version
PlantPromoterDB promoter information of AT1G13870.1

Summary of Gene (AT1G13870.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G13870  TAIR      NCBI 
Gene model AT1G13870.1  
Description Encodes a homolog of the yeast TOT4/KTI12 protein. Yeast TOT4/KTI12 associates with Elongator, a multisubunit complex that binds the RNA polymerase II transcription elongation complex. Ds insertion mutant has enlarged shoot apical region, 4 to 6 long slender leaves followed by spike-like structures, short roots.  
#
#

Overview

Focused view (chromosome 1: 4749345-4748146)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G13870.1                      5'->3' (-)
Promoter sequence






 
AT1G13880.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G13870.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-4748642-297

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATCTATAAG-47486684748676-323-331
Y PatchCTTTCTTC-47486284748635-283-290
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAACCGGTTC-47486794748690-334-345
 AtREG473TTAAACCG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528    ACCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAACCGGAC-47486994748708-354-363
 AtREG496CAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573  AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGCTAAACCGGAC-47487304748740-385-395
 AtREG511CTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573   AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2+4748982AT1G13880.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+4748874AT1G13880.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTTCTTCC+47490144749025AT1G13880.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGGTTTAA+47486834748690AT1G13880.1
 AtREG473CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTCCGGTTTG+47486994748708AT1G13880.1
 AtREG573GTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496  CCGGTTTG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTCCGGTTTAG+47487304748740AT1G13880.1
 AtREG573GTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511   CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.