version
PlantPromoterDB promoter information of AT1G12780

Summary of Gene (AT1G12780)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G12780  TAIR      NCBI 
Gene model AT1G12780  
Description Encodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress.  
#
#

Overview

Focused view (chromosome 1: 4351820-4350621)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G12780                        5'->3' (-)
Promoter sequence

 
AT1G12760.1         
AT1G12760.2         
AT1G12770.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G12780

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA49-4358224-104

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-4358326-206
TSS cloneAclone-4358255-135
TSS cloneAclone-4358233-113
TSS cloneCclone-4358226-106
TSS cloneCclone-4358225-105
TSS cloneAclone-4358224-104
TSS cloneTclone-4358223-103
TSS cloneAclone-4358220-100

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTTC-43582124358219-92-99
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCACT-43583244358331-204-211
 AtREG510AGCCCACT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA13+4351215AT1G12770.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+4351215AT1G12770.1
TSS cloneTclone+4351216AT1G12770.1
TSS cloneAclone+4351253AT1G12770.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTTC+43512274351234AT1G12770.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACCGGTTTAT+43511254351134AT1G12770.1
 AtREG436ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598  CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGACCCGGTT+43511404351148AT1G12770.1
 AtREG463GACCCGGT  PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 
 AtREG455 ACCCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTCCGGTTTGG+43511534351163AT1G12770.1
 AtREG573GTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496  CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550   CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.