PlantPromoterDB promoter information of AT1G12780
Summary of Gene (AT1G12780)
|
Overview
|
Focused view (chromosome 1: 4376120-4374921)
|
Genome position
from initiation codon TSS from cDNA TSS information AT1G12780 5'->3' (-) Promoter sequence AT1G12840.1
TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT1G12780
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 49 | - | 4358224 | -104 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 4358326 | -206 |
| TSS clone | A | clone | - | 4358255 | -135 |
| TSS clone | A | clone | - | 4358233 | -113 |
| TSS clone | C | clone | - | 4358226 | -106 |
| TSS clone | C | clone | - | 4358225 | -105 |
| TSS clone | A | clone | - | 4358224 | -104 |
| TSS clone | T | clone | - | 4358223 | -103 |
| TSS clone | A | clone | - | 4358220 | -100 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCTTCTTC | - | 4358212 | 4358219 | -92 | -99 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | AGCCCACT | - | 4358324 | 4358331 | -204 | -211 | |||
| AtREG510 | AGCCCACT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS peak | A | 46 | + | 4375515 | AT1G12840.1 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone peak | T | clone | - | 4375169 | AT1G12830.1 |
| TSS clone | G | clone | + | 4375516 | AT1G12840.1 |
| TSS clone | G | clone | + | 4375517 | AT1G12840.1 |
| TSS clone | C | clone | + | 4375518 | AT1G12840.1 |
| TSS clone | A | clone | + | 4375519 | AT1G12840.1 |
| TSS clone | G | clone | + | 4375572 | AT1G12840.1 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | GTATATAAT | + | 4375483 | 4375491 | AT1G12840.1 | |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | TAAATGGGCTAATACTGGGCCAA | - | 4375228 | 4375250 | AT1G12830.1 | ||||
| AtREG443 | TAAATGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG386 | AAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG372 | AATGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG581 | ATGGGCTA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG571 | TGGGCTAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG434 | TACTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG384 | ACTGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG458 | CTGGGCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG484 | TGGGCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| REG | GTCCGGTTTT | - | 4375333 | 4375342 | AT1G12830.1 | ||||
| AtREG573 | GTCCGGTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG521 | TCCGGTTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG542 | CCGGTTTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | ATTGCCAC | - | 4375369 | 4375376 | AT1G12830.1 | ||||
| AtREG654 | ATTGCCAC | PPDB Motif | PLACE Motif | GCCAC | |||||
| REG | CCGGTTTAA | - | 4375433 | 4375441 | AT1G12830.1 | ||||
| AtREG412 | CCGGTTTA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG473 | CGGTTTAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | CAAACCGGT | - | 4375459 | 4375467 | AT1G12830.1 | ||||
| AtREG496 | CAAACCGG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG436 | AAACCGGT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | TTGGCCCAGTATTAGCCCATTTA | + | 4375228 | 4375250 | AT1G12840.1 | ||||
| AtREG484 | TTGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG458 | TGGCCCAG | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG384 | GGCCCAGT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG434 | GCCCAGTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG571 | TTAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG581 | TAGCCCAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG372 | AGCCCATT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG386 | GCCCATTT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG443 | CCCATTTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | AAAACCGGAC | + | 4375333 | 4375342 | AT1G12840.1 | ||||
| AtREG542 | AAAACCGG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG521 | AAACCGGA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG573 | AACCGGAC | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | GTGGCAAT | + | 4375369 | 4375376 | AT1G12840.1 | ||||
| AtREG654 | GTGGCAAT | PPDB Motif | PLACE Motif | GCCAC | |||||
| REG | TTAAACCGG | + | 4375433 | 4375441 | AT1G12840.1 | ||||
| AtREG473 | TTAAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG412 | TAAACCGG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | ACCGGTTTG | + | 4375459 | 4375467 | AT1G12840.1 | ||||
| AtREG436 | ACCGGTTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG496 | CCGGTTTG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||