PlantPromoterDB promoter information of AT1G03220

Summary of Gene (AT1G03220)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G03220 TAIR NCBI
Gene model	AT1G03220
Description	extracellular dermal glycoprotein, putative / EDGP, putative; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: response to salt stress; LOCATED IN: cell wall, plasma membrane, membrane, plant-type cell wall; EXPRESSED IN: stem, root, callus, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: extracellular dermal glycoprotein, putative / EDGP, putative (TAIR:AT1G03230.1); Has 790 Blast hits to 787 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 790; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 786143-787342)

`Genome position from initiation codon` `AT1G03220.1 TSS from cDNA TSS information AT1G03220 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G03220

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 89 + 787124 -19

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	89	+	787124	-19

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone + 787122 -21

TSS clone A clone + 787124 -19

TSS clone A clone + 787125 -18

TSS clone T clone + 787128 -15

TSS clone C clone + 787129 -14

TSS clone T clone + 787134 -9

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	+	787122	-21
TSS clone	`A`	clone	+	787124	-19
TSS clone	`A`	clone	+	787125	-18
TSS clone	`T`	clone	+	787128	-15
TSS clone	`C`	clone	+	787129	-14
TSS clone	`T`	clone	+	787134	-9

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TGTCTATAAATA + 787088 787099 -55 -44

Y Patch CCTCTTCTTC + 787108 787117 -35 -26

Y Patch TCTTCTCC + 787162 787169 19 26

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TGTCTATAAATA`	+	787088	787099	-55	-44
Y Patch	`CCTCTTCTTC`	+	787108	787117	-35	-26
Y Patch	`TCTTCTCC`	+	787162	787169	19	26
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG AAAGTCAA + 787009 787016 -134 -127

AtREG632 AAAGTCAA PPDB Motif PLACE Motif TTGAC

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`AAAGTCAA`		+	787009	787016	-134	-127
	AtREG632	`AAAGTCAA`		PPDB Motif		PLACE Motif	`TTGAC`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None