version
PlantPromoterDB promoter information of AT1G03030.1

Summary of Gene (AT1G03030.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G03030  TAIR      NCBI 
Gene model AT1G03030.1  
Description phosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: kinase activity, phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uridine kinase (InterPro:IPR000764); Has 1794 Blast hits to 1794 proteins in 581 species: Archae - 7; Bacteria - 1124; Metazoa - 151; Fungi - 173; Plants - 39; Viruses - 0; Other Eukaryotes - 300 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 700621-701820)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G03030.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G03030.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+701519-102

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+701477-144
TSS cloneTclone+701478-143
TSS cloneGclone+701530-91

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTTCCTC+701493701504-128-117
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGCCCAGT+701359701367-262-254
 AtREG458TGGCCCAG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384 GGCCCAGT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGGCCTTTT+701434701441-187-180
 AtREG459GGCCTTTT PPDB Motif  PLACE Motif 
REGATGACACGTGTCT+701455701467-166-154
 AtREG438ATGACACG     ABA PPDB Motif  PLACE Motif 
 AtREG389 TGACACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG366  GACACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG470     ACGTGTCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.