version
PlantPromoterDB promoter information of AT1G05860.1

Summary of Gene (AT1G05860.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G05860  TAIR      NCBI 
Gene model AT1G05860.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31600.1); Has 51 Blast hits to 50 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 1768061-1769260)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G05860.1                      5'->3' (+)
Promoter sequence











 
AT1G05850.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence













 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G05860.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTTTCTCTCTCCC+17690251769041-36-20
Y PatchCCTTCTTCTTCC+176908517690962435
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTGGGCCCTA+17688131768823-248-238
 AtREG612TGTGGGCC   DREB1Aox PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG400  TGGGCCCT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG387   GGGCCCTA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTATGGCCCATTGGGCTTTTA+17689261768945-135-116
 AtREG479TATGGCCC             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG437 ATGGCCCA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490  TGGCCCAT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG551    GCCCATTG         PPDB MotifGCCCA  PLACE Motif 
 AtREG461       CATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG402        ATTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407         TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376          TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409           GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG549            GGCTTTTA PPDB Motif  PLACE Motif 
REGGTAAGGCC+17689471768954-114-107
 AtREG530GTAAGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA300-1768663AT1G05850.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-1768695AT1G05850.1
TSS cloneGclone-1768690AT1G05850.1
TSS cloneCclone-1768665AT1G05850.1
TSS cloneAclone-1768663AT1G05850.1
TSS cloneAclone-1768662AT1G05850.1
TSS cloneAclone-1768659AT1G05850.1
TSS cloneTclone-1768656AT1G05850.1
TSS cloneTclone-1768654AT1G05850.1
TSS cloneCclone-1768652AT1G05850.1
TSS cloneAclone-1768648AT1G05850.1
TSS cloneTclone-1768647AT1G05850.1
TSS cloneGclone-1768639AT1G05850.1
TSS cloneAclone-1768637AT1G05850.1
TSS cloneTclone-1768612AT1G05850.1
TSS cloneTclone-1768574AT1G05850.1
TSS cloneTclone-1768562AT1G05850.1
TSS cloneTclone-1768137AT1G05850.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCCT-17686501768658AT1G05850.1
Y PatchTTTCTTCTTCCTCCTCTCTTTC-17686661768687AT1G05850.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATCCAACGG-17687291768737AT1G05850.1
 AtREG586ATCCAACG  PPDB MotifCCAACGG  PLACE Motif 
 AtREG554 TCCAACGG PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
REGTAGGGCCCACA-17688131768823AT1G05850.1
 AtREG387TAGGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG400 AGGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG612   GGCCCACADREB1Aox PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTAAAAGCCCAATGGGCCATA-17689261768945AT1G05850.1
 AtREG549TAAAAGCC             PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC            PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402    AGCCCAAT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG461     GCCCAATG        PPDB MotifGCCCA  PLACE Motif 
 AtREG551        CAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361         AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490          ATGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437           TGGGCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG479            GGGCCATA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGGGCCTTAC-17689471768954AT1G05850.1
 AtREG530GGCCTTAC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.