version
PlantPromoterDB promoter information of AT1G21710.1

Summary of Gene (AT1G21710.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G21710  TAIR      NCBI 
Gene model AT1G21710.1  
Description Encodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme.  
#
#

Overview

Focused view (chromosome 1: 7623439-7624638)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G21710.1                      5'->3' (+)
Promoter sequence




 
AT1G21700.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G21710.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4+7624411-28

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGTTAAAGTCAA+76242657624277-174-162
 AtREG645CGGTTAAA      PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG632     AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGTTCGGTTT+76242847624291-155-148
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACCGAA+76243157624322-124-117
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTTCGGTT+76243347624341-105-98
 AtREG556GTTCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAAACCGGTTT+76243597624370-80-69
 AtREG473TTAAACCG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2-7624135AT1G21700.1
TSS peakA2-7624124AT1G21700.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxAATATATAGAG-76241567624166AT1G21700.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGACTTTAACCG-76242657624277AT1G21700.1
 AtREG632TTGACTTT      PPDB Motif  PLACE MotifTTGAC 
 AtREG645     TTTAACCG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGAAACCGAA-76242847624291AT1G21700.1
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTT-76243157624322AT1G21700.1
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCGAAC-76243347624341AT1G21700.1
 AtREG556AACCGAAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAAACCGGTTTAA-76243597624372AT1G21700.1
 AtREG436  AAACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473TTAAACCGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.