version
PlantPromoterDB promoter information of AT1G11475.1

Summary of Gene (AT1G11475.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G11475  TAIR      NCBI 
Gene model AT1G11475.1  
Description Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB10.  
#
#

Overview

Focused view (chromosome 1: 3861520-3862719)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G11475.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G11475.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+3862438-82

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+3862438-82

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGTCAGA+38621393862147-381-373
 AtREG625ACCGTCAG  PPDB Motif  PLACE Motif 
 AtREG622 CCGTCAGA PPDB Motif  PLACE Motif 
REGTTAAACCGGA+38622863862295-234-225
 AtREG473TTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTGACTTT+38623043862311-216-209
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGCGTCGTTT+38623363862343-184-177
 AtREG415CGTCGTTT PPDB Motif  PLACE Motif 
REGACGACGTCGTTTA+38623713862383-149-137
 AtREG431ACGACGTCGT    PPDB MotifACGT  PLACE MotifACGT 
 AtREG493   ACGTCGTT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG415    CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG565     GTCGTTTA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.