version
PlantPromoterDB promoter information of AT1G11870.3

Summary of Gene (AT1G11870.3)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G11870  TAIR      NCBI 
Gene model AT1G11870.3  
Description Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  
#
#

Overview

Focused view (chromosome 1: 4002895-4004094)

Genome position     
from initiation codon
AT1G11860.1         
AT1G11860.2         
AT1G11870.1         
AT1G11870.2         
TSS from cDNA
TSS information
AT1G11870.3                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G11870.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakT4+4002995-900
TSS peakA4+4003122-773
TSS peakG5+4003874-21

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+4003877-18

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTCCTC+40029994003010-896-885
Y PatchTCTTCTTC+40038664003873-29-22
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTATACCGG+40027004002707-1195-1188
 AtREG629TATACCGG PPDB Motif  PLACE Motif 
REGGAAACGACA+40028544002862-1041-1033
 AtREG576GAAACGAC  PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA PPDB Motif  PLACE Motif 
REGTGGGCTCACATGGGCCATA+40028914002909-1004-986
 AtREG485TGGGCTCA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG504        CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
 AtREG490         ATGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437          TGGGCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG479           GGGCCATA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTGTCGTTTT+40037204003728-175-167
 AtREG569TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG520 GTCGTTTT PPDB Motif  PLACE Motif 
REGAACACGTGGCAA+40037644003775-131-120
 AtREG590AACACGTG    ABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG382 ACACGTGG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG367  CACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG379   ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG452    CGTGGCAA PPDB Motif  PLACE MotifGCCAC 
REGAAACGACA+40037974003804-98-91
 AtREG569AAACGACA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.