PlantPromoterDB promoter information of AT1G02810
Summary of Gene (AT1G02810)
|
Overview
|
Focused view (chromosome 1: 620034-621233)
|
Genome position
from initiation codon AT1G02813.1 TSS from cDNA TSS information AT1G02810 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G02810
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | + | 618263 | -21 |
| TSS clone peak | C | clone | + | 618264 | -20 |
| TSS clone peak | A | clone | + | 618265 | -19 |
| TSS clone | T | clone | + | 618266 | -18 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | CTTATATAAACC | + | 618229 | 618240 | -55 | -44 |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | ACGCGTTTT | + | 618105 | 618113 | -179 | -171 | |||
| AtREG633 | ACGCGTTT | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| AtREG566 | CGCGTTTT | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | AGCCCAAA | + | 621169 | 621176 | AT1G02816.1 | ||||
| AtREG469 | AGCCCAAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| REG | TATAGGCCTAT | + | 621199 | 621209 | AT1G02816.1 | ||||
| AtREG487 | TATAGGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG649 | ATAGGCCTAT | PPDB Motif | PLACE Motif | ||||||
| REG | TTAAAGCCCATGGGCCTTAA | + | 621219 | 621238 | AT1G02816.1 | ||||
| AtREG545 | TTAAAGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG365 | TAAAGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG376 | AAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG378 | AAGCCCAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG591 | CCCATGGG | PPDB Motif | GCCCA, CCATGG | PLACE Motif | |||||
| AtREG507 | GCCCATGGGC | PPDB Motif | GCCCA, CCATGG | PLACE Motif | |||||
| AtREG504 | CATGGGCC | PPDB Motif | GCCCA, CCATGG | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | ATGGGCCT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG353 | TGGGCCTT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG351 | GGGCCTTA | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG416 | GGCCTTAA | PPDB Motif | PLACE Motif | ||||||