PlantPromoterDB promoter information of AT1G02760
Summary of Gene (AT1G02760)
|
Overview
|
Focused view (chromosome 1: 606752-605553)
|
Genome position
TSS from cDNA TSS information AT1G02760 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G02760
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | None | None | None | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone peak | A | clone | - | 606659 | AT1G02770.1 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | GGCCCAACAAAAGCCCATAA | - | 606740 | 606759 | AT1G02770.1 | ||||
| AtREG449 | GGCCCAAC | PPDB Motif | GCCCA, CCAACGG | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG543 | GCCCAACA | PPDB Motif | GCCCA | PLACE Motif | CAACA | ||||
| AtREG409 | AAAAGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG376 | AAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG378 | AAGCCCAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG477 | AGCCCATA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG394 | GCCCATAA | PPDB Motif | GCCCA | PLACE Motif | |||||