PlantPromoterDB promoter information of AT1G06830

Summary of Gene (AT1G06830)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G06830 TAIR NCBI
Gene model	AT1G06830
Description	glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin-like, plant II (InterPro:IPR011905), Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT2G30540.1); Has 650 Blast hits to 649 proteins in 97 species: Archae - 0; Bacteria - 2; Metazoa - 174; Fungi - 56; Plants - 405; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 2096189-2097388)

`Genome position from initiation codon` `AT1G06830.1 TSS from cDNA TSS information AT1G06830 5'->3' (+) Promoter sequence AT1G06820.1 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G06830

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone peak A clone + 2097151 -38

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone peak	`A`	clone	+	2097151	-38

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box GTTATAAATA + 2097116 2097125 -73 -64

Y Patch CTTCCCTC + 2097106 2097113 -83 -76

Y Patch CTCCTTTC + 2097143 2097150 -46 -39

Y Patch CTTCTTCTTCTTC + 2097161 2097173 -28 -16

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`GTTATAAATA`	+	2097116	2097125	-73	-64
Y Patch	`CTTCCCTC`	+	2097106	2097113	-83	-76
Y Patch	`CTCCTTTC`	+	2097143	2097150	-46	-39
Y Patch	`CTTCTTCTTCTTC`	+	2097161	2097173	-28	-16
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG GGTTCGGT + 2096999 2097006 -190 -183

AtREG451 GGTTCGGT PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`GGTTCGGT`		+	2096999	2097006	-190	-183
	AtREG451	`GGTTCGGT`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone peak A clone - 2096506 AT1G06820.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone peak	`A`	clone	-	2096506	AT1G06820.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG TTAAAGGC - 2096693 2096700 AT1G06820.1

AtREG639 TTAAAGGC PPDB Motif AAACG(C/G) PLACE Motif