version
PlantPromoterDB promoter information of AT1G03890.1

Summary of Gene (AT1G03890.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G03890  TAIR      NCBI 
Gene model AT1G03890.1  
Description cupin family protein; FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf, seed; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710), 11-S plant seed storage protein (InterPro:IPR006044); BEST Arabidopsis thaliana protein match is: CRA1 (CRUCIFERINA); nutrient reservoir (TAIR:AT5G44120.3); Has 691 Blast hits to 656 proteins in 126 species: Archae - 0; Bacteria - 61; Metazoa - 2; Fungi - 0; Plants - 627; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 988250-989449)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G03890.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G03890.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+989198-52
TSS cloneAclone+989200-50
TSS clone peakCclone+989213-37
TSS cloneTclone+989214-36
TSS cloneTclone+989216-34
TSS cloneAclone+989218-32
TSS cloneTclone+989225-25

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCCGGTTAAA+989113989124-137-126
 AtREG644TTTCCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621  TCCGGTTA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501   CCGGTTAA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG645    CGGTTAAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.