version
PlantPromoterDB promoter information of AT1G02810

Summary of Gene (AT1G02810)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G02810  TAIR      NCBI 
Gene model AT1G02810  
Description pectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: ATPMEPCRB; pectinesterase (TAIR:AT4G02330.1); Has 1267 Blast hits to 1233 proteins in 181 species: Archae - 0; Bacteria - 238; Metazoa - 5; Fungi - 135; Plants - 888; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 621234-622433)

Genome position     
from initiation codon
AT1G02813.1         
AT1G02816.1         
TSS from cDNA
TSS information
AT1G02810                        5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G02810

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+618263-21
TSS clone peakCclone+618264-20
TSS clone peakAclone+618265-19
TSS cloneTclone+618266-18

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTATATAAACC+618229618240-55-44
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGCGTTTT+618105618113-179-171
 AtREG633ACGCGTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG566 CGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone+621462AT1G02816.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTCCC+621496621505AT1G02816.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCATGGGCCTTAA+621227621238AT1G02816.1
 AtREG504CATGGGCC     PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
 AtREG354 ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353  TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351   GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG416    GGCCTTAA PPDB Motif  PLACE Motif 
REGTAAGCCCAAAATTAGCCCAT+621327621346AT1G02816.1
 AtREG426TAAGCCCA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469  AGCCCAAA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529   GCCCAAAA          PPDB MotifGCCCA  PLACE Motif 
 AtREG571           TTAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581            TAGCCCAT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATGGGCTTA+621394621402AT1G02816.1
 AtREG378ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426 TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATGACACGTGTCG+621406621418AT1G02816.1
 AtREG438ATGACACG     ABA PPDB Motif  PLACE Motif 
 AtREG389 TGACACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG366  GACACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG478     ACGTGTCGABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.