PlantPromoterDB promoter information of AT1G15270.1

Summary of Gene (AT1G15270.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G15270  TAIR      NCBI 
Gene model AT1G15270.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  


Focused view (chromosome 1: 5253020-5251821)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AT1G15270.1                      5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

TSS tag distribution(+)

TSS tag distribution(-)


Promoter Summary of AT1G15270.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
TSS peakA8-5252095-75

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS cloneGclone-5252096-76
TSS cloneTclone-5252094-74
TSS cloneAclone-5252093-73
TSS cloneCclone-5252092-72
TSS cloneGclone-5252090-70
TSS cloneTclone-5252089-69

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATTATAAATA-52521255252135-105-115
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 AtREG459GGCCTTTT            PPDB Motif  PLACE Motif 
 AtREG357       TAATGGGC     PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
TSS peakA4+5252297AT1G15280.1, AT1G15280.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS cloneGclone+5252315AT1G15280.1, AT1G15280.2
TSS cloneTclone+5252317AT1G15280.1, AT1G15280.2
TSS cloneCclone+5252318AT1G15280.1, AT1G15280.2

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGTAAATGGGCT+52521615252170AT1G15280.1, AT1G15280.2
REGTATGGCCCATTAAAAGGCC+52521805252198AT1G15280.1, AT1G15280.2
 AtREG357    GCCCATTA        PPDB MotifGCCCA  PLACE Motif 
 AtREG459           AAAAGGCC PPDB Motif  PLACE Motif 
REGTTTTGGGCCCGTTAAA+52522105252225AT1G15280.1, AT1G15280.2

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.