version
PlantPromoterDB promoter information of AT1G15280.1

Summary of Gene (AT1G15280.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G15280  TAIR      NCBI 
Gene model AT1G15280.1  
Description glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 5251538-5252737)

Genome position     
from initiation codon
AT1G15280.2         
TSS from cDNA
TSS information
AT1G15280.1                      5'->3' (+)
Promoter sequence







 
AT1G15270.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G15280.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+5252297-241

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+5252315-223
TSS cloneTclone+5252317-221
TSS cloneCclone+5252318-220

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAATGGGCT+52521615252170-377-368
 AtREG443TAAATGGG   PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTATGGCCCATTAAAAGGCC+52521805252198-358-340
 AtREG479TATGGCCC            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG437 ATGGCCCA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490  TGGCCCAT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357    GCCCATTA        PPDB MotifGCCCA  PLACE Motif 
 AtREG396     CCCATTAA       PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG459           AAAAGGCC PPDB Motif  PLACE Motif 
REGTTTTGGGCCCGTTAAA+52522105252225-328-313
 AtREG529TTTTGGGC         PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392  TTGGGCCC       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG401     GGCCCGTT    PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 
 AtREG399      GCCCGTTA   PPDB MotifACGGGC  PLACE MotifYAACKG, CNGTTR 
 AtREG610        CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8-5252095AT1G15270.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-5252096AT1G15270.1
TSS cloneTclone-5252094AT1G15270.1
TSS cloneAclone-5252093AT1G15270.1
TSS cloneCclone-5252092AT1G15270.1
TSS cloneGclone-5252090AT1G15270.1
TSS cloneTclone-5252089AT1G15270.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATTATAAATA-52521255252135AT1G15270.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGCCCATTTA-52521615252170AT1G15270.1
 AtREG372AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386 GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443  CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGGGCCTTTTAATGGGCCATA-52521805252198AT1G15270.1
 AtREG459GGCCTTTT            PPDB Motif  PLACE Motif 
 AtREG396      TTAATGGG      PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357       TAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361        AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490         ATGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437          TGGGCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG479           GGGCCATA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTTTAACGGGCCCAAAA-52522105252225AT1G15270.1
 AtREG610TTTAACGG         PPDB Motif  PLACE MotifYAACKG, CNGTTR 
 AtREG399  TAACGGGC       PPDB MotifACGGGC  PLACE MotifYAACKG, CNGTTR 
 AtREG401   AACGGGCC      PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 
 AtREG392      GGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373       GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529        GCCCAAAA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.