PlantPromoterDB promoter information of AT1G14000.1

Summary of Gene (AT1G14000.1)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G14000 TAIR NCBI
Gene model	AT1G14000.1
Description	Encodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling.

#

Overview

Focused view (chromosome 1: 4796606-4797805)

`Genome position from initiation codon` `TSS from cDNA TSS information AT1G14000.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G14000.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 5 + 4797443 -163

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	5	+	4797443	-163

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone + 4797409 -197

TSS clone A clone + 4797411 -195

TSS clone G clone + 4797444 -162

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	+	4797409	-197
TSS clone	`A`	clone	+	4797411	-195
TSS clone	`G`	clone	+	4797444	-162

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CATCTCTCTCTCCCTCTCTCC + 4797414 4797434 -192 -172

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CATCTCTCTCTCCCTCTCTCC`	+	4797414	4797434	-192	-172
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG AGTCGGTC + 4797233 4797240 -373 -366

AtREG638 AGTCGGTC DREB1Aox, ABA PPDB Motif CCGAC PLACE Motif CCGAC, RCCGAC

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`AGTCGGTC`		+	4797233	4797240	-373	-366
	AtREG638	`AGTCGGTC`	DREB1Aox, ABA	PPDB Motif	`CCGAC`	PLACE Motif	`CCGAC, RCCGAC`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None