PlantPromoterDB promoter information of AT1G01490

Summary of Gene (AT1G01490)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G01490 TAIR NCBI
Gene model	AT1G01490
Description	heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT5G23760.1); Has 7628 Blast hits to 3670 proteins in 294 species: Archae - 47; Bacteria - 686; Metazoa - 2844; Fungi - 342; Plants - 780; Viruses - 96; Other Eukaryotes - 2833 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 183066-181867)

`Genome position from initiation codon` `AT1G01490.1 AT1G01490.2 TSS from cDNA TSS information AT1G01490 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G01490

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 4 - 182212 -146

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	4	-	182212	-146

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone C clone - 182367 -301

TSS clone T clone - 182357 -291

TSS clone T clone - 182348 -282

TSS clone G clone - 182327 -261

TSS clone G clone - 182325 -259

TSS clone T clone - 182302 -236

TSS clone A clone - 182241 -175

TSS clone A clone - 182089 -23

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`C`	clone	-	182367	-301
TSS clone	`T`	clone	-	182357	-291
TSS clone	`T`	clone	-	182348	-282
TSS clone	`G`	clone	-	182327	-261
TSS clone	`G`	clone	-	182325	-259
TSS clone	`T`	clone	-	182302	-236
TSS clone	`A`	clone	-	182241	-175
TSS clone	`A`	clone	-	182089	-23

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TTCTTCTTCTTCTT - 182173 182186 -107 -120

Y Patch TCTCTCTT - 182216 182223 -150 -157

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TTCTTCTTCTTCTT`	-	182173	182186	-107	-120
Y Patch	`TCTCTCTT`	-	182216	182223	-150	-157
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TCACGCGC - 182418 182425 -352 -359

AtREG395 TCACGCGC PPDB Motif ACGCGC PLACE Motif

REG CACGCGCC - 182431 182438 -365 -372

AtREG486 CACGCGCC PPDB Motif ACGCGC PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TCACGCGC`		-	182418	182425	-352	-359
	AtREG395	`TCACGCGC`		PPDB Motif	`ACGCGC`	PLACE Motif
REG	`CACGCGCC`		-	182431	182438	-365	-372
	AtREG486	`CACGCGCC`		PPDB Motif	`ACGCGC`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None