version
PlantPromoterDB promoter information of AT1G02090.2

Summary of Gene (AT1G02090.2)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G02090  TAIR      NCBI 
Gene model AT1G02090.2  
Description encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.  
#
#

Overview

Focused view (chromosome 1: 390568-389369)

Genome position     
from initiation codon
AT1G02090.1         
AT1G02090.3         
TSS from cDNA
TSS information
AT1G02090.2                      5'->3' (-)
Promoter sequence





 
AT1G02100.1         
AT1G02100.2         
AT1G02100.3         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G02090.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5-389650-82

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-389643-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAATATAAAAA-389671389680-103-112
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAGCCCAATTA-389729389740-161-172
 AtREG485TGAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533 GAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG418   GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG600    CCCAATTA PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCAGA-389753389762-185-194
 AtREG484TTGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458 TGGCCCAG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG397  GGCCCAGA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGACGCGGTT-389786389793-218-225
 AtREG441ACGCGGTTDrought PPDB Motif  PLACE Motif 
REGGTTTGGGCTCA-389798389808-230-240
 AtREG474GTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533  TTGGGCTC  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485   TGGGCTCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTCGTCGTT-389918389925-350-357
 AtREG648TCGTCGTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4+389873AT1G02100.2, AT1G02100.3, AT1G02100.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+389816AT1G02100.2, AT1G02100.3, AT1G02100.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTCCTTC+389839389851AT1G02100.1, AT1G02100.2, AT1G02100.3
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTTCCGGT+389585389592AT1G02100.1, AT1G02100.2, AT1G02100.3
 AtREG644TTTCCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAATTGGGCTCA+389729389740AT1G02100.1, AT1G02100.2, AT1G02100.3
 AtREG600TAATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533   TTGGGCTC  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485    TGGGCTCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTCTGGGCCAA+389753389762AT1G02100.1, AT1G02100.2, AT1G02100.3
 AtREG397TCTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458 CTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484  TGGGCCAA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGAACCGCGT+389786389793AT1G02100.1, AT1G02100.2, AT1G02100.3
 AtREG441AACCGCGTDrought PPDB Motif  PLACE Motif 
REGTGAGCCCAAAC+389798389808AT1G02100.1, AT1G02100.2, AT1G02100.3
 AtREG485TGAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533 GAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469  AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG474   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.