version
PlantPromoterDB promoter information of AT1G06220.2

Summary of Gene (AT1G06220.2)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G06220  TAIR      NCBI 
Gene model AT1G06220.2  
Description Encodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS.  
#
#

Overview

Focused view (chromosome 1: 1899524-1900723)

Genome position     
from initiation codon
AT1G06220.1         
TSS from cDNA
TSS information
AT1G06220.2                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G06220.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+1900016-508

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+1899964-560

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAAACGC+18997451899752-779-772
 AtREG585CAAAACGC PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
REGAACCCGGTTTAC+18998021899813-722-711
 AtREG516AACCCGGT     PPDB Motif  PLACE Motif 
 AtREG455 ACCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412   CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG519    CGGTTTAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAATTGGGCCGAT+18998441899855-680-669
 AtREG418AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG352 ATTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414  TTGGGCCG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG393   TGGGCCGA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG555    GGGCCGAT PPDB MotifGCCCA  PLACE MotifGGGCC 
REGGACCCGACCC+18998691899878-655-646
 AtREG390GACCCGAC   PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG405 ACCCGACC  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442  CCCGACCC PPDB MotifCCGAC  PLACE MotifCCGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.