version
PlantPromoterDB promoter information of AT1G04350.1

Summary of Gene (AT1G04350.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G04350  TAIR      NCBI 
Gene model AT1G04350.1  
Description encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase  
#
#

Overview

Focused view (chromosome 1: 1164296-1165495)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G04350.1                      5'->3' (+)
Promoter sequence









 
AT1G04340.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G04350.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+1165239-57

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+1165213-83
TSS cloneTclone+1165240-56
TSS cloneTclone+1165242-54
TSS cloneTclone+1165244-52
TSS cloneAclone+1165245-51
TSS cloneAclone+1165268-28
TSS cloneAclone+1165279-17

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTTCTTCTTCTT+11652181165233-78-63
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAACCGAA+11649511164960-345-336
 AtREG473TTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACCGGAC+11650411165050-255-246
 AtREG542AAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573  AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGTCGTTTC+11651521165160-144-136
 AtREG569TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576 GTCGTTTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-1164851AT1G04340.1
TSS clone peakAclone-1164816AT1G04340.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxATTATATAAATT-11648761164887AT1G04340.1
Y PatchCGTCTCTC-11647931164800AT1G04340.1
Y PatchTTTCTCTCT-11648601164868AT1G04340.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGGTTCAATTCGGTTTAG-11649151164932AT1G04340.1
 AtREG640CGGTTCAA           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568        TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514         TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511          CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTTAA-11649511164960AT1G04340.1
 AtREG568TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473  CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTCCGGTTTT-11650411165050AT1G04340.1
 AtREG573GTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542  CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.