PlantPromoterDB promoter information of AT1G12110

Summary of Gene (AT1G12110)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G12110 TAIR NCBI
Gene model	AT1G12110
Description	Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium.

#

Overview

Focused view (chromosome 1: 4104341-4105540)

`Genome position from initiation codon` `AT1G12110.1 TSS from cDNA TSS information AT1G12110 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G12110

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 49 + 4105238 -103

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	49	+	4105238	-103

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 4105233 -108

TSS clone A clone + 4105238 -103

TSS clone C clone + 4105239 -102

TSS clone A clone + 4105241 -100

TSS clone A clone + 4105251 -90

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	4105233	-108
TSS clone	`A`	clone	+	4105238	-103
TSS clone	`C`	clone	+	4105239	-102
TSS clone	`A`	clone	+	4105241	-100
TSS clone	`A`	clone	+	4105251	-90

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box GTATAAATA + 4105202 4105210 -139 -131

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`GTATAAATA`	+	4105202	4105210	-139	-131
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG CAAGCCCAC + 4104949 4104957 -392 -384

AtREG525 CAAGCCCA PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG518 AAGCCCAC PPDB Motif GCCCA PLACE Motif TGGGCY

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`CAAGCCCAC`		+	4104949	4104957	-392	-384
	AtREG525	`CAAGCCCA`		PPDB Motif	`GCCCA`	PLACE Motif	`TGGGCY`
	AtREG518	`AAGCCCAC`		PPDB Motif	`GCCCA`	PLACE Motif	`TGGGCY`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None