PlantPromoterDB promoter information of AT1G14960

Summary of Gene (AT1G14960)

Organism	Arabidopsis thaliana
Chromosome	1
Locus	AT1G14960 TAIR NCBI
Gene model	AT1G14960
Description	major latex protein-related / MLP-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: major latex protein-related / MLP-related (TAIR:AT1G14950.1); Has 230 Blast hits to 208 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 230; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

#

Overview

Focused view (chromosome 1: 5159042-5157843)

`Genome position from initiation codon` `AT1G14950.1 TSS from cDNA TSS information AT1G14960 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G14960

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 8 - 5160083 -91

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	8	-	5160083	-91

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone - 5160081 -89

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	-	5160081	-89

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TGTCTATATAAAGG - 5160105 5160118 -113 -126

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TGTCTATATAAAGG`	-	5160105	5160118	-113	-126
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TAAAAGCC - 5160171 5160178 -179 -186

AtREG549 TAAAAGCC PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TAAAAGCC`		-	5160171	5160178	-179	-186
	AtREG549	`TAAAAGCC`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone - 5158253 AT1G14950.1

TSS clone C clone - 5158224 AT1G14950.1

TSS clone A clone - 5158219 AT1G14950.1

TSS clone T clone - 5158218 AT1G14950.1

TSS clone peak A clone - 5158199 AT1G14950.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	-	5158253	AT1G14950.1
TSS clone	`C`	clone	-	5158224	AT1G14950.1
TSS clone	`A`	clone	-	5158219	AT1G14950.1
TSS clone	`T`	clone	-	5158218	AT1G14950.1
TSS clone peak	`A`	clone	-	5158199	AT1G14950.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None