version
PlantPromoterDB promoter information of AT1G04850.1

Summary of Gene (AT1G04850.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G04850  TAIR      NCBI 
Gene model AT1G04850.1  
Description ubiquitin-associated (UBA)/TS-N domain-containing protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), PUG (InterPro:IPR006567), Zinc finger, C2H2-type (InterPro:IPR007087), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48690.1); Has 17438 Blast hits to 9965 proteins in 571 species: Archae - 30; Bacteria - 1031; Metazoa - 7907; Fungi - 1971; Plants - 445; Viruses - 50; Other Eukaryotes - 6004 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 1369706-1368507)

Genome position     
from initiation codon
AT1G04860.1         
TSS from cDNA
TSS information
AT1G04850.1                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G04850.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG17-1368741-35

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-1368779-73
TSS cloneAclone-1368777-71
TSS cloneAclone-1368774-68
TSS cloneTclone-1368744-38
TSS cloneTclone-1368742-36
TSS cloneGclone-1368739-33
TSS cloneAclone-1368737-31

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGAACCG-13688261368833-120-127
 AtREG640TTGAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGAACCGGT-13688451368853-139-147
 AtREG480TGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528 GAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGAACCGGAAA-13688581368867-152-161
 AtREG579GAACCGGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 AACCGGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644  ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCTAAACCGA-13688921368900-186-194
 AtREG511CTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCAAACCG-13689181368925-212-219
 AtREG550CCAAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGGGTCGA-13689811368988-275-282
 AtREG539CGGGTCGA PPDB Motif  PLACE Motif 
REGGGGTATTT-13689991369006-293-300
 AtREG602GGGTATTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.