version
PlantPromoterDB promoter information of AT1G19710.1

Summary of Gene (AT1G19710.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G19710  TAIR      NCBI 
Gene model AT1G19710.1  
Description glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G75420.1); Has 4243 Blast hits to 4240 proteins in 780 species: Archae - 115; Bacteria - 2336; Metazoa - 83; Fungi - 27; Plants - 65; Viruses - 0; Other Eukaryotes - 1617 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 6813920-6815119)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G19710.1                      5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G19710.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+6814806-114

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+6814793-127

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCTCT+68147966814805-124-115
Y PatchCTTTCTCC+68148246814831-96-89
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCTTTTA+68146296814636-291-284
 AtREG549GGCTTTTA PPDB Motif  PLACE Motif 
REGAATAGGCCTTTTAAAGCCCATTAT+68146406814663-280-257
 AtREG424AATAGGCC                 PPDB Motif  PLACE Motif 
 AtREG649 ATAGGCCT                PPDB Motif  PLACE Motif 
 AtREG459    GGCCTTTT             PPDB Motif  PLACE Motif 
 AtREG545          TTAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365           TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376            AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378             AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372              AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357               GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG546                CCCATTAT PPDB Motif  PLACE Motif 
REGAAACGGCA+68147016814708-219-212
 AtREG500AAACGGCA PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAAACGGCGT+68147316814740-189-180
 AtREG531AAAACGGC   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG524 AAACGGCG  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG497  AACGGCGT PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.