PlantPromoterDB promoter information of AT1G12780
Summary of Gene (AT1G12780)
|
Overview
|
Focused view (chromosome 1: 4375270-4374071)
|
Genome position
from initiation codon TSS from cDNA TSS information AT1G12780 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G12780
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 49 | - | 4358224 | -104 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 4358326 | -206 |
| TSS clone | A | clone | - | 4358255 | -135 |
| TSS clone | A | clone | - | 4358233 | -113 |
| TSS clone | C | clone | - | 4358226 | -106 |
| TSS clone | C | clone | - | 4358225 | -105 |
| TSS clone | A | clone | - | 4358224 | -104 |
| TSS clone | T | clone | - | 4358223 | -103 |
| TSS clone | A | clone | - | 4358220 | -100 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCTTCTTC | - | 4358212 | 4358219 | -92 | -99 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | AGCCCACT | - | 4358324 | 4358331 | -204 | -211 | |||
| AtREG510 | AGCCCACT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone peak | T | clone | - | 4375169 | AT1G12830.1 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | TTGGCCCAGTATTAGCCCATTTA | + | 4375228 | 4375250 | AT1G12840.1 | ||||
| AtREG484 | TTGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG458 | TGGCCCAG | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG384 | GGCCCAGT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG434 | GCCCAGTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG571 | TTAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG581 | TAGCCCAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG372 | AGCCCATT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG386 | GCCCATTT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG443 | CCCATTTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | TAAATGGGCTAATACTGGGCCAA | - | 4375228 | 4375250 | AT1G12830.1 | ||||
| AtREG443 | TAAATGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG386 | AAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG372 | AATGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG581 | ATGGGCTA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG571 | TGGGCTAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG434 | TACTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG384 | ACTGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG458 | CTGGGCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG484 | TGGGCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||