version
PlantPromoterDB promoter information of AT1G18080

Summary of Gene (AT1G18080)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G18080  TAIR      NCBI 
Gene model AT1G18080  
Description Encodes the Arabidopsis thaliana homolog of the tobacco WD-40 repeat ArcA gene.  
#
#

Overview

Focused view (chromosome 1: 6221325-6222524)

Genome position     
from initiation codon
AT1G18080.1         
TSS from cDNA
TSS information
AT1G18080                        5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G18080

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG156+6222262-63

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+6222256-69
TSS cloneTclone+6222259-66
TSS cloneGclone+6222262-63
TSS cloneTclone+6222263-62
TSS cloneTclone+6222265-60
TSS cloneCclone+6222269-56
TSS cloneTclone+6222295-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATAAATA+62222216222230-104-95
Y PatchCCTTCTTCTT+62222516222260-74-65
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGCCCATATA+62220156222025-310-300
 AtREG581TAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477 AGCCCATA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432  GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620   CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGGGCTTTTA+62220536222060-272-265
 AtREG549GGCTTTTA PPDB Motif  PLACE Motif 
REGATATGGGCTGA+62221256222135-200-190
 AtREG432ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG477 TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG609   TGGGCTGA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATAAGCCCATTAA+62221376222149-188-176
 AtREG462ATAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357    GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396     CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGTGAGCCCATAT+62221786222188-147-137
 AtREG485TGAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477  AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432   GCCCATAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.