGCCAANONE 
J090009B09GCTGGGCCAANONE 
J090075K17GCTGGGCCAANONE 
J090081H23GCTGGGCCAANONE 
J090097H21GCTGGGCCAANONE 
J100063P14GCTGGGCCAANONE 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
J023036H24AGATGGGCCTTGGCCCATGANONE 
J023084G23AGATGGGCCTTGGCCCATGANONE 
J033025J04AGATGGGCCTTGGCCCATGANONE 
J033139J18AGATGGGCCTTGGCCCATGANONE 
J090006A09AGATGGGCCTTGGCCCATGANONE 
J090036D02AGATGGGCCTTGGCCCATGANONE 
Os01g0951800AK069239TTGGCCCACTProtein prenyltransferase domain containing protein. 
Os01g0953100AK064981TTGGCCCATTTNONE 
AK068882TTGGCCCATTTProtein of unknown function DUF594 family protein. 
J013001C07TTGGCCCATTTNONE 
J013169K14TTGGCCCATTTNONE 
J033114G07TTGGCCCATTTNONE 
J065035K15TTGGCCCATTTNONE 
J065082E12TTGGCCCATTTNONE 
Os01g0959900AK058375TTGGCCCAAAAConserved hypothetical protein. 
AK066497TTGGCCCAAAANONE 
Os01g0960300AK100099TTGGCCCATATSimilar to Glucose inhibited division protein A. 
Os01g0965400006-063-H08TTGGCCCAAAANONE 
011-037-A03TTGGCCCAAAANONE 
AK069647TTGGCCCAAAASimilar to Uridylate kinase (EC 2.7.4.-) (UK) (Uridine monophosphate kinase) (UMP kinase). 
AK104789TTGGCCCAAAANONE 
J013072N21TTGGCCCAAAANONE 
J023027E20TTGGCCCAAAANONE 
J023075O12TTGGCCCAAAANONE 
J033111H12TTGGCCCAAAANONE 
J080001F12TTGGCCCAAAANONE 
J080004J12TTGGCCCAAAANONE 
J080005N15TTGGCCCAAAANONE 
J080008D06TTGGCCCAAAANONE 
J080010I10TTGGCCCAAAANONE 
J080011D19TTGGCCCAAAANONE 
J080015G04TTGGCCCAAAANONE 
J080018O05TTGGCCCAAAANONE 
J080024K13TTGGCCCAAAANONE 
J080026M08TTGGCCCAAAANONE 
J080027H22TTGGCCCAAAANONE 
J080027L18TTGGCCCAAAANONE 
J080029C13TTGGCCCAAAANONE 
J080030A02TTGGCCCAAAANONE 
J080031C10TTGGCCCAAAANONE 
J080038L14TTGGCCCAAAANONE 
J080039B17TTGGCCCAAAANONE 
J080041C13TTGGCCCAAAANONE 
J080042A06TTGGCCCAAAANONE 
J080043L15TTGGCCCAAAANONE 
J080047C08TTGGCCCAAAANONE 
J080049C07TTGGCCCAAAANONE 
J080051M10TTGGCCCAAAANONE 
J080053F03TTGGCCCAAAANONE 
J080054B13TTGGCCCAAAANONE 
J080063K02TTGGCCCAAAANONE 
J080064L04TTGGCCCAAAANONE 
J080071B19TTGGCCCAAAANONE 
J080071M13TTGGCCCAAAANONE 
J080083P09TTGGCCCAAAANONE 
J080088G09TTGGCCCAAAANONE 
J080089I16TTGGCCCAAAANONE 
J080092E23TTGGCCCAAAANONE 
J080093B19TTGGCCCAAAANONE 
J080097H14TTGGCCCAAAANONE 
Os02g0106100AK072245AACTGGGCCAASimilar to Fructosyltransferase. 
Os02g0119400AK060055TTGGCCCACGTGTCCNONE 
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52). 
J033107H09TTGGCCCACGTGTCCNONE 
J075175F09TTGGCCCACGTGTCCNONE 
J090011H05TTGGCCCACGTGTCCNONE 
J090091O05TTGGCCCACGTGTCCNONE 
Os02g0119700AK108777TTGGCCCAAATACGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0133800006-092-D12CCTGGGCCAAAGCCCAATTNONE 
006-111-G01CCTGGGCCAAAGCCCAATTNONE 
AK103646CCTGGGCCAAAGCCCAATTNONE 
AK109376CCTGGGCCAAAGCCCAATTProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CCTGGGCCAAAGCCCAATTNONE 
J033135B19CCTGGGCCAAAGCCCAATTNONE 
J065200F01CCTGGGCCAAAGCCCAATTNONE 
J065213J11CCTGGGCCAAAGCCCAATTNONE 
J075031N16CCTGGGCCAAAGCCCAATTNONE 
J075032N17CCTGGGCCAAAGCCCAATTNONE 
J075047P04CCTGGGCCAAAGCCCAATTNONE 
J075063D01CCTGGGCCAAAGCCCAATTNONE 
J075105F23CCTGGGCCAAAGCCCAATTNONE 
J075121E16CCTGGGCCAAAGCCCAATTNONE 
J075176F10CCTGGGCCAAAGCCCAATTNONE 
J075182M16CCTGGGCCAAAGCCCAATTNONE 
J075190E09CCTGGGCCAAAGCCCAATTNONE 
J075191B14CCTGGGCCAAAGCCCAATTNONE 
J100055J24CCTGGGCCAAAGCCCAATTNONE 
J100066H24CCTGGGCCAAAGCCCAATTNONE 
J100073N01CCTGGGCCAAAGCCCAATTNONE 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0162500009-181-F03TTGGCCCAGCCCATAANONE 
009-181-F03TTGGCCCATCCNONE 
AK058907TTGGCCCAGCCCATAANONE 
AK058907TTGGCCCATCCNONE 
AK121223TTGGCCCAGCCCATAASimilar to 40S ribosomal protein S14. 
AK121223TTGGCCCATCCSimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCAGCCCATAANONE 
J023090I10TTGGCCCATCCNONE 
J023136J11TTGGCCCAGCCCATAANONE 
J023136J11TTGGCCCATCCNONE 
J053097J20TTGGCCCAGCCCATAANONE 
J053097J20TTGGCCCATCCNONE 
J053098F01TTGGCCCAGCCCATAANONE 
J053098F01TTGGCCCATCCNONE 
J065065B09TTGGCCCAGCCCATAANONE 
J065065B09TTGGCCCATCCNONE 
J065082M04TTGGCCCAGCCCATAANONE 
J065082M04TTGGCCCATCCNONE 
J065188O05TTGGCCCAGCCCATAANONE 
J065188O05TTGGCCCATCCNONE 
J075057P15TTGGCCCAGCCCATAANONE 
J075057P15TTGGCCCATCCNONE 
J075061J08TTGGCCCAGCCCATAANONE 
J075061J08TTGGCCCATCCNONE 
J075061N15TTGGCCCAGCCCATAANONE 
J075061N15TTGGCCCATCCNONE 
J075131I08TTGGCCCAGCCCATAANONE 
J075131I08TTGGCCCATCCNONE 
J075141H13TTGGCCCAGCCCATAANONE 
J075141H13TTGGCCCATCCNONE 
J080062E14TTGGCCCAGCCCATAANONE 
J080062E14TTGGCCCATCCNONE 
J080062P15TTGGCCCAGCCCATAANONE 
J080062P15TTGGCCCATCCNONE 
J080318G17TTGGCCCAGCCCATAANONE 
J080318G17TTGGCCCATCCNONE 
J080319G19TTGGCCCAGCCCATAANONE 
J080319G19TTGGCCCATCCNONE 
J090001L10TTGGCCCAGCCCATAANONE 
J090001L10TTGGCCCATCCNONE 
J090024I18TTGGCCCAGCCCATAANONE 
J090024I18TTGGCCCATCCNONE 
J090033F24TTGGCCCAGCCCATAANONE 
J090033F24TTGGCCCATCCNONE 
J090036M16TTGGCCCAGCCCATAANONE 
J090036M16TTGGCCCATCCNONE 
J090040I24TTGGCCCAGCCCATAANONE 
J090040I24TTGGCCCATCCNONE 
J090048P06TTGGCCCAGCCCATAANONE 
J090048P06TTGGCCCATCCNONE 
J090049B12TTGGCCCAGCCCATAANONE 
J090049B12TTGGCCCATCCNONE 
J090068C02TTGGCCCAGCCCATAANONE 
J090068C02TTGGCCCATCCNONE 
J090069O04TTGGCCCAGCCCATAANONE 
J090069O04TTGGCCCATCCNONE 
J090084H22TTGGCCCAGCCCATAANONE 
J090084H22TTGGCCCATCCNONE 
J100022L03TTGGCCCAGCCCATAANONE 
J100022L03TTGGCCCATCCNONE 
J100028O14TTGGCCCAGCCCATAANONE 
J100028O14TTGGCCCATCCNONE 
J100028O18TTGGCCCAGCCCATAANONE 
J100028O18TTGGCCCATCCNONE 
J100032A15TTGGCCCAGCCCATAANONE 
J100032A15TTGGCCCATCCNONE 
J100033D21TTGGCCCAGCCCATAANONE 
J100033D21TTGGCCCATCCNONE 
J100034J23TTGGCCCAGCCCATAANONE 
J100034J23TTGGCCCATCCNONE 
J100043K22TTGGCCCAGCCCATAANONE 
J100043K22TTGGCCCATCCNONE 
J100052M22TTGGCCCAGCCCATAANONE 
J100052M22TTGGCCCATCCNONE 
J100053N03TTGGCCCAGCCCATAANONE 
J100053N03TTGGCCCATCCNONE 
J100074N24TTGGCCCAGCCCATAANONE 
J100074N24TTGGCCCATCCNONE 
J100082J10TTGGCCCAGCCCATAANONE 
J100082J10TTGGCCCATCCNONE 
Os02g0169000AK101628AGATGGGCCAAConserved hypothetical protein. 
Os02g0178400009-151-B08TTGGCCCACGAGGCCCATAANONE 
AK063815TTGGCCCACGAGGCCCATAAProtein transport protein SEC61 gamma subunit. 
AK121516TTGGCCCACGAGGCCCATAANONE 
J033026A17TTGGCCCACGAGGCCCATAANONE 
J065011K14TTGGCCCACGAGGCCCATAANONE 
J065056D01TTGGCCCACGAGGCCCATAANONE 
J065061L22TTGGCCCACGAGGCCCATAANONE 
J065076M01TTGGCCCACGAGGCCCATAANONE 
J075092E14TTGGCCCACGAGGCCCATAANONE 
Os02g0186900J100059N12TTGGCCCAGCCytochrome P450 family protein. 
Os02g0187600AK069783TTGGCCCAGTNONE 
AK109387TTGGCCCAGTConserved hypothetical protein. 
J090029C18TTGGCCCAGTNONE 
Os02g0192500AK059580TTGGCCCATGNONE 
Os02g0235600009-009-H04ATTTGGGCTTTTGGCCCATTTNONE 
009-165-G06ATTTGGGCTTTTGGCCCATTTNONE 
AK120417ATTTGGGCTTTTGGCCCATTTSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14ATTTGGGCTTTTGGCCCATTTNONE 
J023106P11ATTTGGGCTTTTGGCCCATTTNONE 
J033080L09ATTTGGGCTTTTGGCCCATTTNONE 
J033123O05ATTTGGGCTTTTGGCCCATTTNONE 
J065197A18ATTTGGGCTTTTGGCCCATTTNONE 
J065216P16ATTTGGGCTTTTGGCCCATTTNONE 
J075017F02ATTTGGGCTTTTGGCCCATTTNONE 
J075025L16ATTTGGGCTTTTGGCCCATTTNONE 
J075027P04ATTTGGGCTTTTGGCCCATTTNONE 
J075039N01ATTTGGGCTTTTGGCCCATTTNONE 
J075101F24ATTTGGGCTTTTGGCCCATTTNONE 
J075132J15ATTTGGGCTTTTGGCCCATTTNONE 
J075164K16ATTTGGGCTTTTGGCCCATTTNONE 
J075174E19ATTTGGGCTTTTGGCCCATTTNONE 
J100043C23ATTTGGGCTTTTGGCCCATTTNONE 
J100067B11ATTTGGGCTTTTGGCCCATTTNONE 
Os02g0281200009-184-D06TTGGCCCAACANONE 
AK063172TTGGCCCAACANONE 
Os02g0332700009-144-D04TTGGCCCAGGNONE 
AK062975TTGGCCCAGGConserved hypothetical protein. 
Os02g0435000AK060832TTGGCCCACTNONE 
AK102414TTGGCCCACTTranslocation protein Sec62 family protein. 
Os02g0517531AK121247TTGGCCCACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os02g0643500AK068423TCATGGGCCAAPentapeptide repeat containing protein. 
Os02g0658300AK073923CTTGGGCCAAConserved hypothetical protein. 
J065152M15CTTGGGCCAANONE 
Os02g0673000AK108650TTGGCCCAGGProtein of unknown function UPF0005 family protein. 
Os02g0714700AK067734TTGGCCCAGCConserved hypothetical protein. 
Os02g0753200AK067176TTGGCCCATATConserved hypothetical protein. 
AK067176TTGGCCCATATConserved hypothetical protein. 
J013097D23TTGGCCCATATNONE 
J013097D23TTGGCCCATATNONE 
J065085J01TTGGCCCATATNONE 
J065085J01TTGGCCCATATNONE 
J065152L23TTGGCCCATATNONE 
J065152L23TTGGCCCATATNONE 
J065162F18TTGGCCCATATNONE 
J065162F18TTGGCCCATATNONE 
J075002K17TTGGCCCATATNONE 
J075002K17TTGGCCCATATNONE 
J075047D24TTGGCCCATATNONE 
J075047D24TTGGCCCATATNONE 
J075064A01TTGGCCCATATNONE 
J075064A01TTGGCCCATATNONE 
J075075C09TTGGCCCATATNONE 
J075075C09TTGGCCCATATNONE 
J075088M01TTGGCCCATATNONE 
J075088M01TTGGCCCATATNONE 
J075130K03TTGGCCCATATNONE 
J075130K03TTGGCCCATATNONE 
J075146K03TTGGCCCATATNONE 
J075146K03TTGGCCCATATNONE 
J090049F07TTGGCCCATATNONE 
J090049F07TTGGCCCATATNONE 
Os02g0753700009-083-H09TTGGCCCAAAANONE 
AK062661TTGGCCCAAAANONE 
AK103542TTGGCCCAAAAVQ domain containing protein. 
J100025D08TTGGCCCAAAANONE 
J100035B22TTGGCCCAAAANONE 
Os02g0754700AK066904TTGGCCCAATASimilar to Histidyl-tRNA synthetase (EC 6.1.1.21). 
AK099136TTGGCCCAATANONE 
Os02g0762300AK106684TTGGCCCACAProtein of unknown function UPF0021 family protein. 
J090060M09TTGGCCCACANONE 
J100083E05TTGGCCCACANONE 
Os02g0763000J065017L09ATATGGGCCAACGGCCNONE 
J065036A05ATATGGGCCAACGGCCNONE 
J065087C01ATATGGGCCAACGGCCNONE 
J065105A14ATATGGGCCAACGGCCNONE 
J065164J03ATATGGGCCAACGGCCNONE 
J065175J19ATATGGGCCAACGGCCNONE 
J065201H07ATATGGGCCAACGGCCProtein of unknown function Cys-rich family protein. 
J075032O12ATATGGGCCAACGGCCNONE 
J075085D24ATATGGGCCAACGGCCNONE 
J075197C17ATATGGGCCAACGGCCNONE 
J100032C19ATATGGGCCAACGGCCNONE 
Os02g0778200AK065948ACCGGCCCAAGTTGGCCCAAGAminoacyl-tRNA synthetase, class I family protein. 
Os02g0785800005-017-E01TTGGCCCACTNONE 
009-104-F05TTGGCCCACTNONE 
009-149-A09TTGGCCCACTNONE 
009-192-D08TTGGCCCACTNONE 
AK063859TTGGCCCACTNONE 
AK121768TTGGCCCACTSimilar to Ribosomal protein L35A. 
J013037M21TTGGCCCACTNONE 
J023009A11TTGGCCCACTNONE 
J023010P14TTGGCCCACTNONE 
J033092B03TTGGCCCACTNONE 
J065009O06TTGGCCCACTNONE 
J065024K14TTGGCCCACTNONE 
J065053F16TTGGCCCACTNONE 
J065056D18TTGGCCCACTNONE 
J065056N12TTGGCCCACTNONE 
J065071L21TTGGCCCACTNONE 
J065075M21TTGGCCCACTNONE 
J065087D19TTGGCCCACTNONE 
J065111N01TTGGCCCACTNONE 
J065172M05TTGGCCCACTNONE 
J065176E03TTGGCCCACTNONE 
J065184D08TTGGCCCACTNONE 
J065188K21TTGGCCCACTNONE 
J065194I05TTGGCCCACTNONE 
J065196E09TTGGCCCACTNONE 
J065196O21TTGGCCCACTNONE 
J065204O06TTGGCCCACTNONE 
J065212J02TTGGCCCACTNONE 
J075066H03TTGGCCCACTNONE 
J075067C04TTGGCCCACTNONE 
J075070I09TTGGCCCACTNONE 
J075081J03TTGGCCCACTNONE 
J075086I05TTGGCCCACTNONE 
J075092E09TTGGCCCACTNONE 
J075096D13TTGGCCCACTNONE 
J075098A12TTGGCCCACTNONE 
J075110B18TTGGCCCACTNONE 
J075116E14TTGGCCCACTNONE 
J075117J23TTGGCCCACTNONE 
J075117O16TTGGCCCACTNONE 
J075130H10TTGGCCCACTNONE 
J075151B07TTGGCCCACTNONE 
J075156C02TTGGCCCACTNONE 
J075159C07TTGGCCCACTNONE 
J075172O12TTGGCCCACTNONE 
J075181K16TTGGCCCACTNONE 
J075185J05TTGGCCCACTNONE 
J075186D14TTGGCCCACTNONE 
J075187F23TTGGCCCACTNONE 
J075193B15TTGGCCCACTNONE 
J075194P20TTGGCCCACTNONE 
J090002B21TTGGCCCACTNONE 
J090018E03TTGGCCCACTNONE 
J090029I04TTGGCCCACTNONE 
J090065F12TTGGCCCACTNONE 
J090066M05TTGGCCCACTNONE 
J090078A20TTGGCCCACTNONE 
J090084O15TTGGCCCACTNONE 
J090088P20TTGGCCCACTNONE 
J090098L20TTGGCCCACTNONE 
J100025B19TTGGCCCACTNONE 
J100038H15TTGGCCCACTNONE 
J100045H17TTGGCCCACTNONE 
J100058E17TTGGCCCACTNONE 
J100060O16TTGGCCCACTNONE 
J100067I10TTGGCCCACTNONE 
J100082N24TTGGCCCACTNONE 
J100083C17TTGGCCCACTNONE 
J100085I24TTGGCCCACTNONE 
J100087K20TTGGCCCACTNONE 
Os02g0791200AK120632TTTTGGGCCAAZinc finger, RING-type domain containing protein. 
J013153H21TTTTGGGCCAANONE 
J075179E08TTTTGGGCCAANONE 
J075181C07TTTTGGGCCAANONE 
Os02g0800000J100043O08AGTGGGCCAANONE 
J100064O18AGTGGGCCAANONE 
Os02g0805600006-054-D07ATCTGGGCCAANONE 
AK059822ATCTGGGCCAANONE 
AK099516ATCTGGGCCAASimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587ATCTGGGCCAANONE 
J065037H22ATCTGGGCCAANONE 
J090015P17ATCTGGGCCAANONE 
Os02g0819100AK100156TTGGCCCAGTTZinc finger, DHHC-type domain containing protein. 
J013088C21TTGGCCCAGTTNONE 
Os02g0819500AK058926TGATGGGCCAANONE 
Os02g0830100J013032G02TTGGCCCATGANONE 
J013052O21TTGGCCCATGANONE 
J023078A05TTGGCCCATGANONE 
J033114C07TTGGCCCATGANONE 
J033125M07TTGGCCCATGANONE 
J053045C11TTGGCCCATGANONE 
J100055G05TTGGCCCATGANONE 
J100080J22TTGGCCCATGANONE 
Os02g0832200AK108268TTGGCCCATCTConserved hypothetical protein. 
J065053F07TTGGCCCATCTNONE 
J065095B09TTGGCCCATCTNONE 
J065137I11TTGGCCCATCTNONE 
J065187O12TTGGCCCATCTNONE 
J075193O05TTGGCCCATCTNONE 
Os03g0124300AK069148CTTGGGCCAAConserved hypothetical protein. 
AK106076CTTGGGCCAANONE 
J023003G19CTTGGGCCAANONE 
Os03g0126900AK109217GTGGCGTGGGCCAAConserved hypothetical protein. 
J065085G16GTGGCGTGGGCCAANONE 
J100086C03GTGGCGTGGGCCAANONE 
Os03g0127000AK068479TTGGCCCAGTTConserved hypothetical protein. 
J013152D10TTGGCCCAGTTNONE 
J075167I20TTGGCCCAGTTNONE 
J090067O04TTGGCCCAGTTNONE 
Os03g0130700AK110670TTGGCCCAGGNONE 
Os03g0139000006-059-C06TTGGCCCATANONE 
009-055-F07TTGGCCCATANONE 
AK060973TTGGCCCATAConserved hypothetical protein. 
AK103850TTGGCCCATANONE 
Os03g0143600AB110188TTGGCCCAGCNONE 
AK068424TTGGCCCAGCSimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464TTGGCCCAGCNONE 
AY224545TTGGCCCAGCNONE 
J013154F02TTGGCCCAGCNONE 
Os03g0146500006-036-F10TTGGCCCACCTGNONE 
006-082-C03TTGGCCCACCTGNONE 
006-098-E04TTGGCCCACCTGNONE 
006-110-C03TTGGCCCACCTGNONE 
009-057-C11TTGGCCCACCTGNONE 
009-182-D02TTGGCCCACCTGNONE 
AK059776TTGGCCCACCTGGalactose-binding like domain containing protein. 
AK071628TTGGCCCACCTGNONE 
AK104105TTGGCCCACCTGNONE 
AK104220TTGGCCCACCTGNONE 
J065168B02TTGGCCCACCTGNONE 
Os03g0168200AK099530AGTTGGGCCAAConserved hypothetical protein. 
Os03g0225600AK058500TGATGGGCCAAConserved oligomeric complex COG6 family protein. 
Os03g0227000AK068454GTTTGGGCCAASimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP). 
Os03g0257900009-150-G06TGTTGGGCCAANONE 
009-181-H05TGTTGGGCCAANONE 
AK063892TGTTGGGCCAANONE 
AK100114TGTTGGGCCAASimilar to Lectin-like receptor kinase 7;2. 
AK103486TGTTGGGCCAANONE 
J023006K11TGTTGGGCCAANONE 
J075005E15TGTTGGGCCAANONE 
J075007K24TGTTGGGCCAANONE 
J075034G06TGTTGGGCCAANONE 
J075051I19TGTTGGGCCAANONE 
J075076A08TGTTGGGCCAANONE 
J075096H04TGTTGGGCCAANONE 
J075115I09TGTTGGGCCAANONE 
J075132K23TGTTGGGCCAANONE 
J075147C17TGTTGGGCCAANONE 
J090059O20TGTTGGGCCAANONE 
Os03g0270700AK119531TGGTGGGCCAANONE 
Os03g0279200009-097-C06TTGGCCCATCCNONE 
013-007-B07TTGGCCCATCCNONE 
AK121750TTGGCCCATCCSimilar to Histone H2A. 
J033087I02TTGGCCCATCCNONE 
J065002G20TTGGCCCATCCNONE 
J065102M04TTGGCCCATCCNONE 
J065139A02TTGGCCCATCCNONE 
J075109D21TTGGCCCATCCNONE 
J075191L12TTGGCCCATCCNONE 
J090096C03TTGGCCCATCCNONE 
J100036C23TTGGCCCATCCNONE 
Os03g0288400Os03g0288400GAGGCCCATTGGCCCAATAConserved hypothetical protein. 
Os03g0292800012-077-B05ATCTGGGCCAANONE 
AK069970ATCTGGGCCAASimilar to Ran binding protein 1 homolog. 
J065138F22ATCTGGGCCAANONE 
Os03g0294200AK069285TTGGCCCATTSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0295500009-083-F02TTGGCCCATATAAGGCCCAACTNONE 
J053029J05TTGGCCCATATAAGGCCCAACTNONE 
J053054B07TTGGCCCATATAAGGCCCAACTCHCH domain containing protein. 
J065024G23TTGGCCCATATAAGGCCCAACTNONE 
J065036F08TTGGCCCATATAAGGCCCAACTNONE 
J065066M11TTGGCCCATATAAGGCCCAACTNONE 
J065143G19TTGGCCCATATAAGGCCCAACTNONE 
Os03g0300700AK071770TTGGCCCAGCRetrotransposon gag protein family protein. 
J023112P05TTGGCCCAGCNONE 
Os03g0310600AK109731TCTGGGCCAAProtein of unknown function DUF247, plant family protein. 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0333000AK109811TATGGGCTGGGCCAAConserved hypothetical protein. 
J065152D04TATGGGCTGGGCCAANONE 
J090011B05TATGGGCTGGGCCAANONE 
Os03g0333100AK101050TTGGCCCAGCCCATAProtein of unknown function DUF663 domain containing protein. 
Os03g0341100009-012-D06TTGGCCCAACCNONE 
AK121580TTGGCCCAACCSimilar to 60S ribosomal protein L18. 
J033037B18TTGGCCCAACCNONE 
J053090K21TTGGCCCAACCNONE 
J065040D12TTGGCCCAACCNONE 
J075106P15TTGGCCCAACCNONE 
J075117P13TTGGCCCAACCNONE 
J075128N02TTGGCCCAACCNONE 
J090031L12TTGGCCCAACCNONE 
J100023E19TTGGCCCAACCNONE 
J100033O21TTGGCCCAACCNONE 
J100070A12TTGGCCCAACCNONE 
J100087M20TTGGCCCAACCNONE 
Os03g0381000AK069332AATGGGCCAASimilar to Aldose 1-epimerase-like protein. 
J023010L17AATGGGCCAANONE 
Os03g0395000AK073283TTGGCCCATCASimilar to Heme oxygenase 2 (Fragment). 
Os03g0626250J075100A11TTGGCCCATCANONE 
J075134H15TTGGCCCATCANONE 
J075142J02TTGGCCCATCANONE 
J075181A14TTGGCCCATCANONE 
J075192K17TTGGCCCATCANONE 
J090046B06TTGGCCCATCANONE 
Os03g0646300AK069229TTGGCCCAAAASimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0683700AK065067AGATGGGCCAAProtein of unknown function DUF810 family protein. 
Os03g0701100014-015-E11AACTGGGCCAANONE 
AK109455AACTGGGCCAANONE 
AK110740AACTGGGCCAANONE 
Os03g0725300011-085-E09GTATGGGCCAANONE 
AK063969GTATGGGCCAASimilar to Dbr1-prov protein. 
AK073636GTATGGGCCAANONE 
J033050L15GTATGGGCCAANONE 
J053082G03GTATGGGCCAANONE 
Os03g0725400015-060-D03TTGGCCCACTNONE 
AK105499TTGGCCCACTSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860TTGGCCCACTNONE 
AK112085TTGGCCCACTNONE 
J100068K06TTGGCCCACTNONE 
J100073K24TTGGCCCACTNONE 
J100084M24TTGGCCCACTNONE 
Os03g0740700011-093-H12TATTGGGCCAANONE 
AK102723TATTGGGCCAAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19TATTGGGCCAANONE 
J013126N16TATTGGGCCAANONE 
J033105J16TATTGGGCCAANONE 
J090059D19TATTGGGCCAANONE 
Os03g0746400AK063445TTGGCCCATATProtein prenyltransferase domain containing protein. 
AK070923TTGGCCCATATNONE 
J065008K24TTGGCCCATATNONE 
Os03g0758700AK106620TACTGGGCCAAWD40-like domain containing protein. 
Os03g0784000AK067337TTATGGGCCAANONE 
AK100003TTATGGGCCAAFAD dependent oxidoreductase family protein. 
J013102O14TTATGGGCCAANONE 
J013135F18TTATGGGCCAANONE 
Os03g0809700J023093B03AAATGGGCCAANONE 
Os03g0824500AK058990TTGGCCCACCAConserved hypothetical protein. 
J065057L18TTGGCCCACCANONE 
J065083L02TTGGCCCACCANONE 
J065086L24TTGGCCCACCANONE 
J065121L10TTGGCCCACCANONE 
J065168N03TTGGCCCACCANONE 
J100035J22TTGGCCCACCANONE 
J100050G18TTGGCCCACCANONE 
J100055F15TTGGCCCACCANONE 
Os03g0828100009-088-D04AAATGGGCCAANONE 
009-125-F01AAATGGGCCAANONE 
009-169-C06AAATGGGCCAANONE 
AK059132AAATGGGCCAANONE 
AK062799AAATGGGCCAANONE 
AK099043AAATGGGCCAASimilar to 50S ribosomal protein L18. 
J013146D01AAATGGGCCAANONE 
J065057J16AAATGGGCCAANONE 
Os03g0834000AB080084AATGGGCCAAFlap endonuclease-1b (EC 3.-.-.-) (OsFEN-1b). 
AB088391AATGGGCCAANONE 
AK062149AATGGGCCAANONE 
AK069540AATGGGCCAANONE 
J013047J01AATGGGCCAANONE 
J023019F12AATGGGCCAANONE 
J043004H21AATGGGCCAANONE 
Os03g0837300AK111243TTGGCCCATCANONE 
AK121140TTGGCCCATCANicotinate phosphoribosyltransferase and related family protein. 
AY214337TTGGCCCATCANONE 
J023077G12TTGGCCCATCANONE 
J023078M10TTGGCCCATCANONE 
J033031B10TTGGCCCATCANONE 
J033067L18TTGGCCCATCANONE 
J043005P09TTGGCCCATCANONE 
J090013J15TTGGCCCATCANONE 
J090042E10TTGGCCCATCANONE 
J090045A20TTGGCCCATCANONE 
J100022H02TTGGCCCATCANONE 
Os03g0843400009-195-F11CCTGGGCCAANONE 
009-195-F11TTGGCCCACTNONE 
AK061198CCTGGGCCAASimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK061198TTGGCCCACTSimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076CCTGGGCCAANONE 
AK099076TTGGCCCACTNONE 
Os03g0844600AK059168TTGGCCCATTTLipolytic enzyme, G-D-S-L family protein. 
Os03g0850100AK101126ATTGGGCCTTAATGGGCCAANLI interacting factor domain containing protein. 
Os03g0852600009-174-G04TTGGCCCATTANONE 
AK063101TTGGCCCATTAProtein of unknown function DUF565 family protein. 
J065131H12TTGGCCCATTANONE 
J090046K24TTGGCCCATTANONE 
Os04g0129300AK109511AACTGGGCCAAYT521-B-like protein family protein. 
Os04g0208500015-079-C10TTGGCCCAACCNONE 
AK106410TTGGCCCAACCCyclin-like F-box domain containing protein. 
Os04g0473400AK067896AAATGGGCCAASimilar to 60S ribosomal protein L6-B (L17) (YL16) (RP18). 
J013123D20AAATGGGCCAANONE 
J033108A09AAATGGGCCAANONE 
J065196E24AAATGGGCCAANONE 
J100066B16AAATGGGCCAANONE 
Os04g0504200AK110863TGTTGGGCCAAConserved hypothetical protein. 
Os04g0509500AK107601TTGGCCCAAACSimilar to Ammonium transporter Amt1;1 (Fragment). 
Os04g0520900AK068793TGTTGGGCCAAProtein prenyltransferase domain containing protein. 
AK105606TGTTGGGCCAANONE 
Os04g0539000009-165-H09TTGGCCCAGANONE 
014-012-F10TTGGCCCAGANONE 
AK105343TTGGCCCAGALambda integrase-like, N-terminal domain containing protein. 
Os04g0551300AK103502TGATGGGCCAASimilar to Growth regulator like protein. 
Os04g0573900AK101618GGATGGGCCAAGCCCATGTSimilar to Cytochrome P450-like protein. 
AK103182GGATGGGCCAAGCCCATGTNONE 
AK119612GGATGGGCCAAGCCCATGTNONE 
AK120901GGATGGGCCAAGCCCATGTNONE 
Os04g0592500AK066893TAATGGGCCAAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18TAATGGGCCAANONE 
Os04g0595000AK106907TTGGCCCAAGPeptidase A1, pepsin family protein. 
Os04g0610500006-115-C07AGTGGGCCAANONE 
AK066289AGTGGGCCAAPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817AGTGGGCCAANONE 
J013096N09AGTGGGCCAANONE 
J023054I11AGTGGGCCAANONE 
J023121P20AGTGGGCCAANONE 
J053039O20AGTGGGCCAANONE 
J053071L20AGTGGGCCAANONE 
J053088H23AGTGGGCCAANONE 
J053096J03AGTGGGCCAANONE 
Os04g0611300009-006-G08TTGGCCCATCCANONE 
009-011-C01TTGGCCCATCCANONE 
009-036-B09TTGGCCCATCCANONE 
009-116-G09TTGGCCCATCCANONE 
009-126-E09TTGGCCCATCCANONE 
009-132-F09TTGGCCCATCCANONE 
009-151-G07TTGGCCCATCCANONE 
009-155-C07TTGGCCCATCCANONE 
009-163-G01TTGGCCCATCCANONE 
009-169-G08TTGGCCCATCCANONE 
009-191-B02TTGGCCCATCCANONE 
009-196-A08TTGGCCCATCCANONE 
009-198-E07TTGGCCCATCCANONE 
014-015-F04TTGGCCCATCCANONE 
015-087-H04TTGGCCCATCCANONE 
AK062605TTGGCCCATCCANONE 
AK063022TTGGCCCATCCAConserved hypothetical protein. 
AK066749TTGGCCCATCCANONE 
AK104924TTGGCCCATCCANONE 
J065002M20TTGGCCCATCCANONE 
J065045L23TTGGCCCATCCANONE 
J065101E05TTGGCCCATCCANONE 
J065140J23TTGGCCCATCCANONE 
J065179G11TTGGCCCATCCANONE 
J065191B18TTGGCCCATCCANONE 
J065192E03TTGGCCCATCCANONE 
J065199H21TTGGCCCATCCANONE 
J075067F01TTGGCCCATCCANONE 
J075089L01TTGGCCCATCCANONE 
J075147K22TTGGCCCATCCANONE 
J080069G23TTGGCCCATCCANONE 
J100053D10TTGGCCCATCCANONE 
J100078C10TTGGCCCATCCANONE 
Os04g0612600AB042115TTGGCCCAATNONE 
AB042115TTGGCCCACTNONE 
AK060707TTGGCCCAATSimilar to Coatomer-like protein, epsilon subunit. 
AK060707TTGGCCCACTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008TTGGCCCAATNONE 
AK099008TTGGCCCACTNONE 
AK104427TTGGCCCAATNONE 
AK104427TTGGCCCACTNONE 
J023043H02TTGGCCCAATNONE 
J023043H02TTGGCCCACTNONE 
J033033I23TTGGCCCAATNONE 
J033033I23TTGGCCCACTNONE 
J033067P21TTGGCCCAATNONE 
J033067P21TTGGCCCACTNONE 
J033088M21TTGGCCCAATNONE 
J033088M21TTGGCCCACTNONE 
J033133M08TTGGCCCAATNONE 
J033133M08TTGGCCCACTNONE 
J043030I16TTGGCCCAATNONE 
J043030I16TTGGCCCACTNONE 
J075049H08TTGGCCCAATNONE 
J075049H08TTGGCCCACTNONE 
Os04g0654700006-097-D06CAAGTGGGCCAANONE 
013-016-H01CAAGTGGGCCAANONE 
AB055495CAAGTGGGCCAANONE 
AF072849CAAGTGGGCCAANONE 
AK062107CAAGTGGGCCAANONE 
AK099088CAAGTGGGCCAASimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16CAAGTGGGCCAANONE 
J013038J23CAAGTGGGCCAANONE 
J013038L17CAAGTGGGCCAANONE 
J013038N18CAAGTGGGCCAANONE 
J013038O18CAAGTGGGCCAANONE 
J013124A09CAAGTGGGCCAANONE 
J023007N04CAAGTGGGCCAANONE 
J033023C02CAAGTGGGCCAANONE 
J033030M18CAAGTGGGCCAANONE 
J033068I09CAAGTGGGCCAANONE 
J033100E04CAAGTGGGCCAANONE 
J065153E19CAAGTGGGCCAANONE 
J065207I02CAAGTGGGCCAANONE 
J075007A07CAAGTGGGCCAANONE 
J075036M04CAAGTGGGCCAANONE 
J075147I03CAAGTGGGCCAANONE 
J075197L11CAAGTGGGCCAANONE 
Os04g0661900006-090-F11GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J053077D04GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J090095N01GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J100039F24GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0673400Os04g0673400TCTGGGCCAASimilar to Uracil-DNA glycosylase (EC 3.2.2.-) (UDG). 
Os04g0683900004-009-A11GTTGGGCCAANONE 
014-076-H12GTTGGGCCAANONE 
AK060880GTTGGGCCAANONE 
AK099749GTTGGGCCAAHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309GTTGGGCCAANONE 
J013050K21GTTGGGCCAANONE 
J013092E09GTTGGGCCAANONE 
J013095N06GTTGGGCCAANONE 
J013095P07GTTGGGCCAANONE 
J013130D22GTTGGGCCAANONE 
J013134O15GTTGGGCCAANONE 
J023022I06GTTGGGCCAANONE 
J023062L11GTTGGGCCAANONE 
J023078J11GTTGGGCCAANONE 
J023086J01GTTGGGCCAANONE 
J033125A20GTTGGGCCAANONE 
J065023K13GTTGGGCCAANONE 
J065045N02GTTGGGCCAANONE 
J065129F01GTTGGGCCAANONE 
J065164H14GTTGGGCCAANONE 
J065192H09GTTGGGCCAANONE 
J075064P15GTTGGGCCAANONE 
J075088G17GTTGGGCCAANONE 
J075199D20GTTGGGCCAANONE 
Os04g0686600AK068427CTTGGGCCAAProtein kinase domain containing protein. 
J013155F22CTTGGGCCAANONE 
J023020E07CTTGGGCCAANONE 
Os05g0110100009-015-D08AATTGGGCCAANONE 
009-023-C09AATTGGGCCAANONE 
009-031-B11AATTGGGCCAANONE 
009-034-C02AATTGGGCCAANONE 
009-050-B08AATTGGGCCAANONE 
009-065-D12AATTGGGCCAANONE 
009-090-G08AATTGGGCCAANONE 
009-111-H07AATTGGGCCAANONE 
009-136-F12AATTGGGCCAANONE 
009-138-E06AATTGGGCCAANONE 
009-138-G12AATTGGGCCAANONE 
009-141-D08AATTGGGCCAANONE 
009-143-D01AATTGGGCCAANONE 
009-179-D09AATTGGGCCAANONE 
009-179-E03AATTGGGCCAANONE 
009-196-A09AATTGGGCCAANONE 
009-199-F04AATTGGGCCAANONE 
013-021-E05AATTGGGCCAANONE 
013-076-C04AATTGGGCCAANONE 
013-096-F06AATTGGGCCAANONE 
014-071-A05AATTGGGCCAANONE 
014-077-F09AATTGGGCCAANONE 
AK099779AATTGGGCCAANONE 
AK121142AATTGGGCCAAConserved hypothetical protein. 
J013095A16AATTGGGCCAANONE 
J013111A17AATTGGGCCAANONE 
J013132G04AATTGGGCCAANONE 
J023077M04AATTGGGCCAANONE 
J065001B11AATTGGGCCAANONE 
J065001E11AATTGGGCCAANONE 
J065057G10AATTGGGCCAANONE 
J065057L08AATTGGGCCAANONE 
J065080E07AATTGGGCCAANONE 
J065087K10AATTGGGCCAANONE 
J065091M15AATTGGGCCAANONE 
J065167A15AATTGGGCCAANONE 
J075018F02AATTGGGCCAANONE 
J075063F20AATTGGGCCAANONE 
J075064F18AATTGGGCCAANONE 
J075066N19AATTGGGCCAANONE 
J075073I02AATTGGGCCAANONE 
J075080P17AATTGGGCCAANONE 
J075081F11AATTGGGCCAANONE 
J075085E03AATTGGGCCAANONE 
J075101G18AATTGGGCCAANONE 
J075149N08AATTGGGCCAANONE 
J075158I21AATTGGGCCAANONE 
J075161M20AATTGGGCCAANONE 
J075190F12AATTGGGCCAANONE 
J075194K16AATTGGGCCAANONE 
J080001E08AATTGGGCCAANONE 
J080001F21AATTGGGCCAANONE 
J080001H19AATTGGGCCAANONE 
J080001O15AATTGGGCCAANONE 
J080005I22AATTGGGCCAANONE 
J080006K23AATTGGGCCAANONE 
J080014D20AATTGGGCCAANONE 
J080014I05AATTGGGCCAANONE 
J080014K21AATTGGGCCAANONE 
J080017I24AATTGGGCCAANONE 
J080017K11AATTGGGCCAANONE 
J080018F11AATTGGGCCAANONE 
J080022L18AATTGGGCCAANONE 
J080024N23AATTGGGCCAANONE 
J080027J23AATTGGGCCAANONE 
J080029B14AATTGGGCCAANONE 
J080032F14AATTGGGCCAANONE 
J080032K19AATTGGGCCAANONE 
J080032O21AATTGGGCCAANONE 
J080033P17AATTGGGCCAANONE 
J080034I06AATTGGGCCAANONE 
J080039F24AATTGGGCCAANONE 
J080040O13AATTGGGCCAANONE 
J080042B02AATTGGGCCAANONE 
J080043E12AATTGGGCCAANONE 
J080043J15AATTGGGCCAANONE 
J080043N09AATTGGGCCAANONE 
J080052J08AATTGGGCCAANONE 
J080053K01AATTGGGCCAANONE 
J080053K19AATTGGGCCAANONE 
J080055J09AATTGGGCCAANONE 
J080058D07AATTGGGCCAANONE 
J080062F11AATTGGGCCAANONE 
J080063J24AATTGGGCCAANONE 
J080066H04AATTGGGCCAANONE 
J080066I09AATTGGGCCAANONE 
J080067B02AATTGGGCCAANONE 
J080067N09AATTGGGCCAANONE 
J080068D22AATTGGGCCAANONE 
J080068K13AATTGGGCCAANONE 
J080069N19AATTGGGCCAANONE 
J080070D07AATTGGGCCAANONE 
J080070E05AATTGGGCCAANONE 
J080071G04AATTGGGCCAANONE 
J080077G05AATTGGGCCAANONE 
J080077O06AATTGGGCCAANONE 
J080085F05AATTGGGCCAANONE 
J080086E07AATTGGGCCAANONE 
J080089G16AATTGGGCCAANONE 
J080092K15AATTGGGCCAANONE 
J080094A08AATTGGGCCAANONE 
J080097A09AATTGGGCCAANONE 
J080097J07AATTGGGCCAANONE 
J090027N01AATTGGGCCAANONE 
J090081J05AATTGGGCCAANONE 
Os05g0116100006-049-G01TTGGCCCATGGGCCGCCACGTCNONE 
006-064-F09TTGGCCCATGGGCCGCCACGTCNONE 
006-082-A03TTGGCCCATGGGCCGCCACGTCNONE 
006-092-G06TTGGCCCATGGGCCGCCACGTCNONE 
006-102-F09TTGGCCCATGGGCCGCCACGTCNONE 
AB037970TTGGCCCATGGGCCGCCACGTCNONE 
AK061836TTGGCCCATGGGCCGCCACGTCNONE 
AK070895TTGGCCCATGGGCCGCCACGTCDehydroascorbate reductase. 
AY074786TTGGCCCATGGGCCGCCACGTCNONE 
J013022K21TTGGCCCATGGGCCGCCACGTCNONE 
J013154A03TTGGCCCATGGGCCGCCACGTCNONE 
J023074C02TTGGCCCATGGGCCGCCACGTCNONE 
J023091I19TTGGCCCATGGGCCGCCACGTCNONE 
J023135M05TTGGCCCATGGGCCGCCACGTCNONE 
J065027L11TTGGCCCATGGGCCGCCACGTCNONE 
J065065A08TTGGCCCATGGGCCGCCACGTCNONE 
J065120A08TTGGCCCATGGGCCGCCACGTCNONE 
J065174A05TTGGCCCATGGGCCGCCACGTCNONE 
J065184O22TTGGCCCATGGGCCGCCACGTCNONE 
J065191D07TTGGCCCATGGGCCGCCACGTCNONE 
J065209D04TTGGCCCATGGGCCGCCACGTCNONE 
J075014F11TTGGCCCATGGGCCGCCACGTCNONE 
J075036D03TTGGCCCATGGGCCGCCACGTCNONE 
J075157D23TTGGCCCATGGGCCGCCACGTCNONE 
J080007F15TTGGCCCATGGGCCGCCACGTCNONE 
J080008N12TTGGCCCATGGGCCGCCACGTCNONE 
J080010F22TTGGCCCATGGGCCGCCACGTCNONE 
J080011C19TTGGCCCATGGGCCGCCACGTCNONE 
J080011F12TTGGCCCATGGGCCGCCACGTCNONE 
J080012E11TTGGCCCATGGGCCGCCACGTCNONE 
J080015B12TTGGCCCATGGGCCGCCACGTCNONE 
J080015O16TTGGCCCATGGGCCGCCACGTCNONE 
J080016G24TTGGCCCATGGGCCGCCACGTCNONE 
J080016K13TTGGCCCATGGGCCGCCACGTCNONE 
J080018A02TTGGCCCATGGGCCGCCACGTCNONE 
J080018H03TTGGCCCATGGGCCGCCACGTCNONE 
J080022M01TTGGCCCATGGGCCGCCACGTCNONE 
J080023D20TTGGCCCATGGGCCGCCACGTCNONE 
J080023I01TTGGCCCATGGGCCGCCACGTCNONE 
J080023J05TTGGCCCATGGGCCGCCACGTCNONE 
J080024A09TTGGCCCATGGGCCGCCACGTCNONE 
J080024I09TTGGCCCATGGGCCGCCACGTCNONE 
J080025A10TTGGCCCATGGGCCGCCACGTCNONE 
J080025G04TTGGCCCATGGGCCGCCACGTCNONE 
J080027D21TTGGCCCATGGGCCGCCACGTCNONE 
J080029M05TTGGCCCATGGGCCGCCACGTCNONE 
J080030J01TTGGCCCATGGGCCGCCACGTCNONE 
J080034D10TTGGCCCATGGGCCGCCACGTCNONE 
J080036F18TTGGCCCATGGGCCGCCACGTCNONE 
J080038N11TTGGCCCATGGGCCGCCACGTCNONE 
J080039B07TTGGCCCATGGGCCGCCACGTCNONE 
J080039E01TTGGCCCATGGGCCGCCACGTCNONE 
J080039K11TTGGCCCATGGGCCGCCACGTCNONE 
J080040B09TTGGCCCATGGGCCGCCACGTCNONE 
J080040G11TTGGCCCATGGGCCGCCACGTCNONE 
J080041H08TTGGCCCATGGGCCGCCACGTCNONE 
J080041H19TTGGCCCATGGGCCGCCACGTCNONE 
J080041O20TTGGCCCATGGGCCGCCACGTCNONE 
J080042C15TTGGCCCATGGGCCGCCACGTCNONE 
J080043C16TTGGCCCATGGGCCGCCACGTCNONE 
J080043F18TTGGCCCATGGGCCGCCACGTCNONE 
J080044B17TTGGCCCATGGGCCGCCACGTCNONE 
J080044N10TTGGCCCATGGGCCGCCACGTCNONE 
J080044O07TTGGCCCATGGGCCGCCACGTCNONE 
J080045H15TTGGCCCATGGGCCGCCACGTCNONE 
J080045I03TTGGCCCATGGGCCGCCACGTCNONE 
J080046A05TTGGCCCATGGGCCGCCACGTCNONE 
J080048I06TTGGCCCATGGGCCGCCACGTCNONE 
J080049L04TTGGCCCATGGGCCGCCACGTCNONE 
J080049M09TTGGCCCATGGGCCGCCACGTCNONE 
J080050G11TTGGCCCATGGGCCGCCACGTCNONE 
J080051G20TTGGCCCATGGGCCGCCACGTCNONE 
J080053C09TTGGCCCATGGGCCGCCACGTCNONE 
J080053I05TTGGCCCATGGGCCGCCACGTCNONE 
J080053P18TTGGCCCATGGGCCGCCACGTCNONE 
J080054K10TTGGCCCATGGGCCGCCACGTCNONE 
J080054P14TTGGCCCATGGGCCGCCACGTCNONE 
J080057L05TTGGCCCATGGGCCGCCACGTCNONE 
J080062K11TTGGCCCATGGGCCGCCACGTCNONE 
J080063C19TTGGCCCATGGGCCGCCACGTCNONE 
J080065B03TTGGCCCATGGGCCGCCACGTCNONE 
J080066E15TTGGCCCATGGGCCGCCACGTCNONE 
J080066H05TTGGCCCATGGGCCGCCACGTCNONE 
J080066I05TTGGCCCATGGGCCGCCACGTCNONE 
J080068O11TTGGCCCATGGGCCGCCACGTCNONE 
J080070L22TTGGCCCATGGGCCGCCACGTCNONE 
J080071I12TTGGCCCATGGGCCGCCACGTCNONE 
J080071N20TTGGCCCATGGGCCGCCACGTCNONE 
J080072D10TTGGCCCATGGGCCGCCACGTCNONE 
J080072I10TTGGCCCATGGGCCGCCACGTCNONE 
J080074G03TTGGCCCATGGGCCGCCACGTCNONE 
J080076E23TTGGCCCATGGGCCGCCACGTCNONE 
J080076N03TTGGCCCATGGGCCGCCACGTCNONE 
J080077N23TTGGCCCATGGGCCGCCACGTCNONE 
J080084B13TTGGCCCATGGGCCGCCACGTCNONE 
J080084F07TTGGCCCATGGGCCGCCACGTCNONE 
J080085J15TTGGCCCATGGGCCGCCACGTCNONE 
J080085P20TTGGCCCATGGGCCGCCACGTCNONE 
J080090F21TTGGCCCATGGGCCGCCACGTCNONE 
J080093H16TTGGCCCATGGGCCGCCACGTCNONE 
J080093J01TTGGCCCATGGGCCGCCACGTCNONE 
J080093L04TTGGCCCATGGGCCGCCACGTCNONE 
J080097E24TTGGCCCATGGGCCGCCACGTCNONE 
J090012G04TTGGCCCATGGGCCGCCACGTCNONE 
J090054K05TTGGCCCATGGGCCGCCACGTCNONE 
Os05g0152400Os05g0152400AGTTGGGCCAAGlycosyl transferase, family 14 protein. 
Os05g0161400AK105485TGATGGGCCAAPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0168400006-039-A06AATTGGGCCAANONE 
006-039-A06TAATGGGCCAANONE 
AK069800AATTGGGCCAANONE 
AK069800TAATGGGCCAANONE 
AK106195AATTGGGCCAAConserved hypothetical protein. 
AK106195TAATGGGCCAAConserved hypothetical protein. 
J065086N09AATTGGGCCAANONE 
J065086N09TAATGGGCCAANONE 
J065137B10AATTGGGCCAANONE 
J065137B10TAATGGGCCAANONE 
J075062B04AATTGGGCCAANONE 
J075062B04TAATGGGCCAANONE 
J075193I07AATTGGGCCAANONE 
J075193I07TAATGGGCCAANONE 
J075193K24AATTGGGCCAANONE 
J075193K24TAATGGGCCAANONE 
J075194D10AATTGGGCCAANONE 
J075194D10TAATGGGCCAANONE 
J100037F01AATTGGGCCAANONE 
J100037F01TAATGGGCCAANONE 
J100071E09AATTGGGCCAANONE 
J100071E09TAATGGGCCAANONE 
Os05g0182800AK121273TAATGGGCCAAGTGGCCCAATGlutamyl-tRNA synthetase, class Ic family protein. 
Os05g0193800AK058865TTGGCCCAGCNONE 
AK067940TTGGCCCAGCConserved hypothetical protein. 
J065043K19TTGGCCCAGCNONE 
J065095O10TTGGCCCAGCNONE 
J065095O12TTGGCCCAGCNONE 
J080002K02TTGGCCCAGCNONE 
J080012L17TTGGCCCAGCNONE 
J080013J02TTGGCCCAGCNONE 
J080013O11TTGGCCCAGCNONE 
J080020A17TTGGCCCAGCNONE 
J080028E18TTGGCCCAGCNONE 
J080036P11TTGGCCCAGCNONE 
J080042E10TTGGCCCAGCNONE 
J080042L10TTGGCCCAGCNONE 
J080047B11TTGGCCCAGCNONE 
J080048N05TTGGCCCAGCNONE 
J080057E20TTGGCCCAGCNONE 
J080057K13TTGGCCCAGCNONE 
J080058L03TTGGCCCAGCNONE 
J080063H07TTGGCCCAGCNONE 
J080066L23TTGGCCCAGCNONE 
J080069G22TTGGCCCAGCNONE 
J080072E12TTGGCCCAGCNONE 
J080076D06TTGGCCCAGCNONE 
J080077A22TTGGCCCAGCNONE 
J080081A01TTGGCCCAGCNONE 
J080090M13TTGGCCCAGCNONE 
J080093G07TTGGCCCAGCNONE 
J080094O20TTGGCCCAGCNONE 
J080097F13TTGGCCCAGCNONE 
Os05g0378900AK103841TTGGCCCATTConserved hypothetical protein. 
J033148I18TTGGCCCATTNONE 
J065085F12TTGGCCCATTNONE 
J075041H24TTGGCCCATTNONE 
J075180P06TTGGCCCATTNONE 
Os05g0391500AK119412TTGGCCCACTCCSimilar to Endo-beta-mannosidase. 
Os05g0455500AK101985TCTGGGCCAANONE 
AK102633TCTGGGCCAADelta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AY574031TCTGGGCCAANONE 
D49714TCTGGGCCAANONE 
J013002F07TCTGGGCCAANONE 
J033085C02TCTGGGCCAANONE 
Os05g0528200009-146-C01TTGGCCCATGANONE 
AK062985TTGGCCCATGASimilar to 50S ribosomal protein L20. 
Os05g0541900009-130-F05ACATGGGCCAANONE 
009-200-E07ACATGGGCCAANONE 
013-057-G09ACATGGGCCAANONE 
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0554100AK073023TCTGGGCCAARibosomal protein L7/L12 family protein. 
AK101756TCTGGGCCAANONE 
Os05g0571300AK072262TTGGCCCATCTGGCCCATAConserved hypothetical protein. 
AK109853TTGGCCCATCTGGCCCATANONE 
AK111014TTGGCCCATCTGGCCCATANONE 
Os05g0578600AK108477TTGGCCCAATASimilar to Polygalacturonase PG2. 
Os05g0580500AK102000TTGGCCCATGANONE 
AY371049TTGGCCCATGARad21/Rec8 like protein, N-terminal domain containing protein. 
Os05g0588200AK109323TTGGCCCATAARuvA domain 2-like containing protein. 
AK109323TTGGCCCATTTRuvA domain 2-like containing protein. 
Os05g0589000AK061980AACTGGGCCAANONE 
AK099181AACTGGGCCAAConserved hypothetical protein. 
Os06g0125200015-099-F09TTGGCCCAGGGCCGTCNONE 
AK102200TTGGCCCAGGGCCGTCProtein of unknown function DUF581 family protein. 
J033030E04TTGGCCCAGGGCCGTCNONE 
J033058K06TTGGCCCAGGGCCGTCNONE 
J033060O13TTGGCCCAGGGCCGTCNONE 
J033068B04TTGGCCCAGGGCCGTCNONE 
J033087E11TTGGCCCAGGGCCGTCNONE 
J033113N12TTGGCCCAGGGCCGTCNONE 
J065110P15TTGGCCCAGGGCCGTCNONE 
J075174B01TTGGCCCAGGGCCGTCNONE 
Os06g0134000AK102796AGGTGGGCCAANONE 
Os06g0134900AK103205GGATGGGCTGTGTTGGGCCAAGCCCAGConserved hypothetical protein. 
J033122E01GGATGGGCTGTGTTGGGCCAAGCCCAGNONE 
Os06g0135000J075008J15CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075166F23CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075185F03CTGGGCTTGGCCCAACACAGCCCATCCNONE 
Os06g0139700006-052-C07CCATGGGCCAAGGCCCATTNONE 
009-009-A08CCATGGGCCAAGGCCCATTNONE 
015-020-D09CCATGGGCCAAGGCCCATTNONE 
015-087-H06CCATGGGCCAAGGCCCATTNONE 
016-078-A03CCATGGGCCAAGGCCCATTNONE 
AK067884CCATGGGCCAAGGCCCATTNONE 
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein. 
AK106116CCATGGGCCAAGGCCCATTNONE 
AK106220CCATGGGCCAAGGCCCATTNONE 
Os06g0220800AK059876GTATGGGCCAANONE 
AY739306GTATGGGCCAAThioredoxin domain 2 containing protein. 
J075093C09GTATGGGCCAANONE 
J100026J18GTATGGGCCAANONE 
J100041O16GTATGGGCCAANONE 
J100089K16GTATGGGCCAANONE 
Os06g0226600006-083-D04TTGGCCCAGCNONE 
AK061806TTGGCCCAGCNONE 
AK102752TTGGCCCAGCTB2/DP1 and HVA22 related protein family protein. 
J013089J11TTGGCCCAGCNONE 
J033106M05TTGGCCCAGCNONE 
J100044M21TTGGCCCAGCNONE 
J100056E06TTGGCCCAGCNONE 
J100059F06TTGGCCCAGCNONE 
Os06g0248200Os06g0248200TCGTGGGCCAANONE 
Os06g0251000J033111L12AGTGGGCCAANONE 
J043001C08AGTGGGCCAAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0291100J043017O10TTGGCCCAATHypothetical protein. 
Os06g0316100011-089-C01TTGGCCCATGNONE 
015-030-D11TTGGCCCATGNONE 
015-044-H10TTGGCCCATGNONE 
AK105260TTGGCCCATGConserved hypothetical protein. 
AK119646TTGGCCCATGNONE 
Os06g0320500004-013-F05TTGGCCCAGCNONE 
006-021-B06TTGGCCCAGCNONE 
006-021-D12TTGGCCCAGCNONE 
006-022-A12TTGGCCCAGCNONE 
006-024-B10TTGGCCCAGCNONE 
006-029-F07TTGGCCCAGCNONE 
006-029-H12TTGGCCCAGCNONE 
006-031-A05TTGGCCCAGCNONE 
006-033-C03TTGGCCCAGCNONE 
006-036-B12TTGGCCCAGCNONE 
006-048-C08TTGGCCCAGCNONE 
006-050-F03TTGGCCCAGCNONE 
006-051-C12TTGGCCCAGCNONE 
006-054-C03TTGGCCCAGCNONE 
006-057-D12TTGGCCCAGCNONE 
006-067-F01TTGGCCCAGCNONE 
006-071-G12TTGGCCCAGCNONE 
006-072-G11TTGGCCCAGCNONE 
006-072-H01TTGGCCCAGCNONE 
006-081-E02TTGGCCCAGCNONE 
006-082-A11TTGGCCCAGCNONE 
006-084-A04TTGGCCCAGCNONE 
006-085-C08TTGGCCCAGCNONE 
006-086-D03TTGGCCCAGCNONE 
006-088-B05TTGGCCCAGCNONE 
006-088-G02TTGGCCCAGCNONE 
006-092-G10TTGGCCCAGCNONE 
006-094-D11TTGGCCCAGCNONE 
006-094-E04TTGGCCCAGCNONE 
006-103-G12TTGGCCCAGCNONE 
006-106-G08TTGGCCCAGCNONE 
006-111-E06TTGGCCCAGCNONE 
006-114-C07TTGGCCCAGCNONE 
006-115-A04TTGGCCCAGCNONE 
006-117-G11TTGGCCCAGCNONE 
006-118-G09TTGGCCCAGCNONE 
009-010-F03TTGGCCCAGCNONE 
009-076-G01TTGGCCCAGCNONE 
009-134-E10TTGGCCCAGCNONE 
009-193-D07TTGGCCCAGCNONE 
AF094776TTGGCCCAGCNONE 
AK060904TTGGCCCAGCSimilar to Light-harvesting complex I (Fragment). 
AK098864TTGGCCCAGCNONE 
J013001A03TTGGCCCAGCNONE 
J013098P14TTGGCCCAGCNONE 
J013127B16TTGGCCCAGCNONE 
J013169J24TTGGCCCAGCNONE 
J023084H23TTGGCCCAGCNONE 
J023093F05TTGGCCCAGCNONE 
J033041I05TTGGCCCAGCNONE 
J065196G15TTGGCCCAGCNONE 
J075019K01TTGGCCCAGCNONE 
J075053H16TTGGCCCAGCNONE 
J075055M09TTGGCCCAGCNONE 
J075099G10TTGGCCCAGCNONE 
J075099L23TTGGCCCAGCNONE 
J075127I09TTGGCCCAGCNONE 
J080001C14TTGGCCCAGCNONE 
J080016B11TTGGCCCAGCNONE 
J080029C14TTGGCCCAGCNONE 
J080029I17TTGGCCCAGCNONE 
J080034F13TTGGCCCAGCNONE 
J080039E02TTGGCCCAGCNONE 
J080040N05TTGGCCCAGCNONE 
J080042O17TTGGCCCAGCNONE 
J080043N15TTGGCCCAGCNONE 
J080056K02TTGGCCCAGCNONE 
J080063N15TTGGCCCAGCNONE 
J080069H05TTGGCCCAGCNONE 
J080070N15TTGGCCCAGCNONE 
J080075J22TTGGCCCAGCNONE 
J080076F12TTGGCCCAGCNONE 
J080086G05TTGGCCCAGCNONE 
J090046G07TTGGCCCAGCNONE 
J090059H01TTGGCCCAGCNONE 
J090099C09TTGGCCCAGCNONE 
J100028E12TTGGCCCAGCNONE 
J100048J04TTGGCCCAGCNONE 
J100054O05TTGGCCCAGCNONE 
J100062C09TTGGCCCAGCNONE 
J100075C17TTGGCCCAGCNONE 
J100075C23TTGGCCCAGCNONE 
J100075I23TTGGCCCAGCNONE 
Os06g0482200AK119703TTGGCCCAATAThioredoxin fold domain containing protein. 
J065014B11TTGGCCCAATANONE 
J065055E22TTGGCCCAATANONE 
J065092L13TTGGCCCAATANONE 
J065113E21TTGGCCCAATANONE 
J065191D11TTGGCCCAATANONE 
J065214F18TTGGCCCAATANONE 
J075104E18TTGGCCCAATANONE 
J075149O19TTGGCCCAATANONE 
J075170I11TTGGCCCAATANONE 
Os06g0539066J065210J16CTTGGGCCAAConserved hypothetical protein. 
Os06g0542300J100050D16TTGGCCCATCAHeavy metal transport/detoxification protein domain containing protein. 
J100052L04TTGGCCCATCANONE 
Os06g0549600AK073505ATTGGGCCAAFAD linked oxidase, N-terminal domain containing protein. 
J033046H14ATTGGGCCAANONE 
Os06g0555500016-056-B08TTGGCCCACTCTNONE 
AK102375TTGGCCCACTCTNONE 
AK106546TTGGCCCACTCTInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08TTGGCCCACTCTNONE 
J033091P04TTGGCCCACTCTNONE 
J090082P16TTGGCCCACTCTNONE 
Os06g0583500J013034M04TTGGCCCATGAGGCCCATANONE 
J013169I02TTGGCCCATGAGGCCCATANONE 
J023024B09TTGGCCCATGAGGCCCATANONE 
J023132L02TTGGCCCATGAGGCCCATANONE 
J033026C23TTGGCCCATGAGGCCCATANONE 
J033094E23TTGGCCCATGAGGCCCATANONE 
J033101D23TTGGCCCATGAGGCCCATANONE 
J033125B15TTGGCCCATGAGGCCCATANONE 
J033144I11TTGGCCCATGAGGCCCATANONE 
J033145E13TTGGCCCATGAGGCCCATANONE 
J033145I11TTGGCCCATGAGGCCCATANONE 
J065022M23TTGGCCCATGAGGCCCATANONE 
J065043I24TTGGCCCATGAGGCCCATANONE 
J065053G06TTGGCCCATGAGGCCCATANONE 
J065088K03TTGGCCCATGAGGCCCATANONE 
J065121L09TTGGCCCATGAGGCCCATANONE 
J065143M08TTGGCCCATGAGGCCCATANONE 
J065146H02TTGGCCCATGAGGCCCATANONE 
J065206M03TTGGCCCATGAGGCCCATANONE 
J075004L13TTGGCCCATGAGGCCCATANONE 
J075005L17TTGGCCCATGAGGCCCATANONE 
J075007G18TTGGCCCATGAGGCCCATANONE 
J075027E20TTGGCCCATGAGGCCCATANONE 
J075029A19TTGGCCCATGAGGCCCATANONE 
J075041C15TTGGCCCATGAGGCCCATANONE 
J075046M05TTGGCCCATGAGGCCCATANONE 
J075066P21TTGGCCCATGAGGCCCATANONE 
J075069E07TTGGCCCATGAGGCCCATANONE 
J075107P21TTGGCCCATGAGGCCCATANONE 
J075123F03TTGGCCCATGAGGCCCATANONE 
J075124E07TTGGCCCATGAGGCCCATANONE 
J075140J22TTGGCCCATGAGGCCCATANONE 
J075160N03TTGGCCCATGAGGCCCATANONE 
Os06g0590301J033139K16TTGGCCCAAGCCCAAGNONE 
J065011M13TTGGCCCAAGCCCAAGNONE 
J065027D20TTGGCCCAAGCCCAAGNONE 
J065039O05TTGGCCCAAGCCCAAGGlucose/ribitol dehydrogenase family protein. 
J065051O10TTGGCCCAAGCCCAAGNONE 
J065128I21TTGGCCCAAGCCCAAGNONE 
J065163P10TTGGCCCAAGCCCAAGNONE 
J065169H02TTGGCCCAAGCCCAAGNONE 
Os06g0607800012-010-G03AAATGGGCCAANONE 
AB070254AAATGGGCCAANONE 
AK063158AAATGGGCCAASimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695AAATGGGCCAANONE 
J013074G13AAATGGGCCAANONE 
J090015C16AAATGGGCCAANONE 
J090069H10AAATGGGCCAANONE 
Os06g0608500AK060097CCAGCCCATCTTGGCCCACCNONE 
AK070667CCAGCCCATCTTGGCCCACCSnf7 family protein. 
Os06g0666800AK103209CCAAGCCCACATGGGCCAANONE 
AK107710CCAAGCCCACATGGGCCAAConserved hypothetical protein. 
Os06g0683200AK060024CAAGTGGGCCAASimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432CAAGTGGGCCAANONE 
J023002B12CAAGTGGGCCAANONE 
J023054E10CAAGTGGGCCAANONE 
J023123F19CAAGTGGGCCAANONE 
J065035K13CAAGTGGGCCAANONE 
J065129P09CAAGTGGGCCAANONE 
J065184B14CAAGTGGGCCAANONE 
Os06g0688100AK063450TTGGCCCAACTNONE 
AK101144TTGGCCCAACTRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0701400013-010-G06GGCTGGGCCAANONE 
AK121229GGCTGGGCCAASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16GGCTGGGCCAANONE 
J033023L12GGCTGGGCCAANONE 
J065043I07GGCTGGGCCAANONE 
J065049E09GGCTGGGCCAANONE 
J065054I05GGCTGGGCCAANONE 
J065072H13GGCTGGGCCAANONE 
J065073L10GGCTGGGCCAANONE 
J065079P09GGCTGGGCCAANONE 
J065112I06GGCTGGGCCAANONE 
J065167C03GGCTGGGCCAANONE 
J065167I03GGCTGGGCCAANONE 
J065176P13GGCTGGGCCAANONE 
J065205M07GGCTGGGCCAANONE 
J075018E13GGCTGGGCCAANONE 
J075021E04GGCTGGGCCAANONE 
J075038F13GGCTGGGCCAANONE 
J075051E05GGCTGGGCCAANONE 
J075067C10GGCTGGGCCAANONE 
J075079A12GGCTGGGCCAANONE 
J075084A13GGCTGGGCCAANONE 
J075103E20GGCTGGGCCAANONE 
J075116E09GGCTGGGCCAANONE 
J075118F15GGCTGGGCCAANONE 
J075121I15GGCTGGGCCAANONE 
J075129B01GGCTGGGCCAANONE 
J075138A22GGCTGGGCCAANONE 
J075159B22GGCTGGGCCAANONE 
J075165I11GGCTGGGCCAANONE 
J075186E09GGCTGGGCCAANONE 
J075190J09GGCTGGGCCAANONE 
J075191I07GGCTGGGCCAANONE 
J080301C05GGCTGGGCCAANONE 
J080302L02GGCTGGGCCAANONE 
J100035C19GGCTGGGCCAANONE 
J100059P06GGCTGGGCCAANONE 
Os06g0711600016-047-G09GGGTGGGCCAANONE 
AK064384GGGTGGGCCAAmRNA splicing factor SYF2 family protein. 
AK102831GGGTGGGCCAANONE 
J013072P18GGGTGGGCCAANONE 
J023049G01GGGTGGGCCAANONE 
J023088I01GGGTGGGCCAANONE 
J033023I22GGGTGGGCCAANONE 
J033106I12GGGTGGGCCAANONE 
J033109G07GGGTGGGCCAANONE 
J065030F22GGGTGGGCCAANONE 
J065132H19GGGTGGGCCAANONE 
J080301D07GGGTGGGCCAANONE 
J080305C09GGGTGGGCCAANONE 
J080312C03GGGTGGGCCAANONE 
J080313I15GGGTGGGCCAANONE 
J080315B09GGGTGGGCCAANONE 
J090056N21GGGTGGGCCAANONE 
J100027B07GGGTGGGCCAANONE 
Os06g0714100AK121079TTGGCCCAACTComplex 1 LYR protein family protein. 
J023062M13TTGGCCCAACTNONE 
J043020D18TTGGCCCAACTNONE 
J065073A17TTGGCCCAACTNONE 
J065158D09TTGGCCCAACTNONE 
J065195H04TTGGCCCAACTNONE 
J065214P13TTGGCCCAACTNONE 
J080079I22TTGGCCCAACTNONE 
J100031M06TTGGCCCAACTNONE 
J100036I12TTGGCCCAACTNONE 
Os06g0726400AF136268TTGGCCCAAANONE 
AK065121TTGGCCCAAANONE 
AK119436TTGGCCCAAABranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK120332TTGGCCCAAANONE 
AY302112TTGGCCCAAANONE 
D10752TTGGCCCAAANONE 
D11082TTGGCCCAAANONE 
J013031L12TTGGCCCAAANONE 
J013042M09TTGGCCCAAANONE 
J013058E01TTGGCCCAAANONE 
J013058O09TTGGCCCAAANONE 
J013063J17TTGGCCCAAANONE 
J013066I24TTGGCCCAAANONE 
J013069F17TTGGCCCAAANONE 
J013106E01TTGGCCCAAANONE 
J013118D19TTGGCCCAAANONE 
J013162M11TTGGCCCAAANONE 
J023028B19TTGGCCCAAANONE 
J023031A13TTGGCCCAAANONE 
J023047H18TTGGCCCAAANONE 
J023059N10TTGGCCCAAANONE 
J023104N22TTGGCCCAAANONE 
J033025J03TTGGCCCAAANONE 
J033045B05TTGGCCCAAANONE 
J033067M08TTGGCCCAAANONE 
J033113D04TTGGCCCAAANONE 
J043003D11TTGGCCCAAANONE 
J043009O20TTGGCCCAAANONE 
J043016P06TTGGCCCAAANONE 
J043017C21TTGGCCCAAANONE 
J043017J20TTGGCCCAAANONE 
J043021P15TTGGCCCAAANONE 
J043026I22TTGGCCCAAANONE 
J043032L15TTGGCCCAAANONE 
J043034G14TTGGCCCAAANONE 
J043039L16TTGGCCCAAANONE 
J075003D02TTGGCCCAAANONE 
J075003O22TTGGCCCAAANONE 
J075005I24TTGGCCCAAANONE 
J075006N09TTGGCCCAAANONE 
J075011A22TTGGCCCAAANONE 
J075012K24TTGGCCCAAANONE 
J075017D01TTGGCCCAAANONE 
J075017I23TTGGCCCAAANONE 
J075023D17TTGGCCCAAANONE 
J075024B03TTGGCCCAAANONE 
J075025H05TTGGCCCAAANONE 
J075031D19TTGGCCCAAANONE 
J075034B02TTGGCCCAAANONE 
J075035C02TTGGCCCAAANONE 
J075037J12TTGGCCCAAANONE 
J075038M11TTGGCCCAAANONE 
J075039J17TTGGCCCAAANONE 
J075042P10TTGGCCCAAANONE 
J075046J20TTGGCCCAAANONE 
J075047F21TTGGCCCAAANONE 
J075053E05TTGGCCCAAANONE 
J075054D11TTGGCCCAAANONE 
J075054K06TTGGCCCAAANONE 
J075059E15TTGGCCCAAANONE 
J075061O04TTGGCCCAAANONE 
J075062I20TTGGCCCAAANONE 
J075066I12TTGGCCCAAANONE 
J075066L06TTGGCCCAAANONE 
J075071H12TTGGCCCAAANONE 
J075071N19TTGGCCCAAANONE 
J075074K01TTGGCCCAAANONE 
J075077H22TTGGCCCAAANONE 
J075083H18TTGGCCCAAANONE 
J075085F04TTGGCCCAAANONE 
J075085K09TTGGCCCAAANONE 
J075086C06TTGGCCCAAANONE 
J075086E06TTGGCCCAAANONE 
J075087A15TTGGCCCAAANONE 
J075090N02TTGGCCCAAANONE 
J075090N22TTGGCCCAAANONE 
J075091C04TTGGCCCAAANONE 
J075091G16TTGGCCCAAANONE 
J075097E04TTGGCCCAAANONE 
J075099E04TTGGCCCAAANONE 
J075102P22TTGGCCCAAANONE 
J075109B08TTGGCCCAAANONE 
J075109J02TTGGCCCAAANONE 
J075115I12TTGGCCCAAANONE 
J075117E17TTGGCCCAAANONE 
J075123C07TTGGCCCAAANONE 
J075124N05TTGGCCCAAANONE 
J075125E12TTGGCCCAAANONE 
J075126B11TTGGCCCAAANONE 
J075129E14TTGGCCCAAANONE 
J075130N15TTGGCCCAAANONE 
J075131I07TTGGCCCAAANONE 
J075141B13TTGGCCCAAANONE 
J075141B20TTGGCCCAAANONE 
J075144D23TTGGCCCAAANONE 
J075144N01TTGGCCCAAANONE 
J075147M24TTGGCCCAAANONE 
J075148L16TTGGCCCAAANONE 
J075151A22TTGGCCCAAANONE 
J075151D03TTGGCCCAAANONE 
J075151D04TTGGCCCAAANONE 
J075153E23TTGGCCCAAANONE 
J075156D02TTGGCCCAAANONE 
J075156P05TTGGCCCAAANONE 
J075162E23TTGGCCCAAANONE 
J075165J22TTGGCCCAAANONE 
J075166A06TTGGCCCAAANONE 
J075168H13TTGGCCCAAANONE 
J075170D04TTGGCCCAAANONE 
J075171C19TTGGCCCAAANONE 
J075173B12TTGGCCCAAANONE 
J075173M23TTGGCCCAAANONE 
J075174C03TTGGCCCAAANONE 
J075185O11TTGGCCCAAANONE 
J075186G21TTGGCCCAAANONE 
J075187D06TTGGCCCAAANONE 
J075195G21TTGGCCCAAANONE 
J090003D18TTGGCCCAAANONE 
J090005I12TTGGCCCAAANONE 
J090007D15TTGGCCCAAANONE 
J090007G20TTGGCCCAAANONE 
J090014G13TTGGCCCAAANONE 
J090014L08TTGGCCCAAANONE 
J090016J03TTGGCCCAAANONE 
J090023P22TTGGCCCAAANONE 
J090025C19TTGGCCCAAANONE 
J090028F11TTGGCCCAAANONE 
J090028G01TTGGCCCAAANONE 
J090028H02TTGGCCCAAANONE 
J090037I11TTGGCCCAAANONE 
J090040F21TTGGCCCAAANONE 
J090040N24TTGGCCCAAANONE 
J090044M12TTGGCCCAAANONE 
J090045B13TTGGCCCAAANONE 
J090045M22TTGGCCCAAANONE 
J090048C10TTGGCCCAAANONE 
J090051J02TTGGCCCAAANONE 
J090058O15TTGGCCCAAANONE 
J090062F11TTGGCCCAAANONE 
J090067D23TTGGCCCAAANONE 
J090069G15TTGGCCCAAANONE 
J090072I06TTGGCCCAAANONE 
J090073H18TTGGCCCAAANONE 
J090073L01TTGGCCCAAANONE 
J090075O21TTGGCCCAAANONE 
J090084K24TTGGCCCAAANONE 
J090087P11TTGGCCCAAANONE 
J090092B17TTGGCCCAAANONE 
J100042H08TTGGCCCAAANONE 
Os07g0124500012-092-F01TTGGCCCAACANONE 
AK070529TTGGCCCAACASimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000TTGGCCCAACANONE 
J090007O11TTGGCCCAACANONE 
J090010E02TTGGCCCAACANONE 
J090078C04TTGGCCCAACANONE 
Os07g0141400003-129-D08GATCCGACGTGGGCCAANONE 
006-021-E02GATCCGACGTGGGCCAANONE 
006-025-C06GATCCGACGTGGGCCAANONE 
006-027-H11GATCCGACGTGGGCCAANONE 
006-036-C05GATCCGACGTGGGCCAANONE 
006-046-D07GATCCGACGTGGGCCAANONE 
006-047-A02GATCCGACGTGGGCCAANONE 
006-050-F02GATCCGACGTGGGCCAANONE 
006-053-D07GATCCGACGTGGGCCAANONE 
006-054-E06GATCCGACGTGGGCCAANONE 
006-055-E01GATCCGACGTGGGCCAANONE 
006-055-F01GATCCGACGTGGGCCAANONE 
006-056-H12GATCCGACGTGGGCCAANONE 
006-057-D07GATCCGACGTGGGCCAANONE 
006-074-G10GATCCGACGTGGGCCAANONE 
006-077-C02GATCCGACGTGGGCCAANONE 
006-081-E01GATCCGACGTGGGCCAANONE 
006-089-B08GATCCGACGTGGGCCAANONE 
006-089-C10GATCCGACGTGGGCCAANONE 
006-092-E07GATCCGACGTGGGCCAANONE 
006-096-C11GATCCGACGTGGGCCAANONE 
006-096-H06GATCCGACGTGGGCCAANONE 
006-097-E07GATCCGACGTGGGCCAANONE 
006-098-D03GATCCGACGTGGGCCAANONE 
006-102-C05GATCCGACGTGGGCCAANONE 
006-107-E09GATCCGACGTGGGCCAANONE 
006-110-C09GATCCGACGTGGGCCAANONE 
006-113-C01GATCCGACGTGGGCCAANONE 
006-114-D09GATCCGACGTGGGCCAANONE 
006-115-H06GATCCGACGTGGGCCAANONE 
009-016-G06GATCCGACGTGGGCCAANONE 
009-031-C05GATCCGACGTGGGCCAANONE 
009-060-B05GATCCGACGTGGGCCAANONE 
009-123-H12GATCCGACGTGGGCCAANONE 
009-154-B09GATCCGACGTGGGCCAANONE 
009-172-F07GATCCGACGTGGGCCAANONE 
009-193-A04GATCCGACGTGGGCCAANONE 
AF022732GATCCGACGTGGGCCAANONE 
AF052203GATCCGACGTGGGCCAANONE 
AK065248GATCCGACGTGGGCCAASimilar to 23 kDa polypeptide of photosystem II. 
AK104722GATCCGACGTGGGCCAANONE 
D49713GATCCGACGTGGGCCAANONE 
J013002J02GATCCGACGTGGGCCAANONE 
J065051O13GATCCGACGTGGGCCAANONE 
J065066J18GATCCGACGTGGGCCAANONE 
J065077G23GATCCGACGTGGGCCAANONE 
J065162C22GATCCGACGTGGGCCAANONE 
J065162G22GATCCGACGTGGGCCAANONE 
J075091B13GATCCGACGTGGGCCAANONE 
J075099J22GATCCGACGTGGGCCAANONE 
J100056O22GATCCGACGTGGGCCAANONE 
J100059E01GATCCGACGTGGGCCAANONE 
J100079F20GATCCGACGTGGGCCAANONE 
Os07g0180900006-055-B11ATATGGGCCAANONE 
006-103-F09ATATGGGCCAANONE 
011-009-E03ATATGGGCCAANONE 
011-035-H08ATATGGGCCAANONE 
014-043-F08ATATGGGCCAANONE 
AK060711ATATGGGCCAARibosomal protein L4/L1e family protein. 
AK060963ATATGGGCCAANONE 
AK104447ATATGGGCCAANONE 
AK104504ATATGGGCCAANONE 
AK104629ATATGGGCCAANONE 
J023003P15ATATGGGCCAANONE 
J023075H14ATATGGGCCAANONE 
J033101N17ATATGGGCCAANONE 
J033132M11ATATGGGCCAANONE 
J065081C24ATATGGGCCAANONE 
J080004L10ATATGGGCCAANONE 
J080009H21ATATGGGCCAANONE 
J080013F01ATATGGGCCAANONE 
J080022K24ATATGGGCCAANONE 
J080023C22ATATGGGCCAANONE 
J080024M16ATATGGGCCAANONE 
J080026K06ATATGGGCCAANONE 
J080030J23ATATGGGCCAANONE 
J080030L05ATATGGGCCAANONE 
J080031G03ATATGGGCCAANONE 
J080033C03ATATGGGCCAANONE 
J080033D02ATATGGGCCAANONE 
J080035A11ATATGGGCCAANONE 
J080035A14ATATGGGCCAANONE 
J080039E08ATATGGGCCAANONE 
J080040L15ATATGGGCCAANONE 
J080040M03ATATGGGCCAANONE 
J080041L21ATATGGGCCAANONE 
J080043E09ATATGGGCCAANONE 
J080048B14ATATGGGCCAANONE 
J080048O09ATATGGGCCAANONE 
J080051H01ATATGGGCCAANONE 
J080052H06ATATGGGCCAANONE 
J080065K05ATATGGGCCAANONE 
J080066D10ATATGGGCCAANONE 
J080066E23ATATGGGCCAANONE 
J080069F10ATATGGGCCAANONE 
J080074M06ATATGGGCCAANONE 
J080075D13ATATGGGCCAANONE 
J080076G02ATATGGGCCAANONE 
J080082G15ATATGGGCCAANONE 
J080082K06ATATGGGCCAANONE 
J080082P12ATATGGGCCAANONE 
J080085F01ATATGGGCCAANONE 
J080090H22ATATGGGCCAANONE 
J080092D07ATATGGGCCAANONE 
J080094M03ATATGGGCCAANONE 
J080094O10ATATGGGCCAANONE 
J090008I06ATATGGGCCAANONE 
J100058N20ATATGGGCCAANONE 
J100060M07ATATGGGCCAANONE 
J100062M08ATATGGGCCAANONE 
J100064L07ATATGGGCCAANONE 
J100073H16ATATGGGCCAANONE 
J100074C10ATATGGGCCAANONE 
J100075N06ATATGGGCCAANONE 
J100087P11ATATGGGCCAANONE 
J100088B13ATATGGGCCAANONE 
J100088J16ATATGGGCCAANONE 
J100088L17ATATGGGCCAANONE 
J100088O12ATATGGGCCAANONE 
Os07g0191000AK071379TTGGCCCAGAInositol monophosphatase family protein. 
AK103440TTGGCCCAGANONE 
Os07g0242600AK065752TTGGCCCAAATCyclin-like F-box domain containing protein. 
J013037K22TTGGCCCAAATNONE 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0272800AK107279GTTTGGGCCAAGCCCACGAAHypothetical protein. 
J065124H15GTTTGGGCCAAGCCCACGAANONE 
Os07g0300900AK061941TCTGGGCCAASimilar to Lysine-sensitive aspartate kinase. 
AK102162TCTGGGCCAANONE 
Os07g0435400AK111603AAATGGGCCAASimilar to WD40. 
Os07g0459200AK066819GCTGGGCTTGGGCCAACCGAGCCGNONE 
AK102099GCTGGGCTTGGGCCAACCGAGCCGSimilar to Possible kinase. 
Os07g0472400AK105684GCTGGGCCAAATGGGCProtein kinase domain containing protein. 
Os07g0499900AK109745ACATGGGCCAAGTTGGGCCACCyclin-like F-box domain containing protein. 
Os07g0506700AK073959AGCCCATTGGGCCAAWD40-like domain containing protein. 
Os07g0513200015-004-B02TTGGCCCATCANONE 
AK101410TTGGCCCATCANONE 
AK106227TTGGCCCATCANONE 
AK119451TTGGCCCATCAProtein prenyltransferase domain containing protein. 
Os07g0558200AK065243TAATGGGCCAAInositol monophosphatase family protein. 
Os07g0572500AK108612TTGGCCCAAGConserved hypothetical protein. 
Os07g0585800006-106-A05TTGGCCCAACANONE 
AK066419TTGGCCCAACANONE 
AK105064TTGGCCCAACASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TTGGCCCAACANONE 
J065085B08TTGGCCCAACANONE 
J065099I23TTGGCCCAACANONE 
J065169A01TTGGCCCAACANONE 
J065187N13TTGGCCCAACANONE 
J065191L18TTGGCCCAACANONE 
J065194D04TTGGCCCAACANONE 
J065211M09TTGGCCCAACANONE 
J065212I02TTGGCCCAACANONE 
J090003C10TTGGCCCAACANONE 
J090025O11TTGGCCCAACANONE 
J090092F10TTGGCCCAACANONE 
J100055A04TTGGCCCAACANONE 
J100064A01TTGGCCCAACANONE 
J100080L02TTGGCCCAACANONE 
Os07g0598900015-040-C12TGTGGGCCAANONE 
AK102627TGTGGGCCAACobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521TGTGGGCCAANONE 
J033087C18TGTGGGCCAANONE 
J033099K03TGTGGGCCAANONE 
J065054E02TGTGGGCCAANONE 
J090055O05TGTGGGCCAANONE 
Os07g0616900AK071047TGGATGGGCCAAProtein of unknown function DUF500 family protein. 
J013106G03TGGATGGGCCAANONE 
J013124C20TGGATGGGCCAANONE 
J033096D16TGGATGGGCCAANONE 
J043005E08TGGATGGGCCAANONE 
J065197K12TGGATGGGCCAANONE 
J065211I03TGGATGGGCCAANONE 
Os07g0626100009-127-G03AATGGGCCAANONE 
AK062899AATGGGCCAASimilar to 50S ribosomal protein L7/L12. 
Os07g0641400009-078-A04TTGGCCCATGTCCAGCCCATCGNONE 
AK062634TTGGCCCATGTCCAGCCCATCGHypothetical protein. 
Os07g0673000011-058-G06AATTGGGCCAANONE 
AK063364AATTGGGCCAAConserved hypothetical protein. 
Os07g0673700AK071934ATTGGGCCAACyclin-like F-box domain containing protein. 
AK107556ATTGGGCCAANONE 
Os07g0681500AK100010TGATGGGCCAANONE 
Os07g0688300AK068325TATTGGGCCAASimilar to Importin alpha 1. 
AK068325TTGGCCCAAAASimilar to Importin alpha 1. 
AK099611TATTGGGCCAANONE 
AK099611TTGGCCCAAAANONE 
Os08g0112800009-113-D03ATTTGGGCCAANONE 
AK121176ATTTGGGCCAARickettsia 17 kDa surface antigen family protein. 
J023083C18ATTTGGGCCAANONE 
J033074M10ATTTGGGCCAANONE 
J033097G10ATTTGGGCCAANONE 
J065090F05ATTTGGGCCAANONE 
J090001J03ATTTGGGCCAANONE 
J090044F23ATTTGGGCCAANONE 
J090078H09ATTTGGGCCAANONE 
J100088G23ATTTGGGCCAANONE 
Os08g0126700AK111805AACTGGGCCAANONE 
AK111902AACTGGGCCAAZinc finger, CCCH-type domain containing protein. 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0172300AK111274TTGGCCCAGCHAT dimerisation domain containing protein. 
J065184J06TTGGCCCAGCNONE 
Os08g0206600AK064336TTGGCCCATCTAICARFT/IMPCHase bienzyme family protein. 
AK102764TTGGCCCATCTNONE 
Os08g0323400006-027-G07TTGGCCCAGCNONE 
009-152-D11TTGGCCCAGCNONE 
009-160-B08TTGGCCCAGCNONE 
AK068722TTGGCCCAGCSimilar to Rubredoxin (Rd). 
AK104226TTGGCCCAGCNONE 
J065086N20TTGGCCCAGCNONE 
J065138B16TTGGCCCAGCNONE 
J065138O10TTGGCCCAGCNONE 
J075089M06TTGGCCCAGCNONE 
Os08g0387050J043038F21TTGGCCCATTConserved hypothetical protein. 
Os08g0412100AK072641TTGGCCCAAAADisease resistance protein family protein. 
Os08g0412200006-028-H07AAATGGGCCAANONE 
AJ575234AAATGGGCCAANONE 
AK059631AAATGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099367AAATGGGCCAANONE 
AK104578AAATGGGCCAANONE 
J033071L08AAATGGGCCAANONE 
J065197K18AAATGGGCCAANONE 
Os08g0452200AK100150GTTGGGCCAAConserved hypothetical protein. 
Os08g0460800015-094-E01TTGGCCCAAGGCCCAGTTCyclin-like F-box domain containing protein. 
Os08g0469500AK109599ATATGGGCCAAConserved hypothetical protein. 
Os08g0492100AK060178AAATGGGCTGTATTTGGGCCAANONE 
AK071053AAATGGGCTGTATTTGGGCCAAParaneoplastic encephalomyelitis antigen family protein. 
AK100101AAATGGGCTGTATTTGGGCCAANONE 
J023004I20AAATGGGCTGTATTTGGGCCAANONE 
J023067D13AAATGGGCTGTATTTGGGCCAANONE 
J033028G05AAATGGGCTGTATTTGGGCCAANONE 
J033060L15AAATGGGCTGTATTTGGGCCAANONE 
J033103N12AAATGGGCTGTATTTGGGCCAANONE 
J033125B19AAATGGGCTGTATTTGGGCCAANONE 
J065132A12AAATGGGCTGTATTTGGGCCAANONE 
J065161F02AAATGGGCTGTATTTGGGCCAANONE 
J065162L05AAATGGGCTGTATTTGGGCCAANONE 
J090093I18AAATGGGCTGTATTTGGGCCAANONE 
J100061I05AAATGGGCTGTATTTGGGCCAANONE 
J100081G13AAATGGGCTGTATTTGGGCCAANONE 
Os08g0495300Os08g0495300TTGGCCCAGAConserved hypothetical protein. 
Os08g0527400AK119389TTGGCCCATCAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
AK119389TTGGCCCATCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0544500AK071354TTGGCCCACCSimilar to ARP2/3 regulatory protein subunit NAPP. 
Os08g0548900006-043-D07TCCGGCCCATGGGCCAANONE 
006-043-H11TCCGGCCCATGGGCCAANONE 
006-081-G06TCCGGCCCATGGGCCAANONE 
006-109-E04TCCGGCCCATGGGCCAANONE 
011-033-E04TCCGGCCCATGGGCCAANONE 
AK061808TCCGGCCCATGGGCCAASimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK098875TCCGGCCCATGGGCCAANONE 
J013001D12TCCGGCCCATGGGCCAANONE 
J033126N14TCCGGCCCATGGGCCAANONE 
J053069M09TCCGGCCCATGGGCCAANONE 
J053098E10TCCGGCCCATGGGCCAANONE 
J053101C24TCCGGCCCATGGGCCAANONE 
J065002F21TCCGGCCCATGGGCCAANONE 
J065006C22TCCGGCCCATGGGCCAANONE 
J065076J02TCCGGCCCATGGGCCAANONE 
J065134M22TCCGGCCCATGGGCCAANONE 
J075007M19TCCGGCCCATGGGCCAANONE 
J075040I11TCCGGCCCATGGGCCAANONE 
J075047E20TCCGGCCCATGGGCCAANONE 
J075052D22TCCGGCCCATGGGCCAANONE 
J075076L13TCCGGCCCATGGGCCAANONE 
J075157P22TCCGGCCCATGGGCCAANONE 
J075161M18TCCGGCCCATGGGCCAANONE 
J075168P22TCCGGCCCATGGGCCAANONE 
J075181E04TCCGGCCCATGGGCCAANONE 
U92540TCCGGCCCATGGGCCAANONE 
Os08g0553450Os08g0553450TCATGGGCCAAHypothetical protein. 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0120033AK069069TTGGCCCAGCCConserved hypothetical protein. 
Os09g0122000J075038D18TGTTGGGCCAANONE 
J075080K22TGTTGGGCCAANONE 
J075153J04TGTTGGGCCAANONE 
J075161K18TGTTGGGCCAANONE 
J075163H20TGTTGGGCCAANONE 
J075174C07TGTTGGGCCAAConserved hypothetical protein. 
Os09g0397900AK101306GGCTGGGCTTTTTGGTGGGCCAASimilar to FEG protein. 
Os09g0419500016-067-D11TTGGCCCATGTNONE 
AK064394TTGGCCCATGTZinc finger, RING-type domain containing protein. 
AK073786TTGGCCCATGTNONE 
J033067G01TTGGCCCATGTNONE 
Os09g0437900AK107833TTGGCCCATTTSimilar to Adrenodoxin. 
Os09g0443800AK107689TGGTGGGCCAAConserved hypothetical protein. 
Os09g0463700016-008-D06TTGGCCCACACGNONE 
AK060708TTGGCCCACACGSimilar to AHM1. 
J090013G05TTGGCCCACACGNONE 
Os09g0485800AK108749TTGGCCCATTAConserved hypothetical protein. 
J065137H03TTGGCCCATTANONE 
Os09g0495200AK102989CTTGGGCCAAGTGGGCTTTConserved hypothetical protein. 
J075062H18CTTGGGCCAAGTGGGCTTTNONE 
J075098G06CTTGGGCCAAGTGGGCTTTNONE 
Os09g0498100015-046-G11TTGGCCCATGGGCTAAAGCCCAGNONE 
AK064108TTGGCCCATGGGCTAAAGCCCAGSimilar to 30S ribosomal protein S16. 
J065040H21TTGGCCCATGGGCTAAAGCCCAGNONE 
J065062F05TTGGCCCATGGGCTAAAGCCCAGNONE 
J065147B17TTGGCCCATGGGCTAAAGCCCAGNONE 
J075098J22TTGGCCCATGGGCTAAAGCCCAGNONE 
Os09g0509200AK069525GGCTGGGCCTTTGGGCCAASimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0528100009-173-A08TATTGGGCCAANONE 
009-190-G12TATTGGGCCAANONE 
AK059096TATTGGGCCAASimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0532600J013002F02TTTGGGCCAAGCCCATGTNONE 
Os09g0532800J065167K16TGTTGGGCCAAProtein prenyltransferase domain containing protein. 
Os11g0131200J065024D18AGGTGGGCCAAMpv17/PMP22 family protein. 
J065206C17AGGTGGGCCAANONE 
Os11g0148000AK108267CTTGGGCCAASodium/calcium exchanger membrane region domain containing protein. 
J065051O11CTTGGGCCAANONE 
J065110G12CTTGGGCCAANONE 
Os11g0162200009-059-H04TCATGGGCCAAAAGCCCAAAANONE 
AK060396TCATGGGCCAAAAGCCCAAAASimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11TCATGGGCCAAAAGCCCAAAANONE 
J065105K09TCATGGGCCAAAAGCCCAAAANONE 
J075024G12TCATGGGCCAAAAGCCCAAAANONE 
J075040K04TCATGGGCCAAAAGCCCAAAANONE 
J075066D13TCATGGGCCAAAAGCCCAAAANONE 
J075108A11TCATGGGCCAAAAGCCCAAAANONE 
J100031D04TCATGGGCCAAAAGCCCAAAANONE 
J100060O05TCATGGGCCAAAAGCCCAAAANONE 
J100075M22TCATGGGCCAAAAGCCCAAAANONE 
Os11g0171700AK099115ATTGGGCCAASMAD/FHA domain containing protein. 
Os11g0256000J065001O05TTGGCCCAGCAcetolactate synthase, small subunit family protein. 
J065019G09TTGGCCCAGCNONE 
J065039G02TTGGCCCAGCNONE 
J065054A11TTGGCCCAGCNONE 
J065059K07TTGGCCCAGCNONE 
J065077D22TTGGCCCAGCNONE 
Os11g0298400AK068577CAAGTGGGCCAARibulose bisphosphate carboxylase, small chain family protein. 
AK068577TTGGCCCATCARibulose bisphosphate carboxylase, small chain family protein. 
Os11g0425800AK066603TTGGCCCATTASimilar to 60S ribosomal protein L13a. 
J065063A20TTGGCCCATTANONE 
J075021H08TTGGCCCATTANONE 
J075058J10TTGGCCCATTANONE 
J075088B15TTGGCCCATTANONE 
J075099E15TTGGCCCATTANONE 
J075110F13TTGGCCCATTANONE 
J075150G18TTGGCCCATTANONE 
J080312E14TTGGCCCATTANONE 
Os11g0629200AK065196ACATGGGCCAASimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os11g0642100AK107010TTGGCCCAACCyclin-like F-box domain containing protein. 
Os12g0114500013-083-G01TTGGCCCANONE 
014-079-C04TTGGCCCANONE 
AF051369TTGGCCCANONE 
AK073466TTGGCCCANONE 
AK104981TTGGCCCASimilar to Nonspecific lipid-transfer protein (LTP) (Fragment). 
J065162G08TTGGCCCANONE 
Os12g0155200AK067300TTGGCCCACTCCSimilar to Rac GTPase activating protein. 
J090050C04TTGGCCCACTCCNONE 
Os12g0223700J075049J03CTTGGGCCAAAAGCCCAAGHypothetical protein. 
J075101F23CTTGGGCCAAAAGCCCAAGNONE 
Os12g0233500Os12g0233500TTGGCCCAGANONE 
Os12g0257000AK064874TTGGCCCAAACSerine carboxypeptidase I precursor (EC 3.4.16.5) (Carboxypeptidase C). 
Os12g0299700AK071145TTGGCCCATTConserved hypothetical protein. 
J023082N05TTGGCCCATTNONE 
Os12g0533500AK068646GGGCTGGGCCGCGTGGGCCAAConserved hypothetical protein. 
J013158L10GGGCTGGGCCGCGTGGGCCAANONE 
J065083J02GGGCTGGGCCGCGTGGGCCAANONE 
J075079D02GGGCTGGGCCGCGTGGGCCAANONE 
J100037H16GGGCTGGGCCGCGTGGGCCAANONE 
J100075P13GGGCTGGGCCGCGTGGGCCAANONE 
Os12g0554400AK072345TTGGCCCAAATetratricopeptide-like helical domain containing protein. 
Os12g0573000AK067552TTGGCCCATCCHypothetical protein. 
AK069292TTGGCCCATCCNONE 
Os12g0574800AK073004TTGGCCCATAANONE 
AK102465TTGGCCCATAABromodomain transcription factor containing protein. 
AK121687TTGGCCCATAANONE 
J033070O18TTGGCCCATAANONE 
J075097O17TTGGCCCATAANONE 
J080069F02TTGGCCCATAANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.