version
PlantPromoterDB promoter information of AT1G16040

Summary of Gene (AT1G16040)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G16040  TAIR      NCBI 
Gene model AT1G16040  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI biosynthesis protein Pig-F (InterPro:IPR009580); Has 210 Blast hits to 210 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 80; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 5503747-5504946)

Genome position     
from initiation codon
AT1G16040.1         
TSS from cDNA
TSS information
AT1G16040                        5'->3' (+)
Promoter sequence














 
AT1G16030.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence













 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G16040

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+5504682-65
TSS peakG4+5504726-21

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+5504735-12
TSS cloneAclone+5504736-11

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATATAGA+55046405504647-107-100
Y PatchCGTCTTCTTTCTTC+55046955504708-52-39
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGGCAC+55044845504491-263-256
 AtREG444CGTGGCAC PPDB Motif  PLACE MotifGCCAC 
REGTAAATGGGCCTATTAAAGCCCATAT+55045955504619-152-128
 AtREG443TAAATGGG                  PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   ATGGGCCT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358    TGGGCCTA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362     GGGCCTAT             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG424      GGCCTATT            PPDB Motif  PLACE Motif 
 AtREG545            TTAAAGCC      PPDB Motif  PLACE Motif 
 AtREG365             TAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376              AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378               AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477                AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432                 GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGTAGGCCCGT+55046315504640-116-107
 AtREG435GTAGGCCC   PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG429  AGGCCCGT PPDB MotifACGGGC  PLACE MotifGGGCC 
REGAAAAGGCCCAGT+55046505504661-97-86
 AtREG459AAAAGGCC     PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410   AGGCCCAG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384    GGCCCAGT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA13-5504533AT1G16030.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-5504535AT1G16030.1
TSS cloneCclone-5504532AT1G16030.1
TSS cloneTclone-5504407AT1G16030.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATATGGGCTTTAATAGGCCCATTTA-55045955504619AT1G16030.1
 AtREG432ATATGGGC                  PPDB MotifGCCCA  PLACE Motif 
 AtREG477 TATGGGCT                 PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA              PPDB MotifGCCCA  PLACE Motif 
 AtREG545     GGCTTTAA             PPDB Motif  PLACE Motif 
 AtREG424           AATAGGCC       PPDB Motif  PLACE Motif 
 AtREG362            ATAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358             TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354              AGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361               GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG386                GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443                 CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGACGGGCCTAC-55046315504640AT1G16030.1
 AtREG429ACGGGCCT   PPDB MotifACGGGC  PLACE MotifGGGCC 
 AtREG435  GGGCCTAC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGACTGGGCCTTTT-55046505504661AT1G16030.1
 AtREG384ACTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410 CTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353  TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359   GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG459    GGCCTTTT PPDB Motif  PLACE Motif 
REGAAAAGCCC-55048115504818AT1G16030.1
 AtREG409AAAAGCCC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.