version
PlantPromoterDB promoter information of AT1G04070

Summary of Gene (AT1G04070)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G04070  TAIR      NCBI 
Gene model AT1G04070  
Description Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.  
#
#

Overview

Focused view (chromosome 1: 1052116-1050917)

Genome position     
from initiation codon
AT1G04070.1         
TSS from cDNA
TSS information
AT1G04070                        5'->3' (-)
Promoter sequence







 
AT1G04080.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G04070

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5-1051179-63

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-1051167-51

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTC-10511321051139-16-23
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTTAATGGGCCTAC-10512321051245-116-129
 AtREG604CTTAATGG       PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG      PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361   AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354    ATGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358     TGGGCCTA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG435      GGGCCTAC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAAATGGG-10512571051264-141-148
 AtREG443TAAATGGG PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGTTA-10512671051275-151-159
 AtREG401GGCCCGTT  PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 
 AtREG399 GCCCGTTA PPDB MotifACGGGC  PLACE MotifYAACKG, CNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA13+1051371AT1G04080.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+1051371AT1G04080.1
TSS cloneAclone+1051378AT1G04080.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCTCTTC+10513551051364AT1G04080.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGCTTTAA+10512101051217AT1G04080.1
 AtREG545GGCTTTAA PPDB Motif  PLACE Motif 
REGGTAGGCCCATTAAG+10512321051245AT1G04080.1
 AtREG435GTAGGCCC       PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358 TAGGCCCA      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  AGGCCCAT     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357    GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396     CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604      CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGCCCATTTA+10512571051264AT1G04080.1
 AtREG443CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGTAACGGGCC+10512671051275AT1G04080.1
 AtREG399TAACGGGC  PPDB MotifACGGGC  PLACE MotifYAACKG, CNGTTR 
 AtREG401 AACGGGCC PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.